CN104694452B - A kind of recombined bacillus subtilis and its construction method of high yield Pullulanase - Google Patents

Abstract

The invention discloses the recombined bacillus subtilis and its construction method of a kind of high yield Pullulanase.The recombined bacillus subtilis of the high yield Pullulanase constructs acquisition by the following method: will be used to express artificial operons' BPB construction recombination plasmid pGE-BPB of Pullulanase；The nucleotide sequence of the artificial operons BPB is as shown in SEQ ID NO.4；The recombinant plasmid pGE-BPB of aforementioned building is converted into bacillus subtilis bacterium competence cell, so that artificial operons BPB is substituted the neutral protease gene nprE in bacillus subtilis bacterium competence cell in situ by secondary recombination.The present invention is since the Pullulanase of the resistance to acid heat gene of optimization original strain, utilize the method for synthetic biology, a variety of molecular elements that gene transcription level can be improved are assembled into an artificial operons, building obtains recombinant bacillus bacillus, the recombinant bacterial strain can ferment high yield Pullulanase, and unit enzyme activity meets or exceeds 300U/ml.

Description

A kind of recombined bacillus subtilis and its construction method of high yield Pullulanase

Technical field

The invention belongs to bacillus subtilis recombinant bacterial strain constructing technology fields, and in particular to a kind of high yield Pullulanase Recombined bacillus subtilis and its construction method.

Background technique

Pullulanase is a kind of starch solution branch enzyme expressed by microorganism secretion, and I type Pullulanase being capable of specificity incision α -1 in amylopectin branch, 6 glycosidic bonds form amylose, and Pullulanase and other amylases act on, in starch There are important purposes and good market prospects in processing industry.Therefore, a large amount of manpowers of countries in the world investment, financial resources exploitation are general The production bacterial strain of Shandong orchid enzyme, so far, it has been found that many microorganisms can generate Pullulanase, but since current industry is raw Production condition (acid resistance, high temperature resistant condition) is limited, and the produced Pullulanase of most of microbe has no too big commercial value, is sent out Existing most of Pullulanases cannot meet the production requirement of the high temperature-resistant acid-resistant in starch processing industry simultaneously, and zymologic property is deposited The disadvantages of thermal stability is not high, acid-resisting is not strong.

Pullulanase (Bn PulB) optimum temperature 62.5 from Nagano bacillus (Bacillus naganoensis) DEG C, optimal pH hereinafter, best catalytic temperature is at 60 DEG C or so, is very suitable to saccharification processing, but table of the enzyme in opportunistic pathogen 5.0 It is not able to satisfy industry's enlarging production demand up to amount, and Bacillus subtillis is listed in safe microorganisms because secretion capacity is powerful One of (GRAS), it is fully compatible for the industrial production of food-grade Pullulanase, it is the micro- life of first choice for carrying out ectoenzyme fermenting and producing One of object, common type strain Bacillus subtillis Bacillus subtilis W168 (hereinafter referred to as Bacillus subtillis 168) Pullulanase is not produced, is easy to be modified, is the desirable strain for carrying out recombination Pullulanase production building.

Relatively simple direct method is transformed to microorganism at present, is that target gene is building up in plasmid, then Plasmid is transferred to the bacterial strain of transformation, because independently duplicated plasmid is not stablized like the duplication of genome, generally require to lead to It crosses and adds antibiotic in the medium to increase the stability of plasmid in bacterial strain.But in the food industry, this recombinant bacterial strain It needs using antibiotic, and the recombinant bacterial strain for carrying antibiotic resistance gene is not received increasingly.Therefore, the nothing of foreign gene is carried out For trace lead-in mode at the main building mode of structuring food prods industrial microorganism, this mode is homologous by carrying out with microorganism Recombination, and secondary recombination screening is carried out, obtain the production bacterial strain of nonreactive.

Summary of the invention

It is an object of the present invention to provide the recombined bacillus subtilis and its construction method of a kind of high yield Pullulanase.Purport It is asked solving the technology that the produced Pullulanase thermal stability of microorganism is not high, acid-resisting is not strong, yield is not high in the prior art Topic.

Used technical solution is as follows to solve above-mentioned technical problem by the present invention:

A kind of recombined bacillus subtilis of high yield Pullulanase, the recombined bacillus subtilis obtain in the following way : the artificial operons BPB containing expression Pullulanase gene is substituted to the neutral protease gene of bacillus subtilis in situ nprE；The nucleotide sequence of the artificial operons BPB is as shown in SEQ ID NO.4.

Preferably, the recombinant bacillus gemma bar is constructed as starting strain using type strain bacillus subtilis 168 Bacterium.

The artificial operons BPB is transferred in bacillus subtilis by recombinant plasmid pGE-BPB, the recombinant plasmid The nucleotide sequence of pGE-BPB is as shown in SEQ ID NO.1.

The artificial operons BPB includes series connection Artificial promoters Pga2.The core of the series connection Artificial promoters Pga2 Nucleotide sequence is as shown in SEQ ID NO.2, it is spliced by PyxiE promoter and cry3A RNA stable factor, cry3A The decay phase of mRNA can be improved in RNA stable factor, improves the expression quantity of albumen, the preparation of promoter Pga2 is by chemical synthesis It completes.

The artificial operons BPB also includes: the pulB gene obtained through codon optimization, the nucleosides of the pulB gene Acid sequence is as shown in SEQ ID NO.3.The pulB gene is right using the highest password of Bacillus subtillis frequency of use as reference Protogene is optimized, and the Pullulanase albumen of expression has the characteristics that resistance to acid heat.

The artificial operons BPB also includes: the signal peptide sequence SPamyL from bacillus licheniformis amylase secretion, And the terminator sequence T-aprE from bacillus amyloliquefaciens aprE gene；The nucleotide sequence of the T-aprE such as SEQ Shown in ID NO.5.

The recombinant plasmid pGE-BPB, in addition to containing artificial operons BPB, also simultaneous with for Bacillus subtillis The recombination arm of neutral proteinase nprE seamless knockout, recombinant plasmid pGE-BPB pass through secondary recombination form for bacillus subtilis Neutral protease gene nprE in bacterium competence cell is knocked out.The recombination arm DNA knocked out for neutral protease gene nprE Nucleotide sequence as shown in SEQ ID NO.6.

The present invention also provides the sides of the recombined bacillus subtilis fermenting and producing Pullulanase of the high yield Pullulanase Method, this method are as follows: 4.5% sucrose is added in basal medium and 6.0% wheat bran adds dregs of beans, controls starting fermentation pH value For 6.2-6.3, fermented and cultured is carried out to the recombined bacillus subtilis under above-mentioned condition of culture, production obtains Propiram Enzyme.

The present invention also provides a kind of construction method of the recombined bacillus subtilis of high yield Pullulanase, this method includes such as Lower step:

Step 1, it will be used to express artificial operons' BPB construction recombination plasmid pGE-BPB of Pullulanase；The artificial behaviour The nucleotide sequence of sub- BPB is indulged as shown in SEQ ID NO.4；

Step 2, the recombinant plasmid pGE-BPB of aforementioned building is converted into bacillus subtilis bacterium competence cell, is passed through Secondary recombination is so that the artificial operons BPB substitutes the neutral protease gene in bacillus subtilis bacterium competence cell in situ nprE。

The recombinant plasmid pGE-BPB passes through secondary recombination form for the neutral egg in bacillus subtilis bacterium competence cell White enzyme gene nprE is knocked out, the nucleotide sequence such as SEQ ID for the neutral protease gene nprE recombination arm DNA knocked out Shown in NO.6.

The construction method of the recombined bacillus subtilis of the high yield Pullulanase presses following completions, first by recombinant plasmid PGE-BPB is transferred in Bacillus subtillis 168, resistant strain is obtained by the culture plate screening containing erythromycin, with Propiram Enzyme gene pulB is template, and design primer after identifying positive colony by PCR, incorporates Pu Lu for what aforementioned screening obtained The resistant strain of blue enzyme and antibiotic resistance gene is inoculated into progress continuous passage culture in not resistant culture medium, after passing 5-6 times, Bacterium solution is diluted to 10³-10⁴Then the cell concentration of/ml carries out coated plate, the monoclonal colonies of acquisition are carried out with the mirror of PCR again It is fixed, determine artificial operons BPB sequence of in-situ instead of the nonreactive of nprE according to the acquisition of Pullulanase gene in recombinant bacterium Recombinant clone.

The present invention also provides a kind of for expressing the gene order of Pullulanase, which is artificial operons The nucleotide sequence of BPB or the nucleotide sequence with artificial operons BPB with 90% or more homology, the artificial manipulation The nucleotide sequence of sub- BPB is as shown in SEQ ID NO.4.

The present invention also provides a kind of for expressing the recombinant plasmid pGE-BPB of Pullulanase, recombinant plasmid pGE-BPB Nucleotide sequence as shown in SEQ ID NO.1.

The present invention also provides a kind of Pullulanase gene, the nucleotide sequence of the Pullulanase gene such as SEQ ID Shown in NO.3.

Compared with prior art, the invention has the benefit that

The present invention, will using the method for synthetic biology since the Pullulanase of the resistance to acid heat gene of optimization original strain A variety of molecular elements that gene transcription level can be improved, including promoter, mRNA stable factor, secretion signal peptide sequence, eventually Only son etc. is assembled into an artificial operons, and by the way that they are building up in recombinant plasmid, recycles Bacillus subtillis certainly Artificial operons' element is integrated into Bacillus subtillis 168 by the upstream and downstream homologous fragment of the neutral protease gene nprE of body Genome, then by way of nonreactive culture, binding molecule biological means carry out the bacterial strain screening after secondary recombination, finally Obtain producing the nonreactive recombinant bacillus bacillus CH-1 of Pullulanase, which can ferment high yield Pullulanase, unit enzyme Work > 300U/ml.

In the present invention, using the neutral protease gene nprE of Bacillus subtillis as homologous recombination object, by secondary heavy After group, the artificial operons for expressing Pullulanase can be substituted into nprE gene in situ, Pullulanase is not only made to obtain recombination table It reaches, the neutral proteinase that also will affect exogenous protein expression level has carried out gene knockout.Influence bacillus foreign protein There are many factor of extracellular expression level, including promoter, mRNA structure, terminator, secreting signal peptide selection etc. including Gene operon structure it is the most key, on the influences such as the promoter of bacillus, RNA stable factor, secreting signal peptide turn Horizontal factor is recorded, domestic and international expert has made numerous studies, and the present invention combines the above influence factor, devises duplex mode Artificial promoters Pga2 contains efficient promoter PyxiA and Cry3A RNA stable factor.Meanwhile expressing the outer of separate sources When the gene of source, the codon selection tendency of different genera specificity seriously affects the translation efficiency of albumen sometimes, so as to cause The low expression level of protein expression level by gene chemical synthesis mode obtains genetic resources Pullulanase gene in the present invention PulB improves the translation efficiency of Pullulanase albumen by way of codon optimization.

Detailed description of the invention

Fig. 1 is the schematic diagram that enzyme activity changes with fermentation time when recombinating fermentation of bacillus subtilis production Pullulanase；

Fig. 2 is recombined bacillus subtilis enzyme activity and Preliminary fermentation pH when fermenting and producing Pullulanase in Optimal Medium The schematic diagram of relationship between value.

Specific embodiment

Technical solution of the present invention is described in detail below with reference to embodiment.The reagent and biomaterial used below It if not otherwise specified, is commercially produced product.

Embodiment 1: the building of recombinant plasmid pGE-BPB

Gene operon BPB for Pullulanase expression includes one by Gene expression Pga2 and has carried out password The gene order and terminator sequence T- of the coding Bn PulB (its nucleotide sequence is as shown in SEQ ID NO.3) of son optimization AprE, wherein Pga2 is to constitute (the nucleotide sequence of Pga2 such as SEQ ID by promoter PyxiE and RNA stable factor CryIIIA Shown in NO.2), the sequence after following initiation codon ATG closely is SPamyL, and relevant nucleotide sequence is by Jin Weizhi biotechnology Company generates genetic fragment using DNA chemical synthesis, and building obtains gene operon BPB, then by BPB grams of gene operon It is grand to arrive plasmid pUC57, generate pUC57-BPB.Both ends are obtained with the BPB in the site Eco RI by PCR, and PCR is obtained by following methods :

Upstream primer: CAAGGAATTCCATGGCCGGCCGACCGGG

Downstream primer: AGCAGAATTCTTATTTACCATCAGATGG

The preparation method of DNA profiling are as follows: take the pUC57-BPB solution of 100ng/ μ l, after 10000 times of dilution, take the 1.0 μ l to be Template.

PCR reaction system is as follows:

10 × Pfx buffer (being purchased from Invitrogen company, ion containing Mg, dNTP mixture etc.) 5.0 μ l；

Upstream primer (10 μM), 3.0 μ l；

Downstream primer (10 μM), 3.0 μ l

DNA profiling, 1.0 μ l；

Pfx polymerase (5U/ μ l), 0.5 μ l；

Add water to 50 μ l.

Following procedure is run on Mastercycler regular-PCR instrument (Eppendorf):

1) 95 DEG C, 2min

2) 94 DEG C, 20sec

3) 55 DEG C, 45sec

4) 68 DEG C, 4min

5) circulation is from 2) to 4), and 30 times

6) 68 DEG C, 3min

7) it 4 DEG C, saves.

PCR product is after Axygen PCR cleaning agents box recovery purifying, with restriction enzyme Eco RI digestion, with warp Eco RI is connected with the linear plasmid DNA pGENE-nprLR of dephosphorylation process with T4DNA ligase, and connection liquid is transferred to large intestine Bacillus DH5 α, the isolated recombinant plasmid pGE-BPB from Escherichia coli.

Embodiment 2: the molecular biology manipulations of the recombinant bacillus bacillus of Pullulanase are produced

1, pGE-BPB is transferred to 168 competent cell of Bacillus subtillis.

The Competent cell of Bacillus subtillis is prepared first, and preparation is completed by training method twice: by withered grass Bacillus 168 activates in LB agar plate, takes monoclonal to cultivate in LB, is transferred in SP I culture medium with 5% volume ratio, Logarithmic growth phase is arrived in 30 DEG C of cultures, and then same volume ratio is transferred to culture in SP II culture medium and receives to logarithmic growth phase, centrifugation Collect cell, then cell precipitation is resuspended in SP II culture medium, forms the concentration competent cell that OD600 is about 5.0.This The formula of SPI culture medium in embodiment are as follows: 0.02% caseinic acid hydrolysate, 0.1% yeast powder, 0.5% glucose, 0.2% (NH₄)₂SO₄, 1.4%K₂HPO₄·3H₂O, 0.6%KH₂PO₄, 0.1% sodium citrate and 0.02%MgSO₄·7H₂O.SPII training Support the formula of base are as follows: 0.04% caseinic acid hydrolysate, 0.2% yeast powder, 1.0% glucose, 0.4% (NH₄)₂SO₄, 2.8% K₂HPO₄·3H₂O, 1.2%KH₂PO₄, 0.2% sodium citrate, 0.5mM CaCl₂And 2.5mM MgCl₂。

When converting 168 competent cell, the recombinant plasmid pGE-BPB of 1.0 μ g is taken, on ice with the competent cell of 50 μ l It mixes well to apply and educates 30min, 5ml LB culture is added based on 37 DEG C of vibrations and cultivates 2hr, is finally concentrated into cell again through being centrifuged 500 μ l therefrom take on 100 μ l coated plates to the culture plate containing selection markers, and 37 DEG C of cultures are cloned to thallus to be generated.

The removal of the competent cell preparation selection markers of Bacillus subtillis is secondary same by what is induced when nonreactive culture Source recombination is completed.Concrete operations are as follows: taking 2 plants of monoclonal colonies containing recombinant plasmid, be inoculated into not antibiotic culture medium In, it is primary with 1% volume ratio passage after 12 hours, after 5 passages, cell concentration is diluted to 10³-10⁴/ ml, then takes 200 μ l are coated on the LB culture plate of antibiotic-free, and the single thallus of 100-200 or so is taken to clone the tolerance mirror for carrying out antibiotic It is fixed, obtain 10 do not tolerate the clone of antibiotic after, they are identified using PCR method, determines the gene of recombinant strain Group type.

2, the genome type of recombinant bacterial strain is identified by PCR method below.

The genomic DNA that bacterial strain is extracted first with AxyPrep genomic DNA kit, takes 1 μ l 50ng/ μ l genome DNA makees pcr template.

PCR primer is divided to two groups, and first group of primer aF/aR is used to identify that the gene of nprE in wild Bacillus subtilis to be special Sign, second group of PCR primer aF/bR is for identifying removal antibiotic resistance gene and incorporating the recombinant bacterial strain of pulB genotype.

First group of primer: aF:tcattcggttagacagcgg

aR:cgtaagcaagacgatagctgccgtc

Second group of primer: aF:tcattcggttagacagcgg

bR:gcgaaaacaggctgaagctgaacatgag

PCR reaction system is as follows:

10 × Pfx buffer (being purchased from Invitrogen company, ion containing Mg, dNTP mixture etc.) 5.0 μ l；

Upstream primer (10 μM), 3.0 μ l；

Downstream primer (10 μM), 3.0 μ l；

DNA profiling, 1.0 μ l；

Pfx polymerase (5U/ μ l), 0.5 μ l；

Add water to 50 μ l.

Following procedure is run on Mastercycler regular-PCR instrument (Eppendorf):

1) 95 DEG C, 2min

2) 95 DEG C, 25sec

3) 56 DEG C, 45sec

4) 68 DEG C, 2min

5) circulation is from 2) to 4), and 30 times

6) 68 DEG C, 3min

7) it 4 DEG C, saves.

The identification of PCR product: taking 3 μ l of PCR product, and DNA electrophoresis is carried out on 1% Ago-Gel.Wild mushroom and again The difference of group bacterium is when using 168 genomic DNA of wild Bacillus subtilis as template, to obtain the DNA product of 0.8kb；And When using recombined bacillus subtilis bacterial strain CH-1 genomic DNA as template, PCR product 2.0kb.

Embodiment 3: recombined bacillus subtilis bacterial strain CH-1 fermenting and producing Pullulanase

Recombined bacillus subtilis bacterial strain CH-1 has carried out fermentation training in the LB culture medium for having added 2% sucrose first It supports: taking monoclonal recombined bacillus subtilis bacterial strain, be inoculated into the culture medium of 5ml, 30 DEG C are incubated overnight, then with 5% Volume ratio is inoculated into the triangular flask of the 500ml equipped with 100ml, carries out fermented and cultured with 200rpm, timing sampling carries out enzyme activity Measurement.

Enzyme activity determination method is as follows: 1.0ml, the vinegar of pH=4.6 being added in the pulullan solution of 1.0ml 0.5% Then the enzyme solution of 1.0ml is added (control group first by 1.0ml enzyme solution boiling water bath 10min), in 60 DEG C of water in acid-sodium-acetate buffer 3,5- dinitrosalicylic acid 3.0ml, boiling water bath 10min is added in water-bath 30min in bath, and flowing water is cooling after taking-up, in 550nm Survey absorbance value.One enzyme activity unit is defined as: under the above-described reaction conditions, decompose pulullan per minute and release 1 μ Enzyme amount needed for mol glucose.

Referring to Fig. 1, which is recombination bacillus subtilis strain CH-1 fermenting and producing Pullulanase in the shaking flask of 100ml When the schematic diagram that changes with fermentation time of enzyme activity.As can be seen from Figure 1: the recombined bacillus subtilis strain fermentation production is general In 48 hours or so enzyme activity highests of fermenting when the orchid enzyme of Shandong, highest enzyme activity is 30.3U/ml.

The enzymatic production mode of Bacillus subtillis is influenced very greatly by culture medium and fermentation method, therefore to Media Components It is optimized, in the basal medium (composition of the basal medium are as follows: 1% peptone, 0.5% (NH₄)₂SO₄, 0.1% KH₂PO₄, 0.025%MgSO₄, 0.0001%FeSO₄) in joined 4.5% sucrose and 6.0% wheat bran+dregs of beans (wherein wheat bran Mass ratio with dregs of beans is 1:1), and controlling starting fermentation pH is 6.23, in the culture medium of optimization, the producing enzyme performance of CH-1 It greatly improves.Referring to fig. 2, the figure be recombined bacillus subtilis in Optimal Medium when fermenting and producing Pullulanase enzyme activity with The schematic diagram of relationship between Preliminary fermentation pH value.As can be seen from Figure 2: when starting fermentation pH is 6.23 or so, in this batch of experiment Enzyme activity peak value is 268U/ml.

After fermentation liquid is centrifuged, by fermented liquid supernatant obtained carry out protein electrophoresis, by with wild type B brood cell The fermentation supernatant of bacillus 168 compares, it can be clearly seen that recombined bacillus subtilis fermented liquid supernatant includes expression The protein band of Pullulanase；And 168 fermentation supernatant of the wild Bacillus subtilis then not no protein band of Pullulanase.

It above are only part preferred embodiment of the invention, the present invention is not limited in the content of embodiment.For ability For technical staff in domain, can there are various change and change in the conception range of technical solution of the present invention, made What changes and change, within that scope of the present invention.

<110>Shanghai Advanced Research Institute, Chinese Academy of Sciences

<120>a kind of recombined bacillus subtilis and its construction method of high yield Pullulanase

<130> 2015

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 8776

<212> DNA

<213>artificial sequence

<400> 1

agctctcgag aagatgatag ctcatcaaaa atcccgccat tgccaaataa atcgtatatg 60

gcattactgc accataatct tttgagattt gattgggata tggcgcaagc agcaagacaa 120

gcagtccgat aatcagcgta taaaataagc ctagtaagat cttatccgtt ctccaataca 180

gcttgaaaaa cactacattc aacgcaatgg gaagagtgat gatgaaaaac agaaacacga 240

atgcaatcgg ctccatccca tccgggtatt ccttccaata cgaaaagaaa ctaaaaatca 300

tttgtacgat cggcaaactg acaacagcaa ggtcgaacgt ataaaactta ccctttccgc 360

catgatcacg cggcatcagc atatagtgaa aagccgtcag cagcacatat ccgtataaca 420

aaaaatgcag cagcggcagc agttcttttc cgtcctctct taagtaagcg ctggtgaagt 480

ttgttgattg cacctggtga ataagttcaa cagacactcc cgccagcagc acaatccgca 540

atataacacc cgccaagaac attgtgcgct gccggtttat tttgggatga tgcaccaaaa 600

gatataagcc cgccagaaca acaattgacc attgaatcag cagggtgctt tgtctgctta 660

atataaaata acgttcgaaa tgcaatacat aatgactgaa taactccaac acgaacaaca 720

atcctttact tcttattaag gcctcattcg gttagacagc ggacttttca aaaagtttca 780

agatgaaaca aaaatatctc atcttcccct tgatatgtaa aaaacataac tcttgaatga 840

accaccacat gacacttgac tcatcttgat attattcaac aaaaacaaac acaggacaat 900

actatcaatt ttgtctagtt atgttagttt ttgttgagta ttccagaatg ctagtttaat 960

ataacaatat aaagttttca gtattttcaa aaagggggat ttattgtggg tgctagcaag 1020

gaattccatg gccggccgac cgggacaatg aaggaaatgg aacatttaac cgcatcaaga 1080

aaaaaagctt caactggtat cagcaggtta tcgccacaaa cggagagagt ctctgacaat 1140

tttttgaaaa ctcatgcgct tcaattgaca ataacgaaat gcaggcggac aataaaagag 1200

aaagatgaac cacccacaga aaggagggat gcctaaaaac gaagaacatt aaaaacatat 1260

atttgcaccg tctaatggat ttatgaaaaa tcattttatc agtttgaaaa ttatgtatta 1320

tgataagaaa gggaggaaga aaatgatcca aaaacgtaaa cgtacagttt ctttccgtct 1380

tgttcttatg tgcacacttc ttttcgtttc tcttcctatc acaaaaacat ctgctgttaa 1440

cctaacgttt caccgcatca ttcgaaaagg atggatgttc ctgctcgcgt ttttgctcac 1500

tgcctcgctg ttctgcccaa caggacagca cgccaaggct gccgcaccgt ttaaccccgg 1560

ggcacaacct gctgtaagta acgcttattt agatgcttcc aaccaagtgt tggtcaagct 1620

tagccagccg tttactcttg gtgaaggttc aagcggtttt acggttcatg atgacacagc 1680

aaataaggat attccagtta catctgttag tgatgccaat caggtaacgg ctgttttagc 1740

aggtactttc cagcatattt ttggggggag tgattgggca ccggataatc acaatacttt 1800

actaaaaaag gtgaatagca atctctatca attttcagga aatcttcctg aaggaaacta 1860

ccaatataaa gtggctttaa atgatagctg gaataatccg agctacccat ctgataacat 1920

taatttgaca gtgccagctg gtggtgccca tgttacattt tcttatatac catccaccca 1980

tgctgtttat gacacgatta acaatcctaa tgcggattta caagtagata gcagcggtgt 2040

taagacggat ctcgtggcgg ttactcttgg agaaaatcct gatgtaagcc ataccctgtc 2100

cattcaaaca gaggactatc aggcaggaca ggtcatacct cgtaaggtgc ttgattcatc 2160

ccagtactac tattccggag atgatctcgg gaatacctat acaaagaatg caactacctt 2220

taaggtctgg gcgcctacat ccactcaagt aaatgtcctt ctttataata gtgcaaccgg 2280

cgcggtaact aaaacggttc caatgaccgc atcaggccat ggtgtatggg aagcaacagt 2340

caaccaagac cttgaaaatt ggtattacat gtatgaggta acaggacaag gctcaacccg 2400

aacggctgtt gatccgtatg caacagctat tgcaccaaac ggaacgagag gcatgattgt 2460

ggacctagcc aaaacagacc cggccggatg ggagagtgac aaacatatta cgccaaagaa 2520

tatagaagat gaagtcatct atgaaatgga tgttcgtgac ttttccatcg actctaattc 2580

gggtatgaaa aataaaggaa agtatttggc acttacagaa aaaggaacta aaggccctga 2640

caatgtaaag acaggggtag attccttaaa acaacttggg attactcatg ttcagcttca 2700

gcctgttttc gcatttaata gtgtcaatga aaacgatcca actcaatata attggggtta 2760

tgaccctcgc aactacaatg ttcctgaggg acaatatgct actaatgcaa acggaacaac 2820

tcggattaaa gagtttaagg aaatggttct ttcactccat caggaccaca ttggggttaa 2880

tatggatgtt gtttataatc atacctttgc cacgcaaatc tctgacttcg ataagattgt 2940

gccagaatat tactaccgca cggatgatgc tggtaactac actaacggct caggtactgg 3000

aaacgaaatc gcagccgaaa gaccaatggt tcaaaaattt attatcgatt cacttaagtt 3060

ttgggtcaat gagtaccacg ttgacggttt ccgttttgac ttaatggcgt tgcttggaaa 3120

agatacaatg tctaaagctg ccacgcagct tcatgccatt gatccaggaa ttgctctcta 3180

cggtgagcca tggacaggag gaacatccgc gctgccagcc gatcagcttt taacaaaagg 3240

agctcaaaaa ggcatgggag tggctgtatt taatgacaat ctgcgaaacg gtttggacgg 3300

cagtgtcttt gattcatctg ctcaaggttt tgcgacaggt gctactggtt taacggatgc 3360

tattaaaaat ggagttgaag gaagtattaa tgacttcacc gcttcaccag gcgagacgat 3420

caactatgtc acaagtcatg ataactatac cctttgggac aagattgccc aaagcaatcc 3480

aaacgattct gaagcggatc gaattaaaat ggatgagctc gctcaagcga tcgtcatgac 3540

ctcacaaggc attcctttca tgcagggcgg ggaagaaatg cttcgtacga aaggcggcaa 3600

cgacaatagc tataatgctg gtgatgtagt gaacgagttt gattggagca gaaaagctca 3660

atatccagat gttttcaatt attatagcgg gctgattcat cttcgtcttg atcacccagc 3720

cttccgcatg acgacagcta atgaaatcaa tagccacctc caattcctaa atagcccaga 3780

gaacacagtg gcctatgaat tatctgatca tgcaaataaa gatacatggg gtaatattgt 3840

ggttatttat aatccaaata aaacggcaga aaccattaat ttgccaagcg ggaaatggga 3900

aatcaatgcg acgagcggta aggtgggaga atccacactt ggtcaagcag agggcagtgt 3960

tcaagttcca ggcatatcta tgatgattct tcatcaagaa gtaagcccat ctgatggtaa 4020

ataagaattc tgctacaggt cacgtggcta tgtgaaggat cgcgcgtcca gttaagagca 4080

aaaacattga caaaaaaatt tatttatgct aaaatttact attaatatat ttgtatgtat 4140

aataagattc tcctggccag gggaatctta ttttttgtgg aggatcattt catgaggaaa 4200

aatgagtcca gcttaacgtc tctaatttca gcttttgccc gtgcatatca cagccgatat 4260

gacacacctc ttatttttga tgattttatc gcaaaagatc tcattaacga aaaagagttt 4320

atcgacatca gtaaaaatat gattcaagaa atatcgtttt tcaacaaaga gatcgccgaa 4380

cgtcttcaaa atgatcctga aaaaatatta aaatgggttg cacaaatcca gctgtctcca 4440

acgcccctag cacgtgcttc ttattgtgaa aaagtcttgc acaacgaatt aatcctgggg 4500

gcaaaacagt atgtcattct tggagcggga ctggatactt tctgctttcg gcatccagaa 4560

ttagaaaaca gcttacaggt tttcgaggtt gatcatccgg ccacacagca attgaaaaaa 4620

aataagctga aggatgcaaa tctgacaatt ccgggtcatc ttcattttgt tcctatggat 4680

ttcaccaaaa cgttttcgta tgatcctctc ttagatgaag gatttaaaaa cacaaaaaca 4740

ttcttcagcc ttctcggagt gtcttattat gtaacacggg aagaaaatgc aagcttgatc 4800

agcaatttat tttctcatgt cccgcctgga acccgggtta aaccgtgtgc tctacgacca 4860

aaactataaa acctttaaga actttctttt tttacaagaa aaaagaaatt agataaatct 4920

ctcatatctt ttattcaata atcgcatccg attgcagtat aaatttaacg atcactcatc 4980

atgttcatat ttatcagagc tcgtgctata attatactaa ttttataagg aggaaaaaat 5040

atgggcattt ttagtatttt tgtaatcagc acagttcatt atcaaccaaa caaaaaataa 5100

gtggttataa tgaatcgtta ataagcaaaa ttcatataac caaattaagg agggaaataa 5160

tgaacgagaa aaatataaaa cacagtcaaa actttattac ttcaaaacat aatatagata 5220

aaataatgac aaatataaga ttaaatgaac atgataatat ctttgaaatc ggctcaggaa 5280

aaggccattt tacccttgaa ttagtaaaga ggtgtaattt cgtaactgcc attgaaatag 5340

accataaatt atgcaaaact acagaaaata aacttgttga tcacgataat ttccaagttt 5400

taaacaagga tatattgcag tttaaatttc ctaaaaacca atcctataaa atatatggta 5460

atatacctta taacataagt acggatataa tacgcaaaat tgtttttgat agtatagcta 5520

atgagattta tttaatcgtg gaatacgggt ttgctaaaag attattaaat acaaaacgct 5580

cattggcatt acttttaatg gcagaagttg atatttctat attaagtatg gttccaagag 5640

aatattttca tcctaaacct aaagtgaata gctcacttat cagattaagt agaaaaaaat 5700

caagaatatc acacaaagat aaacaaaagt ataattattt cgttatgaaa tgggttaaca 5760

aagaatacaa gaaaatattt acaaaaaatc aatttaacaa ttccttaaaa catgcaggaa 5820

ttgacgattt aaacaatatt agctttgaac aattcttatc tcttttcaat agctataaat 5880

tatttaataa gtaagttaag ggatgcataa actgcatccc ttaacttgtt tttcgtgtgc 5940

ctattttttg tgaattgatt atcgatcttt tgcgccatgg atccgcggcg cgcccatatg 6000

catgcactag tgtcgacaag cttctagatc tactagcgca gcttaattaa cctaggctgc 6060

tgccaccgct gagcaataac tagcataacc ccttggggcc tctaaacggg tcttgagggg 6120

ttttttgctg aaaggcggcc gctgttccgg atctgcatcg caggatgctg ctggctaccc 6180

tgtggaacac ctacatctgt attaacgaag cgctggcatt gaccctgagt gatttttctc 6240

tggtcccgcc gcatccatac cgccagttgt ttaccctcac aacgttccag taaccgggca 6300

tgttcatcat cagtaacccg tatcgtgagc atcctctctc gtttcatcgg tatcattacc 6360

cccatgaaca gaaatccccc ttacacggag gcatcagtga ccaaacagga aaaaaccgcc 6420

cttaacatgg cccgctttat cagaagccag acattaacgc ttctggagaa actcaacgag 6480

ctggacgcgg atgaacaggc agacatctgt gaatcgcttc acgaccacgc tgatgagctt 6540

taccgcagct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc 6600

ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc 6660

gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg tagcgatagc 6720

ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata 6780

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg 6840

cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc 6900

actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt 6960

gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc 7020

ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa 7080

acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc 7140

ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg 7200

cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc 7260

tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc 7320

gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca 7380

ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact 7440

acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg 7500

gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt 7560

ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct 7620

tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga 7680

gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa 7740

tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac 7800

ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga 7860

taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc 7920

cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca 7980

gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta 8040

gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct gcaggcatcg 8100

tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc 8160

gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg 8220

ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt 8280

ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt 8340

cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca acacgggata 8400

ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc 8460

gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac 8520

ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa 8580

ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct 8640

tcctttttca atattattga agcatttatc agggttattg tctcatgagc ggatacatat 8700

ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc 8760

cacctgacgt cttaag 8776

<210> 2

<211> 317

<212> DNA

<213>artificial sequence

<400> 2

ccatggccgg ccgaccggga caatgaagga aatggaacat ttaaccgcat caagaaaaaa 60

agcttcaact ggtatcagca ggttatcgcc acaaacggag agagtctctg acaatttttt 120

gaaaactcat gcgcttcaat tgacaataac gaaatgcagg cggacaataa aagagaaaga 180

tgaaccaccc acagaaagga gggatgccta aaaacgaaga acattaaaaa catatatttg 240

caccgtctaa tggatttatg aaaaatcatt ttatcagttt gaaaattatg tattatgata 300

agaaagggag gaagaaa 317

<210> 3

<211> 2580

<212> DNA

<213>artificial sequence

<400> 3

ctaacgtttc accgcatcat tcgaaaagga tggatgttcc tgctcgcgtt tttgctcact 60

gcctcgctgt tctgcccaac aggacagcac gccaaggctg ccgcaccgtt taaccccggg 120

gcacaacctg ctgtaagtaa cgcttattta gatgcttcca accaagtgtt ggtcaagctt 180

agccagccgt ttactcttgg tgaaggttca agcggtttta cggttcatga tgacacagca 240

aataaggata ttccagttac atctgttagt gatgccaatc aggtaacggc tgttttagca 300

ggtactttcc agcatatttt tggggggagt gattgggcac cggataatca caatacttta 360

ctaaaaaagg tgaatagcaa tctctatcaa ttttcaggaa atcttcctga aggaaactac 420

caatataaag tggctttaaa tgatagctgg aataatccga gctacccatc tgataacatt 480

aatttgacag tgccagctgg tggtgcccat gttacatttt cttatatacc atccacccat 540

gctgtttatg acacgattaa caatcctaat gcggatttac aagtagatag cagcggtgtt 600

aagacggatc tcgtggcggt tactcttgga gaaaatcctg atgtaagcca taccctgtcc 660

attcaaacag aggactatca ggcaggacag gtcatacctc gtaaggtgct tgattcatcc 720

cagtactact attccggaga tgatctcggg aatacctata caaagaatgc aactaccttt 780

aaggtctggg cgcctacatc cactcaagta aatgtccttc tttataatag tgcaaccggc 840

gcggtaacta aaacggttcc aatgaccgca tcaggccatg gtgtatggga agcaacagtc 900

aaccaagacc ttgaaaattg gtattacatg tatgaggtaa caggacaagg ctcaacccga 960

acggctgttg atccgtatgc aacagctatt gcaccaaacg gaacgagagg catgattgtg 1020

gacctagcca aaacagaccc ggccggatgg gagagtgaca aacatattac gccaaagaat 1080

atagaagatg aagtcatcta tgaaatggat gttcgtgact tttccatcga ctctaattcg 1140

ggtatgaaaa ataaaggaaa gtatttggca cttacagaaa aaggaactaa aggccctgac 1200

aatgtaaaga caggggtaga ttccttaaaa caacttggga ttactcatgt tcagcttcag 1260

cctgttttcg catttaatag tgtcaatgaa aacgatccaa ctcaatataa ttggggttat 1320

gaccctcgca actacaatgt tcctgaggga caatatgcta ctaatgcaaa cggaacaact 1380

cggattaaag agtttaagga aatggttctt tcactccatc aggaccacat tggggttaat 1440

atggatgttg tttataatca tacctttgcc acgcaaatct ctgacttcga taagattgtg 1500

ccagaatatt actaccgcac ggatgatgct ggtaactaca ctaacggctc aggtactgga 1560

aacgaaatcg cagccgaaag accaatggtt caaaaattta ttatcgattc acttaagttt 1620

tgggtcaatg agtaccacgt tgacggtttc cgttttgact taatggcgtt gcttggaaaa 1680

gatacaatgt ctaaagctgc cacgcagctt catgccattg atccaggaat tgctctctac 1740

ggtgagccat ggacaggagg aacatccgcg ctgccagccg atcagctttt aacaaaagga 1800

gctcaaaaag gcatgggagt ggctgtattt aatgacaatc tgcgaaacgg tttggacggc 1860

agtgtctttg attcatctgc tcaaggtttt gcgacaggtg ctactggttt aacggatgct 1920

attaaaaatg gagttgaagg aagtattaat gacttcaccg cttcaccagg cgagacgatc 1980

aactatgtca caagtcatga taactatacc ctttgggaca agattgccca aagcaatcca 2040

aacgattctg aagcggatcg aattaaaatg gatgagctcg ctcaagcgat cgtcatgacc 2100

tcacaaggca ttcctttcat gcagggcggg gaagaaatgc ttcgtacgaa aggcggcaac 2160

gacaatagct ataatgctgg tgatgtagtg aacgagtttg attggagcag aaaagctcaa 2220

tatccagatg ttttcaatta ttatagcggg ctgattcatc ttcgtcttga tcacccagcc 2280

ttccgcatga cgacagctaa tgaaatcaat agccacctcc aattcctaaa tagcccagag 2340

aacacagtgg cctatgaatt atctgatcat gcaaataaag atacatgggg taatattgtg 2400

gttatttata atccaaataa aacggcagaa accattaatt tgccaagcgg gaaatgggaa 2460

atcaatgcga cgagcggtaa ggtgggagaa tccacacttg gtcaagcaga gggcagtgtt 2520

caagttccag gcatatctat gatgattctt catcaagaag taagcccatc tgatggtaaa 2580

<210> 4

<211> 3010

<212> DNA

<213>artificial sequence

<400> 4

gaattccatg gccggccgac cgggacaatg aaggaaatgg aacatttaac cgcatcaaga 60

aaaaaagctt caactggtat cagcaggtta tcgccacaaa cggagagagt ctctgacaat 120

tttttgaaaa ctcatgcgct tcaattgaca ataacgaaat gcaggcggac aataaaagag 180

aaagatgaac cacccacaga aaggagggat gcctaaaaac gaagaacatt aaaaacatat 240

atttgcaccg tctaatggat ttatgaaaaa tcattttatc agtttgaaaa ttatgtatta 300

tgataagaaa gggaggaaga aaatgatcca aaaacgtaaa cgtacagttt ctttccgtct 360

tgttcttatg tgcacacttc ttttcgtttc tcttcctatc acaaaaacat ctgctgttaa 420

cctaacgttt caccgcatca ttcgaaaagg atggatgttc ctgctcgcgt ttttgctcac 480

tgcctcgctg ttctgcccaa caggacagca cgccaaggct gccgcaccgt ttaaccccgg 540

ggcacaacct gctgtaagta acgcttattt agatgcttcc aaccaagtgt tggtcaagct 600

tagccagccg tttactcttg gtgaaggttc aagcggtttt acggttcatg atgacacagc 660

aaataaggat attccagtta catctgttag tgatgccaat caggtaacgg ctgttttagc 720

aggtactttc cagcatattt ttggggggag tgattgggca ccggataatc acaatacttt 780

actaaaaaag gtgaatagca atctctatca attttcagga aatcttcctg aaggaaacta 840

ccaatataaa gtggctttaa atgatagctg gaataatccg agctacccat ctgataacat 900

taatttgaca gtgccagctg gtggtgccca tgttacattt tcttatatac catccaccca 960

tgctgtttat gacacgatta acaatcctaa tgcggattta caagtagata gcagcggtgt 1020

taagacggat ctcgtggcgg ttactcttgg agaaaatcct gatgtaagcc ataccctgtc 1080

cattcaaaca gaggactatc aggcaggaca ggtcatacct cgtaaggtgc ttgattcatc 1140

ccagtactac tattccggag atgatctcgg gaatacctat acaaagaatg caactacctt 1200

taaggtctgg gcgcctacat ccactcaagt aaatgtcctt ctttataata gtgcaaccgg 1260

cgcggtaact aaaacggttc caatgaccgc atcaggccat ggtgtatggg aagcaacagt 1320

caaccaagac cttgaaaatt ggtattacat gtatgaggta acaggacaag gctcaacccg 1380

aacggctgtt gatccgtatg caacagctat tgcaccaaac ggaacgagag gcatgattgt 1440

ggacctagcc aaaacagacc cggccggatg ggagagtgac aaacatatta cgccaaagaa 1500

tatagaagat gaagtcatct atgaaatgga tgttcgtgac ttttccatcg actctaattc 1560

gggtatgaaa aataaaggaa agtatttggc acttacagaa aaaggaacta aaggccctga 1620

caatgtaaag acaggggtag attccttaaa acaacttggg attactcatg ttcagcttca 1680

gcctgttttc gcatttaata gtgtcaatga aaacgatcca actcaatata attggggtta 1740

tgaccctcgc aactacaatg ttcctgaggg acaatatgct actaatgcaa acggaacaac 1800

tcggattaaa gagtttaagg aaatggttct ttcactccat caggaccaca ttggggttaa 1860

tatggatgtt gtttataatc atacctttgc cacgcaaatc tctgacttcg ataagattgt 1920

gccagaatat tactaccgca cggatgatgc tggtaactac actaacggct caggtactgg 1980

aaacgaaatc gcagccgaaa gaccaatggt tcaaaaattt attatcgatt cacttaagtt 2040

ttgggtcaat gagtaccacg ttgacggttt ccgttttgac ttaatggcgt tgcttggaaa 2100

agatacaatg tctaaagctg ccacgcagct tcatgccatt gatccaggaa ttgctctcta 2160

cggtgagcca tggacaggag gaacatccgc gctgccagcc gatcagcttt taacaaaagg 2220

agctcaaaaa ggcatgggag tggctgtatt taatgacaat ctgcgaaacg gtttggacgg 2280

cagtgtcttt gattcatctg ctcaaggttt tgcgacaggt gctactggtt taacggatgc 2340

tattaaaaat ggagttgaag gaagtattaa tgacttcacc gcttcaccag gcgagacgat 2400

caactatgtc acaagtcatg ataactatac cctttgggac aagattgccc aaagcaatcc 2460

aaacgattct gaagcggatc gaattaaaat ggatgagctc gctcaagcga tcgtcatgac 2520

ctcacaaggc attcctttca tgcagggcgg ggaagaaatg cttcgtacga aaggcggcaa 2580

cgacaatagc tataatgctg gtgatgtagt gaacgagttt gattggagca gaaaagctca 2640

atatccagat gttttcaatt attatagcgg gctgattcat cttcgtcttg atcacccagc 2700

cttccgcatg acgacagcta atgaaatcaa tagccacctc caattcctaa atagcccaga 2760

gaacacagtg gcctatgaat tatctgatca tgcaaataaa gatacatggg gtaatattgt 2820

ggttatttat aatccaaata aaacggcaga aaccattaat ttgccaagcg ggaaatggga 2880

aatcaatgcg acgagcggta aggtgggaga atccacactt ggtcaagcag agggcagtgt 2940

tcaagttcca ggcatatcta tgatgattct tcatcaagaa gtaagcccat ctgatggtaa 3000

ataagaattc 3010

<210> 5

<211> 46

<212> DNA

<213>artificial sequence

<400> 5

tagtaaaaag aagcaggttc ctccatacct gcttcttttt aagctt 46

<210> 6

<211> 2024

<212> DNA

<213>artificial sequence

<400> 6

aacccgacat ccggcgttct catggcggtg cttgccgcca gcggtattcc gtatgtcaag 60

tggctgcggt ttatggtgcc gcttgctctg atttggttct tgatcgggct tgtctttatc 120

gtgatcggag tcatgatcaa ttgggggccg ttttaacgat tgctgcccgc cggcttgtac 180

ggcgggcttt tgagttattc attgcagaag cgcaggctgt tattgtaaca tgtaagccat 240

aagccattcg taaaagtgcg ggaggaaggt catgaataat ctgcgtaata gactttcagg 300

cgtgaatggg aaaaataaga gagtaaaaga aaaagaacaa aaaatctggt cggagattgg 360

gatgatagcg ggagcatttg cgctgcttga tgtgatcatc cgcggcatta tgtttgaatt 420

tccgtttaaa gaatgggctg caagccttgt gtttttgttc atcattatct tatattactg 480

catcagggct gcggcatccg gaatgctcat gccgagaata gacaccaaag aagaactgca 540

aaaacgggtg aagcagcagc gaatagaatc aattgcggtc gcctttgcgg tagtggtgct 600

tacgatgtac gacaggggga ttccccatac attcttcgct tggctgaaaa tgattcttct 660

ttttatcgtc tgcggcggcg ttctgtttct gcttcggtat gtgattgtga agctggctta 720

cagaagagcg gtaaaagaag aaataaaaaa gaaatcatct tttttgtttg gaaagcgagg 780

gaagcgttca cagtttcggg cagctttttt tataggaaca ttgatttgta ttcactctgc 840

caagttgttt tgatagagtg attgtgataa ttttaaatgt aagcgttaac aaaattctcc 900

agtcttcaca tcggtttgaa aggaggaagc ggaagaatga agtaagaggg atttttgact 960

ccgaagtaag tcttcaaaaa atcaaataag gagtgtcaag gctagcaagg aattcttagg 1020

taccgggcaa ggctagacgg gacttaccga aagaaaccat caatgatggt ttcttttttg 1080

ttcataaatc agacaaaact tttctcttgc aaaagtttgt gaagtgttgc acaatataaa 1140

tgtgaaatac ttcacaaaca aaaagacatc aaagagaaac ataccctgga aggatgatta 1200

atgatgaaca aacatgtaaa taaagtagct ttaatcggag cgggttttgt tggaagcagt 1260

tatgcatttg cgttaattaa ccaaggaatc acagatgagc ttgtggtcat tgatgtaaat 1320

aaagaaaaag caatgggcga tgtgatggat ttaaaccacg gaaaggcgtt tgcgccacaa 1380

ccggtcaaaa catcttacgg aacatatgaa gactgcaagg atgctgatat tgtctgcatt 1440

tgcgccggag caaaccaaaa acctggtgag acacgccttg aattagtaga aaagaacttg 1500

aagattttca aaggcatcgt tagtgaagtc atggcgagcg gatttgacgg cattttctta 1560

gtcgcgacaa atccggttga tatcctgact tacgcaacat ggaaattcag cggcctgcca 1620

aaagagcggg tgattggaag cggcacaaca cttgattctg cgagattccg tttcatgctg 1680

agcgaatact ttggcgcagc gcctcaaaac gtacacgcgc atattatcgg agagcacggc 1740

gacacagagc ttcctgtttg gagccacgcg aatgtcggcg gtgtgccggt cagtgaactc 1800

gttgagaaaa acgatgcgta caaacaagag gagctggacc aaattgtaga tgatgtgaaa 1860

aacgcagctt accatatcat tgagaaaaaa ggcgcgactt attatggggt tgcgatgagt 1920

cttgctcgca ttacaaaagc cattcttcat aatgaaaaca gcatattaac tgtcagcaca 1980

tatttggacg ggcaatacgg tgcagatgac gtgtacatcg gtgt 2024

Claims (2)

1. a kind of construction method of the recombined bacillus subtilis of high yield Pullulanase, it is characterised in that: the general Shandong of expression will be contained The artificial operons BPB of blue enzyme gene substitutes the neutral protease gene nprE of bacillus subtilis in situ, obtains the recombination Bacillus subtilis；The nucleotide sequence of the artificial operons BPB is as shown in SEQ ID NO.4；

The artificial operons BPB is transferred in bacillus subtilis by recombinant plasmid pGE-BPB, the recombinant plasmid pGE- The nucleotide sequence of BPB is as shown in SEQ ID NO.1；The artificial operons BPB includes to obtain through codon optimization PulB gene, the nucleotide sequence of the pulB gene is as shown in SEQ ID NO.3；

The construction method of the recombined bacillus subtilis includes the following steps:

Step 1, it will be used to express artificial operons' BPB construction recombination plasmid pGE-BPB of Pullulanase；The artificial operons The nucleotide sequence of BPB is as shown in SEQ ID NO.4；

Step 2, recombinant plasmid pGE-BPB is converted into bacillus subtilis bacterium competence cell, the recombinant plasmid pGE-BPB The neutral protease gene nprE in bacillus subtilis bacterium competence cell is knocked out by secondary recombination form, specific as follows: Recombinant plasmid pGE-BPB is transferred in Bacillus subtillis 168, resistance bacterium is obtained by the culture plate screening containing erythromycin Strain, using Pullulanase gene pulB as template, design primer, after identifying positive colony by PCR, by the integration of screening acquisition The resistant strain of Pullulanase and antibiotic resistance gene is inoculated into progress continuous passage culture in not resistant culture medium, passes 5- After 6 times, bacterium solution is diluted to 10³-10⁴Then the cell concentration of/ml carries out coated plate, carry out again to the monoclonal colonies of acquisition The identification of PCR determines artificial operons' BPB sequence of in-situ instead of nprE according to the acquisition of Pullulanase gene in recombinant bacterium Nonreactive recombinant clone.

2. the method for the recombined bacillus subtilis fermenting and producing Pullulanase of high yield Pullulanase described in claim 1, This method are as follows: 4.5% sucrose and 6.0% wheat bran+dregs of beans are added in basal medium, wherein the quality of wheat bran and dregs of beans Ratio is 1:1, and control starting fermentation pH value is 6.2-6.3, carries out fermented and cultured to the recombined bacillus subtilis, production obtains Obtain Pullulanase.