CN108728466A - A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line - Google Patents

A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line Download PDF

Info

Publication number
CN108728466A
CN108728466A CN201810587974.2A CN201810587974A CN108728466A CN 108728466 A CN108728466 A CN 108728466A CN 201810587974 A CN201810587974 A CN 201810587974A CN 108728466 A CN108728466 A CN 108728466A
Authority
CN
China
Prior art keywords
lefteye flounder
cell
carrier
plasmid vector
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810587974.2A
Other languages
Chinese (zh)
Inventor
王旭波
俞海洋
张全启
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ocean University of China
Original Assignee
Ocean University of China
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ocean University of China filed Critical Ocean University of China
Priority to CN201810587974.2A priority Critical patent/CN108728466A/en
Publication of CN108728466A publication Critical patent/CN108728466A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a kind of to realize that the expression vector that efficient stable transfects, carrier of the present invention use Tol2 transposons in lefteye flounder fish, and the plasmid pCS-TP cotransfections of transposase are synthesized in conjunction with coding can significantly improve the ability that lefteye flounder fry cell integrates foreign gene.Invention carrier is added to neomycin resistance selection markers, to realize the mode for relying solely on traditional liposome transfection and adding resistance screening, you can obtain more recombinant cell, greatly improve the screening of lefteye flounder fry cell to the efficiency for surely turning cell line.Invention carrier is added to EGFP fluorescence labels, can convenient tracer be transferred to cell line foreign gene expression.It is prior, carrier of the present invention substitutes common CMV promoter in traditional mammalian expression vector using the lefteye flounder β-actin promoters after optimization, creative obtains a kind of carrier more adapting to lefteye flounder fry cell system exogenous gene expression, to realize foreign gene in the various cell lines of lefteye flounder fish can efficient stable expression.

Description

A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line
Technical field
The invention belongs to biotechnologies, and in particular to a kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line.
Background technology
Cell transfecting is the know-how that exogenous molecules such as RNA, DNA are imported to cell, now has become molecular biology With research gene function conventional means in cell biology.Currently, the more common method of cell transfecting has liposome method, electricity to wear Hole method and viral infection.Electroporation relies on the voltage breakdown cell membrane of instantaneous high impulse, to import exogenous plasmid It is applied widely to intracellular, but operate upper relatively complicated, and lethality is higher after cell transfecting, transfects required cell It is larger with amount of DNA, so being seldom applicable in during cell line transfection.Viral infection carries DNA by virus and infects carefully Born of the same parents, and then on the genome of exogenous origin gene integrator to host cell, will can realize the stable transfection of cell line, but it is applicable in model Enclose it is narrow, under its transfection efficiency of fish cell system, the time be difficult screen the virus of suitable fish cell system transfection, and at This is higher, and experiment flow is complicated.The principle of liposome method is the phosphoric acid by the negative point of band on positively charged liposome and cell membrane Interaction of substituents forms complex, and guiding foreign gene imports into the cell, applied widely, and transfection efficiency is high and operates Simply.
Currently, the transfection of marine fishes cell line mostly uses greatly the transfection that liposome method realizes foreign gene.But in profit Problems with is still encountered with during liposome transfection lefteye flounder fry cell:After 1. foreign gene is transferred to lefteye flounder fry cell system It is problematic to integrate on cell genomic dna, thus is difficult to obtain surely to transfect by the mode screened after traditional liposome transfection Lefteye flounder fry cell system.2. the foreign gene that Successful transfection enters lefteye flounder cell is difficult to maintain high efficient expression, the overwhelming majority successfully turns The expression efficiency of its foreign gene of the lefteye flounder fry cell of dye can disappear totally in one week, hence it is evident that be less than mammalian cell transfection The expression efficiency of foreign gene afterwards.
Analyzing reason is mainly:Most of to recombinate with the extension of screening time after 1. recombinant plasmid is transferred to lefteye flounder cell Plasmid can be lost with cell division and gradually, and the plasmid that small part retains also is difficult to correctly be integrated into lefteye flounder cellular genome On, this causes to be difficult to screen the recombinant cell lines surely turned.2. the CMV promoter on common mammalian expression vector is not Can in lefteye flounder fry cell efficiently, the expression of lasting startup downstream gene, although it is higher to show as initial start efficiency, with The extension of time its starting efficiency to continuously decrease.
It is limited to above-mentioned reason, for a long time, one during the cell line using lefteye flounder fish studies its gene function Directly by the way of liposome transient transfection, and the common steady rotaring transfecting mode in mammal cell line can not be utilized, to The lefteye flounder fry cell system that stable transfection foreign gene can not be obtained significantly limits the work(for the regulation and control for carrying out gene in lefteye flounder It can research.Therefore, there is an urgent need to a kind of methods that effective acquisition lefteye flounder surely turns cell line.
Invention content
The object of the present invention is to provide a kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line, realizing will transfect to thin The exogenous gene high-efficient of intracellular is inserted into the genomic DNA of lefteye flounder cell line, and can realize the quick sieve of recombinant cell Choosing.
Plasmid vector provided by the present invention is the DNA plasmid carrier with Tol2 transposons, is also carried in plasmid vector There are the β-actin promoters and neomycin (G418) resistance screening label of lefteye flounder specificity;
β-actin the promoters of the lefteye flounder specificity, nucleotides sequence are classified as SEQ ID NO:3;
The plasmid vector also added EGFP fluorescence labels.
Plasmid provided by the present invention, a kind of specific nucleotides sequence are classified as SEQ ID NO:1;
Another aspect of the present invention provides a kind of method of transfection lefteye flounder cell, is to use above-mentioned plasmid vector by external source It is intracellular that gene is transfected into lefteye flounder;
The method preferably carries out cotransfection with the plasmid pCS-TP for encoding synthesis transposase is combined;
The method, it is a kind of specific steps are as follows:
Step 1:12 orifice plates are passaged to after the good lefteye flounder cell of growth conditions is digested with pancreatin, wait for growth to 90- When 95% fusion, the day before transfection changes not antibiotic DMEM-F12 culture mediums;
Step 2:With DMEM-F12 culture mediums simultaneously dilute plasmid Po β-action-pminiTol2 (holes 1000ng/) and PCS-TP (holes 1000ng/);
Step 3:With DMEM-F12 culture mediums dilution transfection reagent LipGene 2000plus Transfection Reagent (holes 2ul/) is incubated at room temperature 5min;
Step 4:By the diluted plasmid of step 2 and the diluted transfection reagent of step 3 gently mixing, it is placed at room temperature for 20min;
Step 5:The reagent that step 4 is mixed is separately added into 12 orifice plates per hole 100ul, and marks;
Step 6:Culture medium DMEM-F12 is replaced after transfecting 5h, while 10%FBS, 1% nonessential amino acid and 1% is added It is dual anti-;
Step 7:The G418 screenings of 800ng/mL are added in transfection afterwards for 24 hours, and screening duration 2 weeks changes primary culture in during which every 3 days Liquid;
Step 8:Stablize culture 2-3 weeks after screening 2 weeks again, is during which not added with G418 screenings;
Step 9:The EGFP green fluorescences that cell is finally observed in inverted fluorescence microscope, are confirmed whether all cells All it has been transferred to foreign gene.
The present invention provides a kind of to realize that the expression vector that efficient stable transfects, carrier of the present invention use in lefteye flounder fish Tol2 transposons can significantly improve lefteye flounder fry cell integration external source in conjunction with the plasmid pCS-TP cotransfections of coding synthesis transposase The ability of gene.Invention carrier is added to neomycin (G418) resistance screening label, and traditional fat is relied solely on to realize Plasmids add the mode of resistance screening, you can obtain more recombinant cell, greatly improve the screening of lefteye flounder fry cell To the efficiency for surely turning cell line.Invention carrier is added to EGFP fluorescence labels, can convenient tracer be transferred to the external source of cell line The expression of gene.Prior, carrier of the present invention substitutes traditional lactation using the lefteye flounder β-actin promoters after optimization and moves Common CMV promoter in object expression vector, creative obtains a kind of more adaptation lefteye flounder fry cell system exogenous gene expression Carrier, to realize foreign gene in the various cell lines of lefteye flounder fish can efficient stable expression.Carrier of the present invention Lefteye flounder cell line is imported by liposome transfection method, a large amount of stablize outside expression only can be obtained by short-term resistance screening The cell line of source gene.Compared to other transfections, simple, cheap, effect stability is operated, lefteye flounder cell is more can adapt to Transfection experiment.
In conclusion the present invention by liposome transfection it is this it is cheap, efficient in the way of, solve in lefteye flounder cell transfecting The problems such as exogenous origin gene integrator efficiency is low, and expression stability is poor.It is creative in lefteye flounder cell line to realize in a cell Two functions of completion gene editing and stable expression in transfection greatly improve steady turn of screening acquisition after lefteye flounder cell line transfection The efficiency of cell line.
Description of the drawings
Fig. 1:Plasmid construction schematic diagram.
Fig. 2:CMV-pminiTol2 vector plasmids collection of illustrative plates and multiple cloning sites information.
Fig. 3:Po β-action-pminiTol2 vector plasmids collection of illustrative plates and multiple cloning sites information.
Fig. 4:Design sketch after four kinds of plasmid transfection lefteye flounder ovary cell lines.
Specific implementation mode
Lefteye flounder stably transfected cell line can be obtained rapidly in the way of liposome transfection the present invention provides a kind of Plasmid.Constructed plasmid has Tol2 transposons, can transfection be inserted into lefteye flounder to intracellular exogenous gene high-efficient In the genomic DNA of cell line;Using the special β-actin promoters of the lefteye flounder after optimization, which can be each in lefteye flounder Start expression to stability and high efficiency in kind cell line;Neomycin (G418) resistance screening label is increased simultaneously, for realizing cell Quick screening.
Experimental method in following embodiments and test material used, unless otherwise specified, be from conventional method and Conventional reagent.
Embodiment 1:Vector construction flow
Vector construction flow is as shown in Figure 1, be as follows:
Step 1:Inscribe cleavage pminiTol2 carriers are limited with Bgl II, in Tol2ITR (L) and Tol2ITR (R) swivel base PminiTol2 plasmids are linearized between element.
Step 2:Using PFU DNA Polymerase, by the MCS site mutations of pEGFP-C1 plasmids by way of PCR At the sequence for containing only I restriction enzyme site of Xho I and Xma.
Mutant primer:
5'‐ATCAGTTATCTAGATCCGGTCCGCTCGAGCGGCCCGGGGGGCTTGTACAGCTCGTCCATGC‐3’
Step 3:Using the pEGFP-C1 plasmids after mutation as masterplate, expand to obtain by PFU DNA Polymerase SV40Promoter-NeoR/KanR sections, and add 18bp homologous sequences at the amplimer both ends and built for seamless clone Carrier.
Amplimer:FW:5'‐GCTCTAGATGGCCAGATCCTGAGGCGGAAAGAACCA‐3'
RV:
5'‐GTTTAATTTAAATAGATCTCAGAAGAACTCGTCAAGAAGG‐3’
Step 4:The PCR product that step 3 obtains is purified using GeneJET PCR product purification kits.
Step 5:Using pEGFP-C1 plasmids as masterplate, expand to obtain CMV by PFU DNA Polymerase Enhancer-CMV promoter-EGFP-MCS-SV40poly (A) signal sections, and added at the amplimer both ends 18bp homologous sequences are used for seamless clone's carrier construction.The sequence of amplimer is as follows:
FW:5'‐AAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTC‐3'
RV:5'‐GATCTGGCCATCTAGAGCCGCGTTAAGATACATTGATGAGTTT‐3'
Step 6:The PCR product that step 5 obtains is purified using GeneJET PCR product purification kits.
Step 7:Using Seamless Assembiy Cloning Kit kits, above-mentioned steps 4 and step 6 are purified The linearized vector that obtained segment and step 1 obtains connects into a complete carrier.
Step 8:The carrier built is converted to bacillus coli DH 5 alpha, after bacterium colony PCR and digestion identification, chooses sun Property clone be sequenced, verify the correctness of entire sequence.The carrier of acquisition is named as:CMV‐pminiTol2(SEQ ID NO:2) (Fig. 2).
Step 9:According to lefteye flounder genome sequence, lefteye flounder β-action promoter sequences are obtained by local blast.It is comprehensive Lefteye flounder β-action core promoter sections are predicted using website, and lefteye flounder β-action promoter DNA sequences are tentatively obtained by PCR Arrange 1578bp.
Step 10:Advanced optimize lefteye flounder β-action promoter sequences.Different cut is obtained by way of PCR and digestion Short lefteye flounder β-action promoter sequences (1400bp, 1384bp, 1105bp, 1034bp, 857bp, 474bp), by different length The promoter sequence of degree is cloned into respectively on pGL3-Basic luciferase reporter vectors.
Step 11:Method is transiently transfected using liposome and transfects Paralichthys olivaceus, brain, the cheek, spermary, ovary cell line respectively, is led to It crosses double Luciferase reporter systems and detects startup work of the promoter of 6 sections of different lengths in lefteye flounder 5 in different cell lines respectively Property, as a result show that the promoter of 1034bp all has strongest startup activity in these types of lefteye flounder cell line.It is final to confirm most Excellent lefteye flounder β-action promoter sequences, long 1034bp (SEQ ID NO:3).
Step 12:Bacterium is shaken to the CMV-pminiTol2 plasmids that step 8 obtains and expands numerous, extraction plasmid.
Step 13:With III restriction enzymes double zyme cutting CMV-pminiTol2 plasmids of SnaB I and Eco47, the plasmid is cut off CMV promoter sections, linearization plasmid.
Step 14:To the plasmid progress gel extraction for the linearisation that step 13 obtains, GeneJET gel reclaim reagents are utilized Box is purified.
Step 15:Using the lefteye flounder β-action promoter DNAs of optimization as template, expanded by PFU DNA Polymerase Po β-action promoter sections are obtained, and SnaB I and the III restricted digestion positions Eco47 are added at the amplimer both ends Point.
Step 16:SnaB I and III double digestions of Eco47 are carried out to the PCR product that step 15 obtains, utilize GeneJET PCR Product Purification Kit is purified.
Step 17:Using T4 ligases, above-mentioned steps 16 are purified obtained segment and step 14 are pure by 16 DEG C of connections overnight The plasmid for changing obtained linearisation connects into a complete carrier.
Step 18:The carrier built is converted to bacillus coli DH 5 alpha, after bacterium colony PCR and digestion identification, is chosen Positive colony is sequenced, and the correctness of entire sequence is verified.The carrier of acquisition is named as:Poβ‐action‐pminiTol2 (SEQ ID NO:1) (Fig. 3).
Embodiment 2:Carrier effect detects
Embodiment is illustrated using lefteye flounder ovary cell line as example, and experiments verify that, for other cells of lefteye flounder It is equally applicable.
Explanation:1. experimental group is the carrier Po β-action- of the Po β-action promoter structures after optimization The plasmid pCS-TP cotransfections of pminiTol2 and encoding transposase;2. experimental group is the support C MV- of CMV promoter structures The plasmid pCS-TP cotransfections of pminiTol2 and encoding transposase.1. control group transfects pEGFP-C1 mammalian cell expressions Carrier;2. control group transfects pEGFP-N1 mammalian cell expression vectors.
Step 1:12 orifice plates are passaged to after the good lefteye flounder gonad cell of growth conditions is digested with pancreatin, wait for growth extremely When 90-95% is merged, the day before transfection changes not antibiotic DMEM-F12 culture mediums.
Step 2:1. experimental group dilutes plasmid Po β-action-pminiTol2 simultaneously with 50ul DMEM-F12 culture mediums (holes 1000ng/) and pCS-TP (holes 1000ng/);2. experimental group dilutes plasmid CMV- simultaneously with 50ul DMEM-F12 culture mediums PminiTol2 (holes 1000ng/) and pCS-TP (holes 1000ng/).
Step 3:1. control group uses 50ul DMEM-F12 culture mediums to dilute plasmid (holes 2000ng/) pEGFP-C1;Control group 2. diluting plasmid (holes 2000ng/) pEGFP-N1 with 50ul DMEM-F12 culture mediums.
Step 4:With 50ul DMEM-F12 culture mediums dilution transfection reagent LipGene 2000plus Transfection Reagent (holes 2ul/) is incubated at room temperature 5min.
Step 5:By step 2 and the diluted plasmid of step 3 respectively with the diluted transfection reagent of step 4 gently mixing, room temperature Place 20min.
Step 6:The reagent that step 5 is mixed is separately added into 12 orifice plates per hole 100ul, and marks.
Step 7:The culture medium DMEM-F12 normally cultivated is replaced after transfection 5h (containing 10%FBS, 1% nonessential amino acid It is dual anti-with 1%).
Step 8:The G418 screenings of 800ug/mL are added in transfection afterwards for 24 hours, and screening duration 2 weeks changes primary culture in during which every 3 days Liquid.
Step 9:Stablize culture 2-3 weeks after screening 2 weeks again, is during which not added with G418 screenings.
Step 10:The EGFP green fluorescences that cell is finally observed in inverted fluorescence microscope are confirmed whether all thin Born of the same parents have been transferred to foreign gene.
As a result visible (Fig. 4) transfects the lefteye flounder cell line selection of Po β-action-pminiTol2 and pCS-TP cotransfections Almost all of cell all fluoresces afterwards, it was demonstrated that it realizes stable transfection substantially.Its CMV-pminiTol2 transfection It, and still there is a large amount of cell not work fluorescence after the lefteye flounder cell line selection of pEGFP-C1 and pEGFP-N1 transfections, illustrate it Stable transfection is not implemented, has a large amount of cell loss foreign gene again during follow-up cultivation.
It is found by Experimental comparison, the transfection efficiency of these four plasmids is:Po β-action-pminiTol2 > CMV- PminiTol2 > pEGFP-C1 and pEGFP-N1.Experimental result absolutely proves, compares and Conventional transfection plasmid, structure of the present invention The carrier Po β-action-pminiTol2 built can significantly improve lefteye flounder cell line selection and obtain the efficiency for surely turning cell line.In tooth Just there is larger application prospect in the research of the molecular biology of flounder.
Sequence table
<110>Chinese Marine University
<120>A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 7073
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gggcgaattg ggcccagagg tgtaaagtac ttgagtaatt ttacttgatt actgtactta 60
agtattattt ttggggattt ttactttact tgagtacaat taaaaatcaa tacttttact 120
tttacttaat tacatttttt tagaaaaaaa agtacttttt actccttaca attttattta 180
cagtcaaaaa gtacttattt tttggagatc acttcattct attttccctt gctattacca 240
aaccaattga attgcgctga tgcccagttt aatttaaata gatcctgagg cggaaagaac 300
cagctgtgga atgtgtgtca gttagggtgt ggaaagtccc caggctcccc agcaggcaga 360
agtatgcaaa gcatgcatct caattagtca gcaaccaggt gtggaaagtc cccaggctcc 420
ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccat agtcccgccc 480
ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc 540
tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag 600
aagtagtgag gaggcttttt tggaggccta ggcttttgca aagatcgatc aagagacagg 660
atgaggatcg tttcgcatga ttgaacaaga tggattgcac gcaggttctc cggccgcttg 720
ggtggagagg ctattcggct atgactgggc acaacagaca atcggctgct ctgatgccgc 780
cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg acctgtccgg 840
tgccctgaat gaactgcaag acgaggcagc gcggctatcg tggctggcca cgacgggcgt 900
tccttgcgca gctgtgctcg acgttgtcac tgaagcggga agggactggc tgctattggg 960
cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct cctgccgaga aagtatccat 1020
catggctgat gcaatgcggc ggctgcatac gcttgatccg gctacctgcc cattcgacca 1080
ccaagcgaaa catcgcatcg agcgagcacg tactcggatg gaagccggtc ttgtcgatca 1140
ggatgatctg gacgaagagc atcaggggct cgcgccagcc gaactgttcg ccaggctcaa 1200
ggcgagcatg cccgacggcg aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa 1260
tatcatggtg gaaaatggcc gcttttctgg attcatcgac tgtggccggc tgggtgtggc 1320
ggaccgctat caggacatag cgttggctac ccgtgatatt gctgaagagc ttggcggcga 1380
atgggctgac cgcttcctcg tgctttacgg tatcgccgct cccgattcgc agcgcatcgc 1440
cttctatcgc cttcttgacg agttcttctg agatctggcc atctagagcg gccgcgcgca 1500
ctagtgaatt ccatggatcg cgttaagata cattgatgag tttggacaaa ccacaactag 1560
aatgcagtga aaaaaatgct ttatttgtga aatttgtgat gctattgctt tatttgtaac 1620
cattataagc tgcaataaac aagttaacaa caacaattgc attcatttta tgtttcaggt 1680
tcagggggag gtgtgggagg ttttttaaag caagtaaaac ctctacaaat gtggtatggc 1740
tgattatgat cagttatcta gatccggtcc gctcgagcgg cccggggggc ttgtacagct 1800
cgtccatgcc gagagtgatc ccggcggcgg tcacgaactc cagcaggacc atgtgatcgc 1860
gcttctcgtt ggggtctttg ctcagggcgg actgggtgct caggtagtgg ttgtcgggca 1920
gcagcacggg gccgtcgccg atgggggtgt tctgctggta gtggtcggcg agctgcacgc 1980
tgccgtcctc gatgttgtgg cggatcttga agttcacctt gatgccgttc ttctgcttgt 2040
cggccatgat atagacgttg tggctgttgt agttgtactc cagcttgtgc cccaggatgt 2100
tgccgtcctc cttgaagtcg atgcccttca gctcgatgcg gttcaccagg gtgtcgccct 2160
cgaacttcac ctcggcgcgg gtcttgtagt tgccgtcgtc cttgaagaag atggtgcgct 2220
cctggacgta gccttcgggc atggcggact tgaagaagtc gtgctgcttc atgtggtcgg 2280
ggtagcggct gaagcactgc acgccgtagg tcagggtggt cacgagggtg ggccagggca 2340
cgggcagctt gccggtggtg cagatgaact tcagggtcag cttgccgtag gtggcatcgc 2400
cctcgccctc gccggacacg ctgaacttgt ggccgtttac gtcgccgtcc agctcgacca 2460
ggatgggcac caccccggtg aacagctcct cgcccttgct caccatggtg gcgaccggta 2520
gcgctagcgg atctgacggt tcactaaacc cccgtcgtgc cccagtgtgt gacgctggac 2580
caatgggagc gcgccattcc gaaagtttac cttttatggc tcgagccggc cgactgacgc 2640
ggtataaagg ccgcgcgccc gcagctaacg gattcactct gagcgccgtc acacgcagct 2700
cgtgcgggat atcacttgcc tggaaccggt tcccttaaag cgaaaagccc ccccacccaa 2760
aaaaggtaag aggaccaccg ccagaaaaca aattgatggg aaggggtgtg aacgtttcac 2820
cgtcgactcg gctgctttga atttcggccc gtaaaaaaaa gagcgactgt ttccgtgtgt 2880
tgtgtttctt gctggttttt aatgtaaaaa gatggcaccg accacgaggt tctttgtccc 2940
ggtgtcacaa acaaatccgc gttaattgtg ccgcaccggt ggttcgattc tcccggtgga 3000
agttgaggtg atgcccgggg accgttagga agtacaggtg cactttcttt tctttctttt 3060
tttttttaca ggaagccggc tccggattct tacgtgcact ttaagggcgt gtctattatt 3120
tttttaaaaa tctgattaat tactggactt taattaacgc agcacgaggc ctacagataa 3180
aaacgtctaa atctatttta aaggctttga gttcctcaga tttctcttat aatcgcagta 3240
ttcgtcgatg tgaacgtgac gtgaagtgcg agtgacaaat ccgctaatcc cagaaaaggc 3300
gtggcctcca ggaaatggag taacggtcca cgactcgaac atgacgtcgt tatgcaacta 3360
cgtctttttt ttttgtgtta acgtagcgcc acttcctttt gtctggcggg gtcggaatgt 3420
gcagggcgag gagctccacc taccggccaa cgtggcgaac tgcagctgga gcggtaacag 3480
gaagtgacag cagcgcgtca tcggtgctgc tgggaagtgg atgaatgact tgagaaacta 3540
actttttttt tttcttcttc ttctctcctc tctgcagttc agcccatggt aatagcgatg 3600
actaatacgt agatgtactg ccaagtagga aagtcccata aggtcatgta ctgggcataa 3660
tgccaggcgg gccatttacc gtcattgacg tcaatagggg gcgtacttgg catatgatac 3720
acttgatgta ctgccaagtg ggcagtttac cgtaaatact ccacccattg acgtcaatgg 3780
aaagtcccta ttggcgttac tatgggaaca tacgtcatta ttgacgtcaa tgggcggggg 3840
tcgttgggcg gtcagccagg cgggccattt accgtaagtt atgtaacgcg gaactccata 3900
tatgggctat gaactaatga ccccgtaatt gattactatt aatcaagctt aaacaagaat 3960
ctctagtttt ctttcttgct tttactttta cttccttaat actcaagtac aattttaatg 4020
gagtactttt ttacttttac tcaagtaaga ttctagccag atacttttac ttttaattga 4080
gtaaaatttt ccctaagtac ttgtactttc acttgagtaa aatttttgag tactttttac 4140
acctctgctc gaccatatgg gagagctccc aacgcgttgg atgcatagct tgagtattct 4200
atagtgtcac ctaaatagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg 4260
ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg 4320
tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc 4380
gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt 4440
gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct 4500
gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga 4560
taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc 4620
cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg 4680
ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 4740
aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 4800
tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt 4860
gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg 4920
cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 4980
ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 5040
cttgaagtgg tggcctaact acggctacac tagaagaaca gtatttggta tctgcgctct 5100
gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 5160
cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 5220
tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg 5280
ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta 5340
aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca 5400
atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc 5460
ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc 5520
tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc 5580
agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat 5640
taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt 5700
tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc 5760
cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag 5820
ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt 5880
tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac 5940
tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg 6000
cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat 6060
tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc 6120
gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc 6180
tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa 6240
atgttgaata ctcatactct tcctttttca atattattga agcatttatc agggttattg 6300
tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg 6360
cacatttccc cgaaaagtgc cacctgatgc ggtgtgaaat accgcacaga tgcgtaagga 6420
gaaaataccg catcaggaaa ttgtaagcgt taatattttg ttaaaattcg cgttaaattt 6480
ttgttaaatc agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc cttataaatc 6540
aaaagaatag accgagatag ggttgagtgt tgttccagtt tggaacaaga gtccactatt 6600
aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg atggcccact 6660
acgtgaacca tcaccctaat caagtttttt ggggtcgagg tgccgtaaag cactaaatcg 6720
gaaccctaaa gggagccccc gatttagagc ttgacgggga aagccggcga acgtggcgag 6780
aaaggaaggg aagaaagcga aaggagcggg cgctagggcg ctggcaagtg tagcggtcac 6840
gctgcgcgta accaccacac ccgccgcgct taatgcgccg ctacagggcg cgtccattcg 6900
ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc gctattacgc 6960
cagctggcga aagggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc 7020
cagtcacgac gttgtaaaac gacggccagt gaattgtaat acgactcact ata 7073
<210> 2
<211> 6243
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gggcgaattg ggcccagagg tgtaaagtac ttgagtaatt ttacttgatt actgtactta 60
agtattattt ttggggattt ttactttact tgagtacaat taaaaatcaa tacttttact 120
tttacttaat tacatttttt tagaaaaaaa agtacttttt actccttaca attttattta 180
cagtcaaaaa gtacttattt tttggagatc acttcattct attttccctt gctattacca 240
aaccaattga attgcgctga tgcccagttt aatttaaata gatcctgagg cggaaagaac 300
cagctgtgga atgtgtgtca gttagggtgt ggaaagtccc caggctcccc agcaggcaga 360
agtatgcaaa gcatgcatct caattagtca gcaaccaggt gtggaaagtc cccaggctcc 420
ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccat agtcccgccc 480
ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc 540
tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag 600
aagtagtgag gaggcttttt tggaggccta ggcttttgca aagatcgatc aagagacagg 660
atgaggatcg tttcgcatga ttgaacaaga tggattgcac gcaggttctc cggccgcttg 720
ggtggagagg ctattcggct atgactgggc acaacagaca atcggctgct ctgatgccgc 780
cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg acctgtccgg 840
tgccctgaat gaactgcaag acgaggcagc gcggctatcg tggctggcca cgacgggcgt 900
tccttgcgca gctgtgctcg acgttgtcac tgaagcggga agggactggc tgctattggg 960
cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct cctgccgaga aagtatccat 1020
catggctgat gcaatgcggc ggctgcatac gcttgatccg gctacctgcc cattcgacca 1080
ccaagcgaaa catcgcatcg agcgagcacg tactcggatg gaagccggtc ttgtcgatca 1140
ggatgatctg gacgaagagc atcaggggct cgcgccagcc gaactgttcg ccaggctcaa 1200
ggcgagcatg cccgacggcg aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa 1260
tatcatggtg gaaaatggcc gcttttctgg attcatcgac tgtggccggc tgggtgtggc 1320
ggaccgctat caggacatag cgttggctac ccgtgatatt gctgaagagc ttggcggcga 1380
atgggctgac cgcttcctcg tgctttacgg tatcgccgct cccgattcgc agcgcatcgc 1440
cttctatcgc cttcttgacg agttcttctg agatctggcc atctagagcg gccgcgcgca 1500
ctagtgaatt ccatggatcg cgttaagata cattgatgag tttggacaaa ccacaactag 1560
aatgcagtga aaaaaatgct ttatttgtga aatttgtgat gctattgctt tatttgtaac 1620
cattataagc tgcaataaac aagttaacaa caacaattgc attcatttta tgtttcaggt 1680
tcagggggag gtgtgggagg ttttttaaag caagtaaaac ctctacaaat gtggtatggc 1740
tgattatgat cagttatcta gatccggtcc gctcgagcgg cccggggggc ttgtacagct 1800
cgtccatgcc gagagtgatc ccggcggcgg tcacgaactc cagcaggacc atgtgatcgc 1860
gcttctcgtt ggggtctttg ctcagggcgg actgggtgct caggtagtgg ttgtcgggca 1920
gcagcacggg gccgtcgccg atgggggtgt tctgctggta gtggtcggcg agctgcacgc 1980
tgccgtcctc gatgttgtgg cggatcttga agttcacctt gatgccgttc ttctgcttgt 2040
cggccatgat atagacgttg tggctgttgt agttgtactc cagcttgtgc cccaggatgt 2100
tgccgtcctc cttgaagtcg atgcccttca gctcgatgcg gttcaccagg gtgtcgccct 2160
cgaacttcac ctcggcgcgg gtcttgtagt tgccgtcgtc cttgaagaag atggtgcgct 2220
cctggacgta gccttcgggc atggcggact tgaagaagtc gtgctgcttc atgtggtcgg 2280
ggtagcggct gaagcactgc acgccgtagg tcagggtggt cacgagggtg ggccagggca 2340
cgggcagctt gccggtggtg cagatgaact tcagggtcag cttgccgtag gtggcatcgc 2400
cctcgccctc gccggacacg ctgaacttgt ggccgtttac gtcgccgtcc agctcgacca 2460
ggatgggcac caccccggtg aacagctcct cgcccttgct caccatggtg gcgaccggta 2520
gcgctagcgg atctgacggt tcactaaacc agctctgctt atatagacct cccaccgtac 2580
acgcctaccg cccatttgcg tcaatggggc ggagttgtta cgacattttg gaaagtcccg 2640
ttgattttgg tgccaaaaca aactcccatt gacgtcaatg gggtggagac ttggaaatcc 2700
ccgtgagtca aaccgctatc cacgcccatt gatgtactgc caaaaccgca tcaccatggt 2760
aatagcgatg actaatacgt agatgtactg ccaagtagga aagtcccata aggtcatgta 2820
ctgggcataa tgccaggcgg gccatttacc gtcattgacg tcaatagggg gcgtacttgg 2880
catatgatac acttgatgta ctgccaagtg ggcagtttac cgtaaatact ccacccattg 2940
acgtcaatgg aaagtcccta ttggcgttac tatgggaaca tacgtcatta ttgacgtcaa 3000
tgggcggggg tcgttgggcg gtcagccagg cgggccattt accgtaagtt atgtaacgcg 3060
gaactccata tatgggctat gaactaatga ccccgtaatt gattactatt aatcaagctt 3120
aaacaagaat ctctagtttt ctttcttgct tttactttta cttccttaat actcaagtac 3180
aattttaatg gagtactttt ttacttttac tcaagtaaga ttctagccag atacttttac 3240
ttttaattga gtaaaatttt ccctaagtac ttgtactttc acttgagtaa aatttttgag 3300
tactttttac acctctgctc gaccatatgg gagagctccc aacgcgttgg atgcatagct 3360
tgagtattct atagtgtcac ctaaatagct tggcgtaatc atggtcatag ctgtttcctg 3420
tgtgaaattg ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta 3480
aagcctgggg tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg 3540
ctttccagtc gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga 3600
gaggcggttt gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg 3660
tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag 3720
aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc 3780
gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca 3840
aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt 3900
ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc 3960
tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc 4020
tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc 4080
ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact 4140
tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg 4200
ctacagagtt cttgaagtgg tggcctaact acggctacac tagaagaaca gtatttggta 4260
tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca 4320
aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa 4380
aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg 4440
aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc 4500
ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg 4560
acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat 4620
ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg 4680
gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa 4740
taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca 4800
tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc 4860
gcaacgttgt tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt 4920
cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa 4980
aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat 5040
cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct 5100
tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga 5160
gttgctcttg cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag 5220
tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga 5280
gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca 5340
ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg 5400
cgacacggaa atgttgaata ctcatactct tcctttttca atattattga agcatttatc 5460
agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag 5520
gggttccgcg cacatttccc cgaaaagtgc cacctgatgc ggtgtgaaat accgcacaga 5580
tgcgtaagga gaaaataccg catcaggaaa ttgtaagcgt taatattttg ttaaaattcg 5640
cgttaaattt ttgttaaatc agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc 5700
cttataaatc aaaagaatag accgagatag ggttgagtgt tgttccagtt tggaacaaga 5760
gtccactatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg 5820
atggcccact acgtgaacca tcaccctaat caagtttttt ggggtcgagg tgccgtaaag 5880
cactaaatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga aagccggcga 5940
acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg ctggcaagtg 6000
tagcggtcac gctgcgcgta accaccacac ccgccgcgct taatgcgccg ctacagggcg 6060
cgtccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc 6120
gctattacgc cagctggcga aagggggatg tgctgcaagg cgattaagtt gggtaacgcc 6180
agggttttcc cagtcacgac gttgtaaaac gacggccagt gaattgtaat acgactcact 6240
ata 6243
<210> 3
<211> 1034
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cccgtcgtgc cccagtgtgt gacgctggac caatgggagc gcgccattcc gaaagtttac 60
cttttatggc tcgagccggc cgactgacgc ggtataaagg ccgcgcgccc gcagctaacg 120
gattcactct gagcgccgtc acacgcagct cgtgcgggat atcacttgcc tggaaccggt 180
tcccttaaag cgaaaagccc ccccacccaa aaaaggtaag aggaccaccg ccagaaaaca 240
aattgatggg aaggggtgtg aacgtttcac cgtcgactcg gctgctttga atttcggccc 300
gtaaaaaaaa gagcgactgt ttccgtgtgt tgtgtttctt gctggttttt aatgtaaaaa 360
gatggcaccg accacgaggt tctttgtccc ggtgtcacaa acaaatccgc gttaattgtg 420
ccgcaccggt ggttcgattc tcccggtgga agttgaggtg atgcccgggg accgttagga 480
agtacaggtg cactttcttt tctttctttt tttttttaca ggaagccggc tccggattct 540
tacgtgcact ttaagggcgt gtctattatt tttttaaaaa tctgattaat tactggactt 600
taattaacgc agcacgaggc ctacagataa aaacgtctaa atctatttta aaggctttga 660
gttcctcaga tttctcttat aatcgcagta ttcgtcgatg tgaacgtgac gtgaagtgcg 720
agtgacaaat ccgctaatcc cagaaaaggc gtggcctcca ggaaatggag taacggtcca 780
cgactcgaac atgacgtcgt tatgcaacta cgtctttttt ttttgtgtta acgtagcgcc 840
acttcctttt gtctggcggg gtcggaatgt gcagggcgag gagctccacc taccggccaa 900
cgtggcgaac tgcagctgga gcggtaacag gaagtgacag cagcgcgtca tcggtgctgc 960
tgggaagtgg atgaatgact tgagaaacta actttttttt tttcttcttc ttctctcctc 1020
tctgcagttc agcc 1034

Claims (8)

1. a plasmid vector, which is characterized in that the plasmid vector is the DNA plasmid carrier with Tol2 transposons, institute β-actin the promoters of lefteye flounder specificity are also carried in the plasmid vector stated;
β-actin the promoters of the lefteye flounder specificity, nucleotides sequence are classified as SEQ ID NO:3.
2. plasmid vector as described in claim 1, which is characterized in that include neomycin resistance sieve in the plasmid vector Choosing label.
3. plasmid vector as claimed in claim 1 or 2, which is characterized in that the plasmid vector also includes EGFP fluorescence Label.
4. plasmid vector as claimed in claim 3, which is characterized in that the nucleotides sequence of the plasmid vector is classified as SEQ ID NO:1。
5. claim 1-4 any one of them plasmid vector is by exogenous origin gene integrator to the application in lefteye flounder cell.
6. a kind of method that foreign gene is transfected lefteye flounder cell, which is characterized in that the method is to use claim 1-4 It is intracellular that foreign gene is transfected into lefteye flounder by any one of them plasmid vector.
7. method as claimed in claim 6, which is characterized in that the method makes profit requiring 1-4 any one of them matter Grain carrier carries out cotransfection with the plasmid pCS-TP of coding synthesis transposase is combined.
8. method as claimed in claim 6, which is characterized in that the method includes following step:
Step 1:12 orifice plates are passaged to after the good lefteye flounder cell of growth conditions is digested with pancreatin, wait for growth to 90-95% When fusion, the day before transfection changes not antibiotic DMEM-F12 culture mediums;
Step 2:Claim 1-4 any one of them plasmid vector and pCS-TP matter are diluted with DMEM-F12 culture mediums simultaneously Grain;
Step 3:2000 plus Transfection Reagent of transfection reagent LipGene are diluted with DMEM-F12 culture mediums, It is incubated at room temperature 5min;
Step 4:By the diluted plasmid of step 2 and the diluted transfection reagent of step 3 gently mixing, it is placed at room temperature for 20min;
Step 5:The reagent that step 4 is mixed is separately added into 12 orifice plates per hole 100ul, and marks;
Step 6:Culture medium DMEM-F12 is replaced after transfecting 5h, while 10%FBS, 1% nonessential amino acid and 1% pair is added It is anti-;
Step 7:The G418 screenings of 800ng/mL are added in transfection afterwards for 24 hours, and screening duration 2 weeks changes a culture solution in during which every 3 days;
Step 8:Stablize culture 2-3 weeks after screening 2 weeks again, is during which not added with G418 screenings;
Step 9:The EGFP green fluorescences that cell is finally observed in inverted fluorescence microscope, are confirmed whether that all cells all turn Foreign gene is entered.
CN201810587974.2A 2018-06-08 2018-06-08 A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line Pending CN108728466A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810587974.2A CN108728466A (en) 2018-06-08 2018-06-08 A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810587974.2A CN108728466A (en) 2018-06-08 2018-06-08 A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line

Publications (1)

Publication Number Publication Date
CN108728466A true CN108728466A (en) 2018-11-02

Family

ID=63932923

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810587974.2A Pending CN108728466A (en) 2018-06-08 2018-06-08 A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line

Country Status (1)

Country Link
CN (1) CN108728466A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113046354A (en) * 2021-04-09 2021-06-29 中国海洋大学 Optimized beta-actin promoter for paralichthys olivaceus

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103352050A (en) * 2013-06-07 2013-10-16 曹更生 Method for improving cell transfection efficiency through utilization of bacterial artificial chromosome homologous recombination
CN106399370A (en) * 2016-09-12 2017-02-15 中国海洋大学 Method for establishing stable transgenic flounder embryo cell strain
CN107828822A (en) * 2017-11-06 2018-03-23 南京中医药大学 The production method of the fluorescence fish of epidermis changeable colour based on eucaryotic cell structure tension variation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103352050A (en) * 2013-06-07 2013-10-16 曹更生 Method for improving cell transfection efficiency through utilization of bacterial artificial chromosome homologous recombination
CN106399370A (en) * 2016-09-12 2017-02-15 中国海洋大学 Method for establishing stable transgenic flounder embryo cell strain
CN107828822A (en) * 2017-11-06 2018-03-23 南京中医药大学 The production method of the fluorescence fish of epidermis changeable colour based on eucaryotic cell structure tension variation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BO WANG等: "Functional Analysis of the Promoter Region of Japanese Flounder (Paralichthys olivaceus) β-actin Gene: A Useful Tool for Gene Research in Marine Fish", 《INT J MOL SCI.》 *
KWAN, KM 等: "The Tol2kit: A multisite Gateway-based construction kit for Tol2 transposon transgenesis constructs", 《DEVELOPMENTAL DYNAMICS》 *
孙成飞等: "Tgf2转座子介导的草鱼、团头鲂和鲫插入诱变研究", 《农业生物技术学报》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113046354A (en) * 2021-04-09 2021-06-29 中国海洋大学 Optimized beta-actin promoter for paralichthys olivaceus

Similar Documents

Publication Publication Date Title
CN115197967B (en) Helper plasmid for preparing recombinant adeno-associated virus and application thereof
CN104694452B (en) A kind of recombined bacillus subtilis and its construction method of high yield Pullulanase
CN113584134B (en) Isothermal nucleic acid detection system based on CRISPR-Cas9, and method and application thereof
CN104342411B (en) The Ketoreductase mutant of increased activity, coded sequence and preparation method thereof
CN104342412B (en) For producing the Ketoreductase mutant of (S) -4- chloro-3-hydroxyl ethyl butyrate
CN106536740B (en) T7 expression system, method for the production thereof and use thereof for producing recombinant proteins
CN104342410A (en) Ketone reductase mutant and preparation method thereof
CN112522205B (en) Cell line for over-expressing angiotensin converting enzyme 2 as well as preparation method and application thereof
CN108728466A (en) A kind of carrier that can be quickly obtained lefteye flounder and surely turn cell line
US20040101520A1 (en) Recombination method
CN113528450B (en) Establishment and application of rice protoplasm high-efficiency biotin marking system
CN109097392A (en) A kind of Her2-CAR-T system constituting method based on PiggyBac carrier
CN113846019B (en) Marine nannochloropsis targeted epigenomic genetic control method
Takahashi et al. A plasmid that improves the efficiency of foreign gene expression by intracellular T7 RNA polymerase
CN101492685A (en) Gene sequence of recombinant expression vector and construction method thereof
CN109957551B (en) Recombinant vaccinia virus expressing human beta-defensin 2 and application thereof
CN109182241B (en) Engineering bacterium for expressing epoxide hydrolase and construction method and application thereof
CN112852759A (en) Recombinant rabies virus of chimeric canine parvovirus VP2 gene and application thereof
CN114085868A (en) Targeting vector, recombinant Huh7 cell line, construction method and application
KR102422842B1 (en) Compositon for regulating translation of RNA using CRISPRi
CN102051379A (en) Recombinant herpes simplex virus (HSV) genetic operation system and application thereof
CN109055413B (en) Shuttle plasmid vector and construction method and application thereof
CN113025651B (en) Novel application of drug screening cell model, triciribine and structural analogue of targeted HBV core promoter
CN114014924B (en) Method for improving homologous recombination efficiency in gene editing process through BRCA1 and BARD1 proteins
AT509050B1 (en) HYDROLASE ACTIVATOR FROM TRICHODERMA REESEI

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20181102