CN104694452A

CN104694452A - Recombinant bacillus subtilis of high-yield pullulanase and construction method thereof

Info

Publication number: CN104694452A
Application number: CN201510143787.1A
Authority: CN
Inventors: 孙俊松; 史吉平; 陈超; 姜标
Original assignee: Shanghai Advanced Research Institute of CAS
Current assignee: Shanghai Advanced Research Institute of CAS
Priority date: 2015-03-30
Filing date: 2015-03-30
Publication date: 2015-06-10
Anticipated expiration: 2035-03-30
Also published as: CN104694452B

Abstract

The invention discloses a recombinant bacillus subtilis of high-yield pullulanase and a construction method thereof. The construction method of the recombinant bacillus subtilis of the high-yield comprises the following steps that an artificial operon BPB used for expressing the pullulanase is used for constructing a recombinant plasmid pGE-BPB; the nucleotide sequence of the artificial operon BPB is shown in the graph SEQ ID NO.4; the constructed recombinant plasmid pGE-BPB is converted into a bacillus subtilis competent cell, and through secondary recombination, a neutral protease gene nprE in the bacillus subtilis competent cell is replaced by the artificial operon BPB in situ. According to the recombinant bacillus subtilis of the high-yield pullulanase and the construction method thereof, firstly, the acidproof and heatproof pullulanase gene of an original bacterial strain is optimized, based on the synthetic biology method, a plurality of molecular elements capable of improving the gene transcriptional level are assembled into the artificial operon, and the recombinant bacillus subtilis can be obtained through construction. The recombinant bacterial strain can ferment to generate the high-yield pullulanase, and the enzyme activity each unit can reach or exceed 300 U/ml.

Description

A kind of recombined bacillus subtilis of high yield Pullulanase and construction process thereof

Technical field

The invention belongs to subtilis recombinant bacterial strain constructing technology field, be specifically related to a kind of recombined bacillus subtilis and construction process thereof of high yield Pullulanase.

Background technology

Pullulanase is the starch solution branch enzyme that a class is expressed by microorganism secretion, I type Pullulanase specificity can cut α-1 in amylopectin branch, 6 glycosidic links, form amylose starch, Pullulanase and other amylase effects, have important purposes and good market outlook in starch processing industry.Therefore, the production bacterial strain of a large amount of manpower, financial resources exploitation Pullulanase is dropped in countries in the world, up to now, have been found that many microorganisms can produce Pullulanase, but due to current industrial process conditions (acid resistance, high temperature resistant condition) limit, the Pullulanase that most of microbe is produced there is no too large-scale commerce and is worth, the most of Pullulanases found can not meet the Production requirement of the high temperature-resistant acid-resistant in starch processing industry simultaneously, and zymologic property exists the shortcomings such as thermostability is not high, resistance to acid is not strong.

From Pullulanase (Bn PulB) optimum temperuture 62.5 DEG C of Nagano bacillus (Bacillus naganoensis), optimal pH is below 5.0, best catalytic temperature is at about 60 DEG C, be applicable to very much saccharification processing, but the expression amount of this enzyme in former bacterium can not meet industry's enlarging production demand, and Bacillus subtillis because of secretion capacity powerful, be listed in one of safe microorganisms (GRAS), extremely be suitable for the industrial production of food grade Pullulanase, it is one of first-selected microorganism carrying out extracellular enzyme fermentative production, conventional type strain Bacillus subtillis Bacillus subtilis W168 (hereinafter referred to as Bacillus subtillis 168) does not produce Pullulanase, be easy to be transformed, carry out restructuring Pullulanase to produce the desirable strain built.

At present comparatively simple directly method is transformed to microorganism, that goal gene is building up in plasmid, then plasmid is transferred to the bacterial strain of transformation, because independently duplicated plasmid not like genomic copy stable, therefore, the stability usually increasing plasmid in bacterial strain by adding antibiosis in the medium is often needed.But in the food industry, this recombinant bacterial strain needs to use microbiotic, and the recombinant bacterial strain carrying antibiotic resistance gene is not more and more accepted.Therefore, the seamless lead-in mode carrying out foreign gene has become the main building mode of structuring food prods industrial microorganism, this mode to be by carrying out homologous recombination with microorganism, and carries out secondary restructuring screening, obtains the production bacterial strain of nonreactive.

Summary of the invention

The object of the invention is, a kind of recombined bacillus subtilis and construction process thereof of high yield Pullulanase is provided.Be intended to solve the technical problem that the Pullulanase thermostability that in prior art, Institute of Micro-biology produces is not high, resistance to acid is not strong, output is not high.

The present invention is as follows for solving the problems of the technologies described above adopted technical scheme:

A recombined bacillus subtilis for high yield Pullulanase, this recombined bacillus subtilis obtains in the following way: will substitute the neutral protease gene nprE of subtilis containing the artificial operons BPB original position expressing Pullulanase gene; The nucleotide sequence of described artificial operons BPB is as shown in SEQ IDNO.4.

Preferably, type strain subtilis 168 is adopted to build described recombined bacillus subtilis as starting strain.

Described artificial operons BPB proceeds in subtilis by recombinant plasmid pGE-BPB, and the nucleotide sequence of described recombinant plasmid pGE-BPB is as shown in SEQ ID NO.1.

Described artificial operons BPB includes series connection Artificial promoters Pga2.The nucleotide sequence of described series connection Artificial promoters Pga2 is as shown in SEQ ID NO.2, it is spliced by PyxiE promotor and cry3ARNA stable factor, cry3A RNA stable factor can improve the decay phase of mRNA, improve the expression amount of albumen, the preparation of promotor Pga2 is completed by chemical synthesis.

Described artificial operons BPB also comprises: through the pulB gene of codon optimized acquisition, and the nucleotide sequence of described pulB gene is as shown in SEQ ID NO.3.Described pulB gene, is optimized protogene for reference with the highest password of Bacillus subtillis frequency of utilization, and its Pullulanase albumen of expressing has the feature of resistance to acid heat.

Described artificial operons BPB also comprises: from the signal peptide sequence SPamyL of bacillus licheniformis amylase secretion, and from the terminator sequence T-aprE of bacillus amyloliquefaciens aprE gene; The nucleotide sequence of described T-aprE is as shown in SEQ ID NO.5.

Described recombinant plasmid pGE-BPB, except containing artificial operons BPB, also simultaneously with for the seamless restructuring arm knocked out of Bacillus subtillis neutral protease nprE, the neutral protease gene nprE in bacillus subtilis bacterium competence cell is knocked out by secondary recombination form by this recombinant plasmid pGE-BPB.The nucleotide sequence of the restructuring arm DNA knocked out for neutral protease gene nprE is as shown in SEQ ID NO.6.

Present invention also offers the method for the recombined bacillus subtilis fermentative production Pullulanase of described high yield Pullulanase, the method is: in basic medium, add the sucrose of 4.5% and the wheat bran of 6.0% adds dregs of beans, controlling starting fermentation pH value is 6.2-6.3, under above-mentioned culture condition, fermentation culture is carried out to described recombined bacillus subtilis, produce and obtain Pullulanase.

The present invention also provides a kind of construction process of recombined bacillus subtilis of high yield Pullulanase, and the method comprises the steps:

Step 1, will be used for the artificial operons BPB construction recombination plasmid pGE-BPB expressing Pullulanase; The nucleotide sequence of described artificial operons BPB is as shown in SEQ ID NO.4;

Step 2, is converted in bacillus subtilis bacterium competence cell by the recombinant plasmid pGE-BPB of aforementioned structure, makes described artificial operons BPB original position substitute neutral protease gene nprE in bacillus subtilis bacterium competence cell by secondary restructuring.

Neutral protease gene nprE in bacillus subtilis bacterium competence cell is knocked out by secondary recombination form by described recombinant plasmid pGE-BPB, and the nucleotide sequence of the restructuring arm DNA knocked out for neutral protease gene nprE is as shown in SEQ ID NO.6.

The construction process of the recombined bacillus subtilis of described high yield Pullulanase completes by following, first recombinant plasmid pGE-BPB is proceeded in Bacillus subtillis 168, resistant strain is obtained by the culture plate screening containing erythromycin, with Pullulanase gene pulB for template, design primer, after identifying positive colony by PCR, the resistant strain incorporating Pullulanase and antibiotic resistance gene that aforementioned screening obtains is inoculated into and does not carry out continuous passage cultivation containing in the substratum of resistance, after passing 5-6 time, bacterium liquid is diluted to 10 ³-10 ⁴the cell concn of/ml, then carries out coated plate, the mono-clonal bacterium colony obtained is carried out to the qualification of PCR again, determines that artificial operons BPB sequence of in-situ instead of the nonreactive recombinant clone of nprE according to the acquisition of Pullulanase gene in recombinant bacterium.

Present invention also offers a kind of gene order for expressing Pullulanase, this gene order is the nucleotide sequence of artificial operons BPB or has the nucleotide sequence of more than 90% homology with artificial operons BPB, and the nucleotide sequence of described artificial operons BPB is as shown in SEQ ID NO.4.

Present invention also offers a kind of recombinant plasmid pGE-BPB for expressing Pullulanase, the nucleotide sequence of this recombinant plasmid pGE-BPB is as shown in SEQ ID NO.1.

Present invention also offers a kind of Pullulanase gene, the nucleotide sequence of this Pullulanase gene is as shown in SEQID NO.3.

Compared with prior art, beneficial effect of the present invention is:

The present invention is from optimizing the Pullulanase of the resistance to acid heat gene of original strain, utilize the method for synthetic biology, by the multiple molecular element that can improve gene transcription level, comprise promotor, mRNA stable factor, secretion signal peptide sequence, terminators etc. are assembled into an artificial operons, and by they are building up in recombinant plasmid, the upstream and downstream homologous fragment of the neutral protease gene nprE of recycling Bacillus subtillis self, manual maneuvering sub-element is incorporated into the genome of Bacillus subtillis 168, again by mode that nonreactive is cultivated, binding molecule biological means carries out the bacterial strain screening after secondary restructuring, finally obtain the nonreactive recombinant bacillus bacillus CH-1 producing Pullulanase, this recombinant bacterial strain can ferment high yield Pullulanase, unit enzyme >300U/ml alive.

In the present invention, with the neutral protease gene nprE of Bacillus subtillis for homologous recombination object, after secondary restructuring, the artificial operons's original position expressing Pullulanase can be substituted nprE gene, not only make Pullulanase obtain recombinant expressed, also the neutral protease affecting exogenous protein expression level is carried out gene knockout.The factor affecting the extracellular expression level of bacillus foreign protein is a lot, selection etc. comprising promotor, mRNA structure, terminator, secreting signal peptide is the most key in the structure of interior gene operon, the promotor, RNA stable factor, secreting signal peptide etc. of bacillus are affected to the factor of transcriptional level, domestic and international expert has made large quantity research, the present invention combines above influence factor, devise the Artificial promoters Pga2 of duplex mode, contain efficient promoter PyxiA and Cry3A RNA stable factor.Simultaneously, when expressing the foreign gene of different sources, the specific codon of different genera selects tendency to have a strong impact on the translation efficiency of albumen sometimes, thus cause the low expression level of protein expression level, obtain genetic resources Pullulanase gene pulB by gene chemical synthesis mode in the present invention, improved the translation efficiency of Pullulanase albumen by codon optimized mode.

Accompanying drawing explanation

The schematic diagram that when Fig. 1 is restructuring fermentation of bacillus subtilis production Pullulanase, enzyme work changes with fermentation time;

Fig. 2 be recombined bacillus subtilis in Optimal Medium during fermentative production Pullulanase enzyme live and the schematic diagram of relation between Preliminary fermentation pH value.

Embodiment

Below in conjunction with embodiment, technical scheme of the present invention is described in detail.The reagent below adopted and biomaterial if not otherwise specified, are commercially produced product.

Embodiment 1: the structure of recombinant plasmid pGE-BPB

The gene operon BPB expressed for Pullulanase comprises one by Gene expression Pga2 and the gene order and the terminator sequence T-aprE that have carried out codon optimized coding Bn PulB (its nucleotide sequence is as shown in SEQ ID NO.3), wherein Pga2 is made up of (nucleotide sequence of Pga2 is as shown in SEQ ID NO.2) promotor PyxiE and RNA stable factor CryIIIA, following the sequence after initiator codon ATG closely is SPamyL, relevant nucleotide sequence utilizes DNA chemical synthesis to generate gene fragment by Jin Wei intelligence biotech company, build and obtain gene operon BPB, then gene operon BPB is cloned into plasmid pUC57, generate pUC57-BPB.Two ends are obtained by PCR with the BPB in Eco RI site, and PCR is obtained by following methods:

Upstream primer: CAAGGAATTCCATGGCCGGCCGACCGGG

Downstream primer: AGCAGAATTCTTATTTACCATCAGATGG

The preparation method of DNA profiling is: the pUC57-BPB solution getting 100ng/ μ l, and after diluting 10000 times, getting 1.0 μ l is template.

PCR reaction system is as follows:

10 × Pfx buffer (purchased from Invitrogen company, containing Mg ion, dNTP mixture etc.) 5.0 μ l;

Upstream primer (10 μMs), 3.0 μ l;

Downstream primer (10 μMs), 3.0 μ l

DNA profiling, 1.0 μ l;

Pfx polysaccharase (5U/ μ l), 0.5 μ l;

Add water to 50 μ l.

In the following program of the upper operation of Mastercycler regular-PCR instrument (Eppendorf):

1)95℃，2min

2)94℃，20sec

3)55℃，45sec

4)68℃，4min

5) circulation is from 2) to 4), 30 times

6)68℃，3min

7) 4 DEG C, preserve.

PCR primer reclaims after purifying through Axygen PCR cleaning agents box, cut with restriction enzyme Eco RI enzyme, be connected with T4DNA ligase enzyme with the linear plasmid DNA pGENE-nprLR through Eco RI and dephosphorylation process, connecting fluid proceeds to bacillus coli DH 5 alpha, is separated and obtains recombinant plasmid pGE-BPB from intestinal bacteria.

Embodiment 2: the molecular biology manipulations producing the recombinant bacillus bacillus of Pullulanase

1, pGE-BPB is proceeded to Bacillus subtillis 168 competent cell.

First the Competent cell of Bacillus subtillis is prepared, its preparation is completed by twice training method: activated at LB agar plate by Bacillus subtillis 168, get mono-clonal to cultivate in LB, volume ratio with 5% is transferred in SP I substratum, cultivate logarithmic phase for 30 DEG C, then same volume ratio is transferred in SP II substratum and cultivates logarithmic phase, centrifugal collecting cell, again cell precipitation is resuspended in SP II substratum, forms the concentrated competent cell that OD600 is approximately 5.0.In the present embodiment, the formula of SPI substratum is: 0.02% caseinic acid hydrolyzate, 0.1% yeast powder, 0.5% glucose, 0.2% (NH ₄) ₂sO ₄, 1.4%K ₂hPO ₄3H ₂o, 0.6%KH ₂pO ₄, 0.1% Trisodium Citrate and 0.02%MgSO ₄7H ₂o.The formula of SPII substratum is: 0.04% caseinic acid hydrolyzate, 0.2% yeast powder, 1.0% glucose, 0.4% (NH ₄) ₂sO ₄, 2.8%K ₂hPO ₄3H ₂o, 1.2%KH ₂pO ₄, 0.2% Trisodium Citrate, 0.5mM CaCl ₂and 2.5mM MgCl ₂.

When transforming 168 competent cell, get the recombinant plasmid pGE-BPB of 1.0 μ g, fully mix on ice with the competent cell of 50 μ l and depositedly educate 30min, adding 5ml LB cultivates based on 37 DEG C of vibration cultivation 2hr, finally cell is heavyly concentrated into 500 μ l through centrifugal, therefrom get 100 μ l coated plates to containing on the culture plate of selection markers, 37 DEG C are cultured to thalline clone and generate.

The secondary homologous recombination of bringing out when the removal that the competent cell of Bacillus subtillis prepares selection markers is cultivated by nonreactive completes.Concrete operations are as follows: get the mono-clonal bacterium colony of 2 strains containing recombinant plasmid, are inoculated into not containing in antibiotic substratum, go down to posterity once, after going down to posterity, cell concn is diluted to 10 through 5 times after 12 hours with the volume ratio of 1% ³-10 ⁴/ ml, then get 200 μ l to be coated onto on the LB culture plate of antibiotic-free, the single thalline clone getting about 100-200 carries out antibiotic tolerance and identifies, obtain 10 do not tolerate antibiotic clone after, utilize PCR method to identify them, determine the genome type of recombinant strain.

2, the genome type of recombinant bacterial strain is differentiated by following PCR method.

First utilize AxyPrep genomic DNA kit to extract the genomic dna of bacterial strain, get 1 μ l 50ng/ μ l genomic dna and make pcr template.

PCR primer divides two groups, and first group of primer aF/aR is for the identification of the gene expression characteristics of nprE in wild Bacillus subtilis, and second group of PCR primer aF/bR is for the identification of removal antibiotic resistance gene and incorporate the genotypic recombinant bacterial strain of pulB.

First group of primer: aF:tcattcggttagacagcgg

aR:cgtaagcaagacgatagctgccgtc

Second group of primer: aF:tcattcggttagacagcgg

bR:gcgaaaacaggctgaagctgaacatgag

PCR reaction system is as follows:

Upstream primer (10 μMs), 3.0 μ l;

Downstream primer (10 μMs), 3.0 μ l;

DNA profiling, 1.0 μ l;

Pfx polysaccharase (5U/ μ l), 0.5 μ l;

Add water to 50 μ l.

1)95℃，2min

2)95℃，25sec

3)56℃，45sec

4)68℃，2min

5) circulation is from 2) to 4), 30 times

6)68℃，3min

7) 4 DEG C, preserve.

The discriminating of PCR primer: get PCR primer 3 μ l, the sepharose of 1% carries out DNA electrophoresis.The difference of wild mushroom and recombinant bacterium is, during with wild Bacillus subtilis 168 genomic dna for template, can obtain the DNA product of 0.8kb; And with recombined bacillus subtilis bacterial strain CH-1 genomic dna for template time, PCR primer is 2.0kb.

Embodiment 3: recombined bacillus subtilis bacterial strain CH-1 fermentative production Pullulanase

First recombined bacillus subtilis bacterial strain CH-1 has carried out fermentation culture in the LB substratum having added 2% sucrose: get mono-clonal recombined bacillus subtilis bacterial strain, be inoculated in the substratum of 5ml, 30 DEG C of incubated overnight, then be inoculated in the triangular flask of the 500ml that 100ml is housed with the volume ratio of 5%, carry out fermentation culture with 200rpm, time sampling carries out enzyme activity determination.

Enzyme activity determination method is as follows: in the pulullan solution of 1.0ml 0.5%, add 1.0ml, the Acetic acid-sodium acetate damping fluid of pH=4.6, then the enzyme liquid (control group is first by 1.0ml enzyme liquid boiling water bath 10min) of 1.0ml is added, water-bath 30min in 60 DEG C of water-baths, add 3,5-dinitrosalicylic acid 3.0ml, boiling water bath 10min, flowing water cooling after taking out, in 550nm light-metering absorption value.An enzyme activity unit is defined as: under the above-described reaction conditions, and per minute decomposition pulullan discharges the enzyme amount needed for 1 μm of ol glucose.

See Fig. 1, this figure is the restructuring bacillus subtilis strain CH-1 schematic diagram that during fermentative production Pullulanase, enzyme work changes with fermentation time in the shaking flask of 100ml.As can be seen from Figure 1: live the highest at fermentation 48 hours enzyme when described recombined bacillus subtilis strain fermentation produces Pullulanase, the highest enzyme is lived as 30.3U/ml.

The enzymatic production mode of Bacillus subtillis affects very large by substratum and fermentation mode, be therefore optimized Media Components, at basic medium, (composition of this basic medium is: 1% peptone, 0.5% (NH ₄) ₂sO ₄, 0.1%KH ₂pO ₄, 0.025%MgSO ₄, 0.0001%FeSO ₄) in add 4.5% sucrose and 6.0% wheat bran+dregs of beans (wherein the mass ratio of wheat bran and dregs of beans is 1:1), and to control starting fermentation pH be 6.23, and in the substratum optimized, the product enzyme performance of CH-1 improves greatly.See Fig. 2, this figure be recombined bacillus subtilis in Optimal Medium during fermentative production Pullulanase enzyme live and the schematic diagram of relation between Preliminary fermentation pH value.As can be seen from Figure 2: when starting fermentation pH is about 6.23, in this batch of experiment, enzyme peak value alive is 268U/ml.

After fermented liquid is centrifugal, obtained fermented liquid supernatant is carried out protein electrophoresis, by comparing with the fermentation supernatant of wild Bacillus subtilis 168, clearly can see that recombined bacillus subtilis fermented liquid supernatant includes the protein band of the Pullulanase of expression; Wild Bacillus subtilis 168 fermentation supernatant does not then have the protein band of Pullulanase.

Above are only part preferred embodiment of the present invention, the present invention is not limited in the content of embodiment.To those skilled in the art, can have various change and change in the concept of technical solution of the present invention, any change done and change, all within scope.

<110> Shanghai Advanced Research Institute, Chinese Academy of Sciences

The recombined bacillus subtilis of a <120> high yield Pullulanase and construction process thereof

<130> 2015

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 8776

<212> DNA

<213> artificial sequence

<400> 1

agctctcgag aagatgatag ctcatcaaaa atcccgccat tgccaaataa atcgtatatg 60

gcattactgc accataatct tttgagattt gattgggata tggcgcaagc agcaagacaa 120

gcagtccgat aatcagcgta taaaataagc ctagtaagat cttatccgtt ctccaataca 180

gcttgaaaaa cactacattc aacgcaatgg gaagagtgat gatgaaaaac agaaacacga 240

atgcaatcgg ctccatccca tccgggtatt ccttccaata cgaaaagaaa ctaaaaatca 300

tttgtacgat cggcaaactg acaacagcaa ggtcgaacgt ataaaactta ccctttccgc 360

catgatcacg cggcatcagc atatagtgaa aagccgtcag cagcacatat ccgtataaca 420

aaaaatgcag cagcggcagc agttcttttc cgtcctctct taagtaagcg ctggtgaagt 480

ttgttgattg cacctggtga ataagttcaa cagacactcc cgccagcagc acaatccgca 540

atataacacc cgccaagaac attgtgcgct gccggtttat tttgggatga tgcaccaaaa 600

gatataagcc cgccagaaca acaattgacc attgaatcag cagggtgctt tgtctgctta 660

atataaaata acgttcgaaa tgcaatacat aatgactgaa taactccaac acgaacaaca 720

atcctttact tcttattaag gcctcattcg gttagacagc ggacttttca aaaagtttca 780

agatgaaaca aaaatatctc atcttcccct tgatatgtaa aaaacataac tcttgaatga 840

accaccacat gacacttgac tcatcttgat attattcaac aaaaacaaac acaggacaat 900

actatcaatt ttgtctagtt atgttagttt ttgttgagta ttccagaatg ctagtttaat 960

ataacaatat aaagttttca gtattttcaa aaagggggat ttattgtggg tgctagcaag 1020

gaattccatg gccggccgac cgggacaatg aaggaaatgg aacatttaac cgcatcaaga 1080

aaaaaagctt caactggtat cagcaggtta tcgccacaaa cggagagagt ctctgacaat 1140

tttttgaaaa ctcatgcgct tcaattgaca ataacgaaat gcaggcggac aataaaagag 1200

aaagatgaac cacccacaga aaggagggat gcctaaaaac gaagaacatt aaaaacatat 1260

atttgcaccg tctaatggat ttatgaaaaa tcattttatc agtttgaaaa ttatgtatta 1320

tgataagaaa gggaggaaga aaatgatcca aaaacgtaaa cgtacagttt ctttccgtct 1380

tgttcttatg tgcacacttc ttttcgtttc tcttcctatc acaaaaacat ctgctgttaa 1440

cctaacgttt caccgcatca ttcgaaaagg atggatgttc ctgctcgcgt ttttgctcac 1500

tgcctcgctg ttctgcccaa caggacagca cgccaaggct gccgcaccgt ttaaccccgg 1560

ggcacaacct gctgtaagta acgcttattt agatgcttcc aaccaagtgt tggtcaagct 1620

tagccagccg tttactcttg gtgaaggttc aagcggtttt acggttcatg atgacacagc 1680

aaataaggat attccagtta catctgttag tgatgccaat caggtaacgg ctgttttagc 1740

aggtactttc cagcatattt ttggggggag tgattgggca ccggataatc acaatacttt 1800

actaaaaaag gtgaatagca atctctatca attttcagga aatcttcctg aaggaaacta 1860

ccaatataaa gtggctttaa atgatagctg gaataatccg agctacccat ctgataacat 1920

taatttgaca gtgccagctg gtggtgccca tgttacattt tcttatatac catccaccca 1980

tgctgtttat gacacgatta acaatcctaa tgcggattta caagtagata gcagcggtgt 2040

taagacggat ctcgtggcgg ttactcttgg agaaaatcct gatgtaagcc ataccctgtc 2100

cattcaaaca gaggactatc aggcaggaca ggtcatacct cgtaaggtgc ttgattcatc 2160

ccagtactac tattccggag atgatctcgg gaatacctat acaaagaatg caactacctt 2220

taaggtctgg gcgcctacat ccactcaagt aaatgtcctt ctttataata gtgcaaccgg 2280

cgcggtaact aaaacggttc caatgaccgc atcaggccat ggtgtatggg aagcaacagt 2340

caaccaagac cttgaaaatt ggtattacat gtatgaggta acaggacaag gctcaacccg 2400

aacggctgtt gatccgtatg caacagctat tgcaccaaac ggaacgagag gcatgattgt 2460

ggacctagcc aaaacagacc cggccggatg ggagagtgac aaacatatta cgccaaagaa 2520

tatagaagat gaagtcatct atgaaatgga tgttcgtgac ttttccatcg actctaattc 2580

gggtatgaaa aataaaggaa agtatttggc acttacagaa aaaggaacta aaggccctga 2640

caatgtaaag acaggggtag attccttaaa acaacttggg attactcatg ttcagcttca 2700

gcctgttttc gcatttaata gtgtcaatga aaacgatcca actcaatata attggggtta 2760

tgaccctcgc aactacaatg ttcctgaggg acaatatgct actaatgcaa acggaacaac 2820

tcggattaaa gagtttaagg aaatggttct ttcactccat caggaccaca ttggggttaa 2880

tatggatgtt gtttataatc atacctttgc cacgcaaatc tctgacttcg ataagattgt 2940

gccagaatat tactaccgca cggatgatgc tggtaactac actaacggct caggtactgg 3000

aaacgaaatc gcagccgaaa gaccaatggt tcaaaaattt attatcgatt cacttaagtt 3060

ttgggtcaat gagtaccacg ttgacggttt ccgttttgac ttaatggcgt tgcttggaaa 3120

agatacaatg tctaaagctg ccacgcagct tcatgccatt gatccaggaa ttgctctcta 3180

cggtgagcca tggacaggag gaacatccgc gctgccagcc gatcagcttt taacaaaagg 3240

agctcaaaaa ggcatgggag tggctgtatt taatgacaat ctgcgaaacg gtttggacgg 3300

cagtgtcttt gattcatctg ctcaaggttt tgcgacaggt gctactggtt taacggatgc 3360

tattaaaaat ggagttgaag gaagtattaa tgacttcacc gcttcaccag gcgagacgat 3420

caactatgtc acaagtcatg ataactatac cctttgggac aagattgccc aaagcaatcc 3480

aaacgattct gaagcggatc gaattaaaat ggatgagctc gctcaagcga tcgtcatgac 3540

ctcacaaggc attcctttca tgcagggcgg ggaagaaatg cttcgtacga aaggcggcaa 3600

cgacaatagc tataatgctg gtgatgtagt gaacgagttt gattggagca gaaaagctca 3660

atatccagat gttttcaatt attatagcgg gctgattcat cttcgtcttg atcacccagc 3720

cttccgcatg acgacagcta atgaaatcaa tagccacctc caattcctaa atagcccaga 3780

gaacacagtg gcctatgaat tatctgatca tgcaaataaa gatacatggg gtaatattgt 3840

ggttatttat aatccaaata aaacggcaga aaccattaat ttgccaagcg ggaaatggga 3900

aatcaatgcg acgagcggta aggtgggaga atccacactt ggtcaagcag agggcagtgt 3960

tcaagttcca ggcatatcta tgatgattct tcatcaagaa gtaagcccat ctgatggtaa 4020

ataagaattc tgctacaggt cacgtggcta tgtgaaggat cgcgcgtcca gttaagagca 4080

aaaacattga caaaaaaatt tatttatgct aaaatttact attaatatat ttgtatgtat 4140

aataagattc tcctggccag gggaatctta ttttttgtgg aggatcattt catgaggaaa 4200

aatgagtcca gcttaacgtc tctaatttca gcttttgccc gtgcatatca cagccgatat 4260

gacacacctc ttatttttga tgattttatc gcaaaagatc tcattaacga aaaagagttt 4320

atcgacatca gtaaaaatat gattcaagaa atatcgtttt tcaacaaaga gatcgccgaa 4380

cgtcttcaaa atgatcctga aaaaatatta aaatgggttg cacaaatcca gctgtctcca 4440

acgcccctag cacgtgcttc ttattgtgaa aaagtcttgc acaacgaatt aatcctgggg 4500

gcaaaacagt atgtcattct tggagcggga ctggatactt tctgctttcg gcatccagaa 4560

ttagaaaaca gcttacaggt tttcgaggtt gatcatccgg ccacacagca attgaaaaaa 4620

aataagctga aggatgcaaa tctgacaatt ccgggtcatc ttcattttgt tcctatggat 4680

ttcaccaaaa cgttttcgta tgatcctctc ttagatgaag gatttaaaaa cacaaaaaca 4740

ttcttcagcc ttctcggagt gtcttattat gtaacacggg aagaaaatgc aagcttgatc 4800

agcaatttat tttctcatgt cccgcctgga acccgggtta aaccgtgtgc tctacgacca 4860

aaactataaa acctttaaga actttctttt tttacaagaa aaaagaaatt agataaatct 4920

ctcatatctt ttattcaata atcgcatccg attgcagtat aaatttaacg atcactcatc 4980

atgttcatat ttatcagagc tcgtgctata attatactaa ttttataagg aggaaaaaat 5040

atgggcattt ttagtatttt tgtaatcagc acagttcatt atcaaccaaa caaaaaataa 5100

gtggttataa tgaatcgtta ataagcaaaa ttcatataac caaattaagg agggaaataa 5160

tgaacgagaa aaatataaaa cacagtcaaa actttattac ttcaaaacat aatatagata 5220

aaataatgac aaatataaga ttaaatgaac atgataatat ctttgaaatc ggctcaggaa 5280

aaggccattt tacccttgaa ttagtaaaga ggtgtaattt cgtaactgcc attgaaatag 5340

accataaatt atgcaaaact acagaaaata aacttgttga tcacgataat ttccaagttt 5400

taaacaagga tatattgcag tttaaatttc ctaaaaacca atcctataaa atatatggta 5460

atatacctta taacataagt acggatataa tacgcaaaat tgtttttgat agtatagcta 5520

atgagattta tttaatcgtg gaatacgggt ttgctaaaag attattaaat acaaaacgct 5580

cattggcatt acttttaatg gcagaagttg atatttctat attaagtatg gttccaagag 5640

aatattttca tcctaaacct aaagtgaata gctcacttat cagattaagt agaaaaaaat 5700

caagaatatc acacaaagat aaacaaaagt ataattattt cgttatgaaa tgggttaaca 5760

aagaatacaa gaaaatattt acaaaaaatc aatttaacaa ttccttaaaa catgcaggaa 5820

ttgacgattt aaacaatatt agctttgaac aattcttatc tcttttcaat agctataaat 5880

tatttaataa gtaagttaag ggatgcataa actgcatccc ttaacttgtt tttcgtgtgc 5940

ctattttttg tgaattgatt atcgatcttt tgcgccatgg atccgcggcg cgcccatatg 6000

catgcactag tgtcgacaag cttctagatc tactagcgca gcttaattaa cctaggctgc 6060

tgccaccgct gagcaataac tagcataacc ccttggggcc tctaaacggg tcttgagggg 6120

ttttttgctg aaaggcggcc gctgttccgg atctgcatcg caggatgctg ctggctaccc 6180

tgtggaacac ctacatctgt attaacgaag cgctggcatt gaccctgagt gatttttctc 6240

tggtcccgcc gcatccatac cgccagttgt ttaccctcac aacgttccag taaccgggca 6300

tgttcatcat cagtaacccg tatcgtgagc atcctctctc gtttcatcgg tatcattacc 6360

cccatgaaca gaaatccccc ttacacggag gcatcagtga ccaaacagga aaaaaccgcc 6420

cttaacatgg cccgctttat cagaagccag acattaacgc ttctggagaa actcaacgag 6480

ctggacgcgg atgaacaggc agacatctgt gaatcgcttc acgaccacgc tgatgagctt 6540

taccgcagct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc 6600

ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc 6660

gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg tagcgatagc 6720

ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata 6780

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg 6840

cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc 6900

actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt 6960

gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc 7020

ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa 7080

acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc 7140

ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg 7200

cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc 7260

tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc 7320

gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca 7380

ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact 7440

acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg 7500

gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt 7560

ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct 7620

tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga 7680

gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa 7740

tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac 7800

ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga 7860

taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc 7920

cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca 7980

gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta 8040

gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct gcaggcatcg 8100

tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc 8160

gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg 8220

ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt 8280

ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt 8340

cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca acacgggata 8400

ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc 8460

gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac 8520

ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa 8580

ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct 8640

tcctttttca atattattga agcatttatc agggttattg tctcatgagc ggatacatat 8700

ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc 8760

cacctgacgt cttaag 8776

<210> 2

<211> 317

<212> DNA

<213> artificial sequence

<400> 2

ccatggccgg ccgaccggga caatgaagga aatggaacat ttaaccgcat caagaaaaaa 60

agcttcaact ggtatcagca ggttatcgcc acaaacggag agagtctctg acaatttttt 120

gaaaactcat gcgcttcaat tgacaataac gaaatgcagg cggacaataa aagagaaaga 180

tgaaccaccc acagaaagga gggatgccta aaaacgaaga acattaaaaa catatatttg 240

caccgtctaa tggatttatg aaaaatcatt ttatcagttt gaaaattatg tattatgata 300

agaaagggag gaagaaa 317

<210> 3

<211> 2580

<212> DNA

<213> artificial sequence

<400> 3

ctaacgtttc accgcatcat tcgaaaagga tggatgttcc tgctcgcgtt tttgctcact 60

gcctcgctgt tctgcccaac aggacagcac gccaaggctg ccgcaccgtt taaccccggg 120

gcacaacctg ctgtaagtaa cgcttattta gatgcttcca accaagtgtt ggtcaagctt 180

agccagccgt ttactcttgg tgaaggttca agcggtttta cggttcatga tgacacagca 240

aataaggata ttccagttac atctgttagt gatgccaatc aggtaacggc tgttttagca 300

ggtactttcc agcatatttt tggggggagt gattgggcac cggataatca caatacttta 360

ctaaaaaagg tgaatagcaa tctctatcaa ttttcaggaa atcttcctga aggaaactac 420

caatataaag tggctttaaa tgatagctgg aataatccga gctacccatc tgataacatt 480

aatttgacag tgccagctgg tggtgcccat gttacatttt cttatatacc atccacccat 540

gctgtttatg acacgattaa caatcctaat gcggatttac aagtagatag cagcggtgtt 600

aagacggatc tcgtggcggt tactcttgga gaaaatcctg atgtaagcca taccctgtcc 660

attcaaacag aggactatca ggcaggacag gtcatacctc gtaaggtgct tgattcatcc 720

cagtactact attccggaga tgatctcggg aatacctata caaagaatgc aactaccttt 780

aaggtctggg cgcctacatc cactcaagta aatgtccttc tttataatag tgcaaccggc 840

gcggtaacta aaacggttcc aatgaccgca tcaggccatg gtgtatggga agcaacagtc 900

aaccaagacc ttgaaaattg gtattacatg tatgaggtaa caggacaagg ctcaacccga 960

acggctgttg atccgtatgc aacagctatt gcaccaaacg gaacgagagg catgattgtg 1020

gacctagcca aaacagaccc ggccggatgg gagagtgaca aacatattac gccaaagaat 1080

atagaagatg aagtcatcta tgaaatggat gttcgtgact tttccatcga ctctaattcg 1140

ggtatgaaaa ataaaggaaa gtatttggca cttacagaaa aaggaactaa aggccctgac 1200

aatgtaaaga caggggtaga ttccttaaaa caacttggga ttactcatgt tcagcttcag 1260

cctgttttcg catttaatag tgtcaatgaa aacgatccaa ctcaatataa ttggggttat 1320

gaccctcgca actacaatgt tcctgaggga caatatgcta ctaatgcaaa cggaacaact 1380

cggattaaag agtttaagga aatggttctt tcactccatc aggaccacat tggggttaat 1440

atggatgttg tttataatca tacctttgcc acgcaaatct ctgacttcga taagattgtg 1500

ccagaatatt actaccgcac ggatgatgct ggtaactaca ctaacggctc aggtactgga 1560

aacgaaatcg cagccgaaag accaatggtt caaaaattta ttatcgattc acttaagttt 1620

tgggtcaatg agtaccacgt tgacggtttc cgttttgact taatggcgtt gcttggaaaa 1680

gatacaatgt ctaaagctgc cacgcagctt catgccattg atccaggaat tgctctctac 1740

ggtgagccat ggacaggagg aacatccgcg ctgccagccg atcagctttt aacaaaagga 1800

gctcaaaaag gcatgggagt ggctgtattt aatgacaatc tgcgaaacgg tttggacggc 1860

agtgtctttg attcatctgc tcaaggtttt gcgacaggtg ctactggttt aacggatgct 1920

attaaaaatg gagttgaagg aagtattaat gacttcaccg cttcaccagg cgagacgatc 1980

aactatgtca caagtcatga taactatacc ctttgggaca agattgccca aagcaatcca 2040

aacgattctg aagcggatcg aattaaaatg gatgagctcg ctcaagcgat cgtcatgacc 2100

tcacaaggca ttcctttcat gcagggcggg gaagaaatgc ttcgtacgaa aggcggcaac 2160

gacaatagct ataatgctgg tgatgtagtg aacgagtttg attggagcag aaaagctcaa 2220

tatccagatg ttttcaatta ttatagcggg ctgattcatc ttcgtcttga tcacccagcc 2280

ttccgcatga cgacagctaa tgaaatcaat agccacctcc aattcctaaa tagcccagag 2340

aacacagtgg cctatgaatt atctgatcat gcaaataaag atacatgggg taatattgtg 2400

gttatttata atccaaataa aacggcagaa accattaatt tgccaagcgg gaaatgggaa 2460

atcaatgcga cgagcggtaa ggtgggagaa tccacacttg gtcaagcaga gggcagtgtt 2520

caagttccag gcatatctat gatgattctt catcaagaag taagcccatc tgatggtaaa 2580

<210> 4

<211> 3010

<212> DNA

<213> artificial sequence

<400> 4

gaattccatg gccggccgac cgggacaatg aaggaaatgg aacatttaac cgcatcaaga 60

aaaaaagctt caactggtat cagcaggtta tcgccacaaa cggagagagt ctctgacaat 120

tttttgaaaa ctcatgcgct tcaattgaca ataacgaaat gcaggcggac aataaaagag 180

aaagatgaac cacccacaga aaggagggat gcctaaaaac gaagaacatt aaaaacatat 240

atttgcaccg tctaatggat ttatgaaaaa tcattttatc agtttgaaaa ttatgtatta 300

tgataagaaa gggaggaaga aaatgatcca aaaacgtaaa cgtacagttt ctttccgtct 360

tgttcttatg tgcacacttc ttttcgtttc tcttcctatc acaaaaacat ctgctgttaa 420

cctaacgttt caccgcatca ttcgaaaagg atggatgttc ctgctcgcgt ttttgctcac 480

tgcctcgctg ttctgcccaa caggacagca cgccaaggct gccgcaccgt ttaaccccgg 540

ggcacaacct gctgtaagta acgcttattt agatgcttcc aaccaagtgt tggtcaagct 600

tagccagccg tttactcttg gtgaaggttc aagcggtttt acggttcatg atgacacagc 660

aaataaggat attccagtta catctgttag tgatgccaat caggtaacgg ctgttttagc 720

aggtactttc cagcatattt ttggggggag tgattgggca ccggataatc acaatacttt 780

actaaaaaag gtgaatagca atctctatca attttcagga aatcttcctg aaggaaacta 840

ccaatataaa gtggctttaa atgatagctg gaataatccg agctacccat ctgataacat 900

taatttgaca gtgccagctg gtggtgccca tgttacattt tcttatatac catccaccca 960

tgctgtttat gacacgatta acaatcctaa tgcggattta caagtagata gcagcggtgt 1020

taagacggat ctcgtggcgg ttactcttgg agaaaatcct gatgtaagcc ataccctgtc 1080

cattcaaaca gaggactatc aggcaggaca ggtcatacct cgtaaggtgc ttgattcatc 1140

ccagtactac tattccggag atgatctcgg gaatacctat acaaagaatg caactacctt 1200

taaggtctgg gcgcctacat ccactcaagt aaatgtcctt ctttataata gtgcaaccgg 1260

cgcggtaact aaaacggttc caatgaccgc atcaggccat ggtgtatggg aagcaacagt 1320

caaccaagac cttgaaaatt ggtattacat gtatgaggta acaggacaag gctcaacccg 1380

aacggctgtt gatccgtatg caacagctat tgcaccaaac ggaacgagag gcatgattgt 1440

ggacctagcc aaaacagacc cggccggatg ggagagtgac aaacatatta cgccaaagaa 1500

tatagaagat gaagtcatct atgaaatgga tgttcgtgac ttttccatcg actctaattc 1560

gggtatgaaa aataaaggaa agtatttggc acttacagaa aaaggaacta aaggccctga 1620

caatgtaaag acaggggtag attccttaaa acaacttggg attactcatg ttcagcttca 1680

gcctgttttc gcatttaata gtgtcaatga aaacgatcca actcaatata attggggtta 1740

tgaccctcgc aactacaatg ttcctgaggg acaatatgct actaatgcaa acggaacaac 1800

tcggattaaa gagtttaagg aaatggttct ttcactccat caggaccaca ttggggttaa 1860

tatggatgtt gtttataatc atacctttgc cacgcaaatc tctgacttcg ataagattgt 1920

gccagaatat tactaccgca cggatgatgc tggtaactac actaacggct caggtactgg 1980

aaacgaaatc gcagccgaaa gaccaatggt tcaaaaattt attatcgatt cacttaagtt 2040

ttgggtcaat gagtaccacg ttgacggttt ccgttttgac ttaatggcgt tgcttggaaa 2100

agatacaatg tctaaagctg ccacgcagct tcatgccatt gatccaggaa ttgctctcta 2160

cggtgagcca tggacaggag gaacatccgc gctgccagcc gatcagcttt taacaaaagg 2220

agctcaaaaa ggcatgggag tggctgtatt taatgacaat ctgcgaaacg gtttggacgg 2280

cagtgtcttt gattcatctg ctcaaggttt tgcgacaggt gctactggtt taacggatgc 2340

tattaaaaat ggagttgaag gaagtattaa tgacttcacc gcttcaccag gcgagacgat 2400

caactatgtc acaagtcatg ataactatac cctttgggac aagattgccc aaagcaatcc 2460

aaacgattct gaagcggatc gaattaaaat ggatgagctc gctcaagcga tcgtcatgac 2520

ctcacaaggc attcctttca tgcagggcgg ggaagaaatg cttcgtacga aaggcggcaa 2580

cgacaatagc tataatgctg gtgatgtagt gaacgagttt gattggagca gaaaagctca 2640

atatccagat gttttcaatt attatagcgg gctgattcat cttcgtcttg atcacccagc 2700

cttccgcatg acgacagcta atgaaatcaa tagccacctc caattcctaa atagcccaga 2760

gaacacagtg gcctatgaat tatctgatca tgcaaataaa gatacatggg gtaatattgt 2820

ggttatttat aatccaaata aaacggcaga aaccattaat ttgccaagcg ggaaatggga 2880

aatcaatgcg acgagcggta aggtgggaga atccacactt ggtcaagcag agggcagtgt 2940

tcaagttcca ggcatatcta tgatgattct tcatcaagaa gtaagcccat ctgatggtaa 3000

ataagaattc 3010

<210> 5

<211> 46

<212> DNA

<213> artificial sequence

<400> 5

tagtaaaaag aagcaggttc ctccatacct gcttcttttt aagctt 46

<210> 6

<211> 2024

<212> DNA

<213> artificial sequence

<400> 6

aacccgacat ccggcgttct catggcggtg cttgccgcca gcggtattcc gtatgtcaag 60

tggctgcggt ttatggtgcc gcttgctctg atttggttct tgatcgggct tgtctttatc 120

gtgatcggag tcatgatcaa ttgggggccg ttttaacgat tgctgcccgc cggcttgtac 180

ggcgggcttt tgagttattc attgcagaag cgcaggctgt tattgtaaca tgtaagccat 240

aagccattcg taaaagtgcg ggaggaaggt catgaataat ctgcgtaata gactttcagg 300

cgtgaatggg aaaaataaga gagtaaaaga aaaagaacaa aaaatctggt cggagattgg 360

gatgatagcg ggagcatttg cgctgcttga tgtgatcatc cgcggcatta tgtttgaatt 420

tccgtttaaa gaatgggctg caagccttgt gtttttgttc atcattatct tatattactg 480

catcagggct gcggcatccg gaatgctcat gccgagaata gacaccaaag aagaactgca 540

aaaacgggtg aagcagcagc gaatagaatc aattgcggtc gcctttgcgg tagtggtgct 600

tacgatgtac gacaggggga ttccccatac attcttcgct tggctgaaaa tgattcttct 660

ttttatcgtc tgcggcggcg ttctgtttct gcttcggtat gtgattgtga agctggctta 720

cagaagagcg gtaaaagaag aaataaaaaa gaaatcatct tttttgtttg gaaagcgagg 780

gaagcgttca cagtttcggg cagctttttt tataggaaca ttgatttgta ttcactctgc 840

caagttgttt tgatagagtg attgtgataa ttttaaatgt aagcgttaac aaaattctcc 900

agtcttcaca tcggtttgaa aggaggaagc ggaagaatga agtaagaggg atttttgact 960

ccgaagtaag tcttcaaaaa atcaaataag gagtgtcaag gctagcaagg aattcttagg 1020

taccgggcaa ggctagacgg gacttaccga aagaaaccat caatgatggt ttcttttttg 1080

ttcataaatc agacaaaact tttctcttgc aaaagtttgt gaagtgttgc acaatataaa 1140

tgtgaaatac ttcacaaaca aaaagacatc aaagagaaac ataccctgga aggatgatta 1200

atgatgaaca aacatgtaaa taaagtagct ttaatcggag cgggttttgt tggaagcagt 1260

tatgcatttg cgttaattaa ccaaggaatc acagatgagc ttgtggtcat tgatgtaaat 1320

aaagaaaaag caatgggcga tgtgatggat ttaaaccacg gaaaggcgtt tgcgccacaa 1380

ccggtcaaaa catcttacgg aacatatgaa gactgcaagg atgctgatat tgtctgcatt 1440

tgcgccggag caaaccaaaa acctggtgag acacgccttg aattagtaga aaagaacttg 1500

aagattttca aaggcatcgt tagtgaagtc atggcgagcg gatttgacgg cattttctta 1560

gtcgcgacaa atccggttga tatcctgact tacgcaacat ggaaattcag cggcctgcca 1620

aaagagcggg tgattggaag cggcacaaca cttgattctg cgagattccg tttcatgctg 1680

agcgaatact ttggcgcagc gcctcaaaac gtacacgcgc atattatcgg agagcacggc 1740

gacacagagc ttcctgtttg gagccacgcg aatgtcggcg gtgtgccggt cagtgaactc 1800

gttgagaaaa acgatgcgta caaacaagag gagctggacc aaattgtaga tgatgtgaaa 1860

aacgcagctt accatatcat tgagaaaaaa ggcgcgactt attatggggt tgcgatgagt 1920

cttgctcgca ttacaaaagc cattcttcat aatgaaaaca gcatattaac tgtcagcaca 1980

tatttggacg ggcaatacgg tgcagatgac gtgtacatcg gtgt 2024

Claims

1. a recombined bacillus subtilis for high yield Pullulanase, is characterized in that: by substituting the neutral protease gene nprE of subtilis containing the artificial operons BPB original position expressing Pullulanase gene, obtain described recombined bacillus subtilis; The nucleotide sequence of described artificial operons BPB is as shown in SEQ ID NO.4.

2. the recombined bacillus subtilis of high yield Pullulanase as claimed in claim 1, it is characterized in that: described artificial operons BPB proceeds in subtilis by recombinant plasmid pGE-BPB, the nucleotide sequence of described recombinant plasmid pGE-BPB is as shown in SEQ ID NO.1; Described artificial operons BPB includes the pulB gene through codon optimized acquisition, and the nucleotide sequence of described pulB gene is as shown in SEQ ID NO.3.

3. the recombined bacillus subtilis of high yield Pullulanase as claimed in claim 1 or 2, is characterized in that: adopt type strain subtilis 168 to build described recombined bacillus subtilis as starting strain.

4. the method for the recombined bacillus subtilis fermentative production Pullulanase of the high yield Pullulanase described in claim 1 or 2, the method is: in basic medium, add the sucrose of 4.5% and the wheat bran of 6.0% adds dregs of beans, controlling starting fermentation pH value is 6.2-6.3, fermentation culture is carried out to described recombined bacillus subtilis, produces and obtain Pullulanase.

5. a construction process for the recombined bacillus subtilis of high yield Pullulanase, the method comprises the steps:

Step 2, is converted in bacillus subtilis bacterium competence cell by the recombinant plasmid pGE-BPB of aforementioned structure, and described artificial operons BPB substitutes the neutral protease gene nprE in bacillus subtilis bacterium competence cell by secondary recombination form original position.

6. the construction process of the recombined bacillus subtilis of high yield Pullulanase as claimed in claim 5, it is characterized in that, described artificial operons BPB includes: promotor PyxiE, cry3A RNA critical sequences, from the signal peptide sequence SPamyL of bacillus licheniformis amylase secretion, through codon optimized pulB gene, and from the terminator sequence T-aprE of bacillus amyloliquefaciens aprE gene; The nucleotide sequence of described promotor PyxiE and cry3A RNA critical sequences is as shown in SEQ ID NO.2; The nucleotide sequence of described pulB gene is as shown in SEQ ID NO.3; The nucleotide sequence of described T-aprE is as shown in SEQ ID NO.5.

7. the construction process of the recombined bacillus subtilis of high yield Pullulanase as claimed in claim 5, it is characterized in that: the neutral protease gene nprE in bacillus subtilis bacterium competence cell is knocked out by secondary recombination form by described recombinant plasmid pGE-BPB, the nucleotide sequence of the restructuring arm DNA knocked out for neutral protease gene nprE is as shown in SEQ ID NO.6.

8. one kind for expressing the gene order of Pullulanase, it is characterized in that: this gene order is the nucleotide sequence of artificial operons BPB or has the nucleotide sequence of more than 90% homology with artificial operons BPB, and the nucleotide sequence of described artificial operons BPB is as shown in SEQ ID NO.4.

9. for expressing a recombinant plasmid pGE-BPB for Pullulanase, it is characterized in that: the nucleotide sequence of described recombinant plasmid pGE-BPB is as shown in SEQ ID NO.1.

10. a Pullulanase gene, is characterized in that: the nucleotide sequence of described Pullulanase gene is as shown in SEQ ID NO.3.