CN113755518B - Method for constructing recombinant yarrowia lipolytica and application thereof - Google Patents

Abstract

The application discloses a method for improving the temperature tolerance of yarrowia lipolytica or improving the erythritol yield of yarrowia lipolytica under high temperature conditions, which comprises the following steps: over-expressing the high temperature tolerance gene in yarrowia lipolytica of the recipient to obtain yarrowia lipolytica of interest which is higher in high temperature tolerance or erythritol yield than the yarrowia lipolytica of the recipient. According to the application, the heat-resistant gene information of Saccharomyces cerevisiae and thermophilic microorganisms is excavated and arranged through NCBI, PDB and other databases, genes with different functions are used as candidate elements, a plasmid expression vector is constructed after codon optimization, the plasmid expression vector is transformed into yarrowia lipolytica industrial strains, recombinant expression strains are screened, and through fermentation evaluation, the heat-resistant genes Yap1, hsp12, vma2, hul5, tsa1 and Groes with different functions, which can improve the erythritol yield under the condition of 35 ℃, are obtained.

Description

Method for constructing recombinant yarrowia lipolytica and application thereof

Technical Field

The application relates to a method for constructing recombinant yarrowia lipolytica and application thereof in the field of biotechnology.

Background

Erythritol (1, 2,3, 4-butanetetrachol) is a four carbon functional sugar alcohol that is widely distributed in fruits, fermented foods and animals. Because of low metabolic energy in the organism, the compound can prevent and treat dental caries, has low insulin metabolic response and the like, is a low-calorie sweetener, and is widely applied to the fields of food, medicine, chemical industry and the like. The erythritol has huge market development space and very broad application prospect. Although foods such as fruits and kelp widely contain erythritol, the production of erythritol by fermentation with hypertonic or hypertonic-resistant yeast organisms is a major production method. At present, yarrowia lipolytica (yarrowia lipolytica) has realized large-scale erythritol fermentation production, and has achieved better economic benefits. However, the fermentation temperature for producing erythritol by using the strain is generally 30 ℃, and the fermentation temperature needs to be subjected to circulating cooling treatment during the production in seasons with higher temperature such as summer, thereby increasing the production cost, even leading to the shutdown of factories, and seriously affecting the production operation and economic benefits of enterprises. Therefore, the temperature tolerance of yarrowia lipolytica is improved, the production period is increased, and the economic benefit is improved.

Traditional mutagenesis is time-consuming and labor-consuming, has poor genetic stability of the strain, and is generally not suitable for constructing industrial microbial species at the expense of reduced product yield. Along with the elucidation of the response and defense mechanism of the saccharomyces cerevisiae under high temperature stress and the characterization of the thermophilic bacteria source heat-resistant element, a new target is provided for rational breeding of the high temperature resistant yeast. For example, researchers have found that overexpression of ubiquitin ligase Rsp5 and ubiquitin binding enzyme results in improved multiple stress tolerance at higher temperatures (39 ℃); heat stress also causes ROS damage, and yeast heat resistance can be improved by knocking out the glycosyl phosphatidylinositol-immobilized membrane protein encoding gene DFG 5. Liu et al have significantly higher cell viability at 42℃than the control strain by introducing a thermoelement from Thermoanaerobactertengcondensis. Zhou et al greatly enhanced the high temperature growth of E.coli and Saccharomyces cerevisiae (2.6 fold increase in biomass at 36 ℃) by heterologous expression of the cold shock protein cspL from Bacillus coagulans 2-6. Wang et al maintained the high erythritol production properties at 33℃by over-expressing the Rsp5 gene alone in yarrowia lipolytica.

Under high temperature stress, the functional proteins in the yarrowia lipolytica cells can be subjected to thermal denaturation, misfolding, aggregation and the like; intracellular pH homeostasis may be imbalanced; intracellular structures may be subject to oxidative damage; the nucleic acid may be degraded or mutated. Therefore, aiming at the influence of high temperature stress on the yeast, the element with the corresponding protection function is mined, and the method has very important significance for improving the capacity of yarrowia lipolytica for high-yield erythritol at high temperature.

Disclosure of Invention

The technical problem to be solved by the application is how to improve the temperature tolerance of yarrowia lipolytica and how to improve the erythritol yield of yarrowia lipolytica under high temperature conditions.

In order to solve the above technical problems, a first object of the present application is to provide a method for constructing recombinant yarrowia lipolytica, comprising introducing a high temperature tolerance gene into yarrowia lipolytica to obtain the recombinant yarrowia lipolytica; the high temperature tolerance gene is at least one of the following genes: groes gene, hsp12 gene, tsa1 gene, hul gene, vma2 gene, and Yap1 gene;

the Groes gene encodes any one of the following proteins A1) to A3):

a1 Amino acid sequence is protein of sequence 12 in the sequence table,

a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of A1), has more than 80 percent of identity with the protein shown in A1) and has high temperature tolerance activity,

a3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1) or A2);

the Hsp12 gene encodes any one of the following proteins B1) -B3):

b1 Amino acid sequence is protein of sequence 8 in the sequence table,

b2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of B1), has more than 80 percent of identity with the protein shown in A1) and has high temperature tolerance activity,

b3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of B1) or B2);

the Tsa1 gene encodes any one of the following C1) -C3) proteins:

c1 Amino acid sequence is protein of sequence 11 in the sequence table,

c2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of C1), has more than 80 percent of identity with the protein shown in C1) and has high temperature tolerance activity,

c3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of C1) or C2);

the Hul gene encodes any one of the following proteins D1) -D3):

d1 Amino acid sequence is protein of sequence 10 in the sequence table,

d2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of D1), has more than 80 percent of identity with the protein shown in D1) and has high temperature tolerance activity,

d3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of D1) or D2);

the Vma2 gene encodes any one of the following proteins E1) -E3):

e1 Amino acid sequence is protein of sequence 9 in the sequence table,

e2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of E1), has more than 80 percent of identity with the protein shown in E1) and has high temperature tolerance activity,

e3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of E1) or E2);

the Yap1 gene encodes any one of the following proteins F1) -F3):

f1 Amino acid sequence is protein of sequence 7 in the sequence table,

f2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of F1), has more than 80 percent of identity with the protein shown in F1) and has high temperature tolerance activity,

f3 Fusion proteins obtained by ligating protein tags to the N-terminal or/and C-terminal of F1) or F2).

The high temperature is 31-40 ℃, and can be 35 ℃ in particular.

Wherein, the sequence 7 in the sequence table consists of 650 amino acid residues, the sequence 8 in the sequence table consists of 109 amino acid residues, the sequence 9 in the sequence table consists of 517 amino acid residues, the sequence 10 in the sequence table consists of 910 amino acid residues, the sequence 11 in the sequence table consists of 196 amino acid residues, and the sequence 12 in the sequence table consists of 101 amino acid residues.

In the method, the protein can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

In the above method, the protein may be derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) or Thermophilus (Thermus thermophilus).

In the above method, the protein tag (protein-tag) refers to a polypeptide or protein that is fusion expressed together with the target protein by using a DNA in vitro recombination technique, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

In the above method, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the above method, the 80% identity or more may be at least 80%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

In the above method, the Groes gene is a gene represented by a 1) or a 2) as follows:

a1 Coding sequence (CDS) of the coding strand is a cDNA molecule or a DNA molecule of sequence 6 in the sequence table,

a2 The nucleotide of the coding chain is a cDNA molecule or a DNA molecule of a sequence 6 in a sequence table;

the Hsp12 gene is a gene shown in the following b 1) or b 2):

b1 The coding sequence (CDS) of the coding strand is a cDNA molecule or a DNA molecule of a sequence 2 in a sequence table,

b2 The nucleotide of the coding chain is a cDNA molecule or a DNA molecule of a sequence 2 in a sequence table;

the Tsa1 gene is a gene shown in the following c 1) or c 2):

c1 Coding sequence (CDS) of the coding strand is a cDNA molecule or a DNA molecule of sequence 5 in the sequence listing,

c2 The nucleotide of the coding chain is a cDNA molecule or a DNA molecule of a sequence 5 in a sequence table;

the Hul gene is a gene shown in the following d 1) or d 2):

d1 Coding sequence (CDS) of the coding strand is a cDNA molecule or a DNA molecule of sequence 4 in the sequence table,

d2 The nucleotide of the coding chain is a cDNA molecule or a DNA molecule of a sequence 4 in a sequence table;

the Vma2 gene is a gene shown in the following e 1) or e 2):

e1 Coding sequence (CDS) of the coding strand is cDNA molecule or DNA molecule of sequence 3 in the sequence table,

e2 The nucleotide of the coding chain is a cDNA molecule or a DNA molecule of a sequence 3 in a sequence table;

the Yap1 gene is a gene shown in the following f 1) or f 2):

f1 Coding sequence (CDS) of the coding strand is cDNA molecule or DNA molecule of sequence 1 in the sequence table,

f2 The nucleotide of the coding chain is a cDNA molecule or a DNA molecule of a sequence 1 in a sequence table.

Wherein, the sequence 1 in the sequence table consists of 1953 nucleotides, and codes the protein shown in the sequence 7 in the sequence table; sequence 2 in the sequence table consists of 330 nucleotides and codes protein shown in sequence 8 in the sequence table; sequence 3 in the sequence table consists of 1554 nucleotides and codes protein shown in sequence 9 in the sequence table; sequence 4 in the sequence table consists of 2733 nucleotides and codes protein shown in sequence 10 in the sequence table; sequence 5 in the sequence table consists of 591 nucleotides and codes protein shown in sequence 11 in the sequence table; sequence 6 in the sequence table consists of 306 nucleotides and codes for a protein shown in sequence 12 in the sequence table.

In the above method, the recombinant yarrowia lipolytica has a higher erythritol yield than the yarrowia lipolytica under high temperature conditions. The high temperature is 31-40 ℃, and can be 35 ℃ in particular.

A second object of the present application is to protect recombinant yarrowia lipolytica constructed in the above-described manner.

A third object of the present application is the use of a high temperature tolerance gene for increasing erythritol production by yarrowia lipolytica under high temperature conditions or for increasing high temperature tolerance by yarrowia lipolytica, said high temperature tolerance gene being at least one of the following genes: groes gene, hsp12 gene, tsa1 gene, hul gene, vma2 gene, and Yap1 gene;

the Groes gene encodes any one of the following proteins A1) to A3):

a1 Amino acid sequence is protein of sequence 12 in the sequence table,

a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of A1), has more than 80 percent of identity with the protein shown in A1) and has high temperature tolerance activity,

a3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1) or A2);

the Hsp12 gene encodes any one of the following proteins B1) -B3):

b1 Amino acid sequence is protein of sequence 8 in the sequence table,

b2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of B1), has more than 80 percent of identity with the protein shown in A1) and has high temperature tolerance activity,

b3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of B1) or B2);

the Tsa1 gene encodes any one of the following C1) -C3) proteins:

c1 Amino acid sequence is protein of sequence 11 in the sequence table,

c2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of C1), has more than 80 percent of identity with the protein shown in C1) and has high temperature tolerance activity,

c3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of C1) or C2);

the Hul gene encodes any one of the following proteins D1) -D3):

d1 Amino acid sequence is protein of sequence 10 in the sequence table,

d2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of D1), has more than 80 percent of identity with the protein shown in D1) and has high temperature tolerance activity,

d3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of D1) or D2);

the Vma2 gene encodes any one of the following proteins E1) -E3):

e1 Amino acid sequence is protein of sequence 9 in the sequence table,

e2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of E1), has more than 80 percent of identity with the protein shown in E1) and has high temperature tolerance activity,

e3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of E1) or E2);

the Yap1 gene encodes any one of the following proteins F1) -F3):

f1 Amino acid sequence is protein of sequence 7 in the sequence table,

f2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of F1), has more than 80 percent of identity with the protein shown in F1) and has high temperature tolerance activity,

f3 Fusion proteins obtained by ligating protein tags to the N-terminal or/and C-terminal of F1) or F2).

The application also provides application of the high-temperature tolerance gene in constructing high-temperature resistant recombinant yarrowia lipolytica, wherein the high-temperature tolerance gene comprises at least one of the following genes: groes gene, hsp12 gene, tsa1 gene, hul gene, vma2 gene, and Yap1 gene;

the Groes gene encodes any one of the following proteins A1) to A3):

a1 Amino acid sequence is protein of sequence 12 in the sequence table,

a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of A1), has more than 80 percent of identity with the protein shown in A1) and has high temperature tolerance activity,

a3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1) or A2);

the Hsp12 gene encodes any one of the following proteins B1) -B3):

b1 Amino acid sequence is protein of sequence 8 in the sequence table,

b2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of B1), has more than 80 percent of identity with the protein shown in A1) and has high temperature tolerance activity,

b3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of B1) or B2);

the Tsa1 gene encodes any one of the following C1) -C3) proteins:

c1 Amino acid sequence is protein of sequence 11 in the sequence table,

c2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of C1), has more than 80 percent of identity with the protein shown in C1) and has high temperature tolerance activity,

c3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of C1) or C2);

the Hul gene encodes any one of the following proteins D1) -D3):

d1 Amino acid sequence is protein of sequence 10 in the sequence table,

d2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of D1), has more than 80 percent of identity with the protein shown in D1) and has high temperature tolerance activity,

d3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of D1) or D2);

the Vma2 gene encodes any one of the following proteins E1) -E3):

e1 Amino acid sequence is protein of sequence 9 in the sequence table,

e2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of E1), has more than 80 percent of identity with the protein shown in E1) and has high temperature tolerance activity,

e3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of E1) or E2);

the Yap1 gene encodes any one of the following proteins F1) -F3):

f1 Amino acid sequence is protein of sequence 7 in the sequence table,

f2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of F1), has more than 80 percent of identity with the protein shown in F1) and has high temperature tolerance activity,

f3 Fusion proteins obtained by ligating protein tags to the N-terminal or/and C-terminal of F1) or F2).

In the above application, the elevated temperature is 31 ℃ to 40 ℃, and may be specifically 35 ℃.

In order to solve the technical problems, the application also provides the application of the method or the recombinant yarrowia lipolytica in erythritol production. The erythritol is produced by producing erythritol at a high temperature of 31-40 ℃, and specifically can be 35 ℃.

The agent provided by the application contains a substance for promoting the expression of the high temperature tolerance gene in yarrowia lipolytica.

The active ingredient of the above-mentioned agent may be a substance that promotes the expression of a high temperature tolerance gene in yarrowia lipolytica, the active ingredient of the above-mentioned agent may further contain other biological components or/and non-biological components, and the other active ingredient of the above-mentioned agent may be determined by one skilled in the art based on the effect of improving the high temperature tolerance or erythritol production of yarrowia lipolytica.

The application also protects the application of the method or the reagent in erythritol production.

According to the application, the sequenced Saccharomyces cerevisiae, thermophilic microorganisms and heat-resistant gene information thereof are mined and sorted through NCBI, PDB and other databases, and genes with different functions and obvious reported effects in the existing literature are combined as candidate elements. Constructing a plasmid expression vector after codon optimization, transforming into yarrowia lipolytica strains, and screening recombinant expression strains. Through fermentation evaluation, different functional heat-resistant genes Yap1, hsp12, vma2, hul5, tsa1 and Groes which can improve the erythritol yield under the condition of 35 ℃ are obtained. Compared with a control strain transformed with an empty plasmid, the growth of the strain expressing the heat-resistant genes Yap1, hsp12, vma2, hul5, tsa1 or Groes under the condition of 35 ℃ is improved, and the erythritol yield is also obviously increased.

Preservation description

Strain name: yarrowia lipolytica

Latin name: yarrowia lipolytica

Strain number: ERY01

Preservation mechanism: china general microbiological culture Collection center (China Committee for culture Collection of microorganisms)

The preservation organization is abbreviated as: CGMCC

Address: beijing city, chaoyang area, north Chenxi Lu No. 1 and 3

Preservation date: 2021, 7, 27

Accession numbers of the preservation center: CGMCC No.22966

Drawings

FIG. 1 shows the growth of each strain at 35℃for 72 hours in example 1 of the present application.

FIG. 2 shows erythritol yields of the respective strains of example 1 of the present application when fermented at 35℃for 72 hours.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the examples described below are all conventional biochemical reagents, unless otherwise specified, and are commercially available.

Strain 1

Saccharomyces cerevisiae BY4741 in the examples described below is described in non-patent documents "Zhang G, lin Y, qi X, li L, wang Q, ma Y.TALENs-assisted multiplex editing for accelerated genome evolution to improve yeast phenolates.ACS Synth biol.2015;4 (10): 1101-11", available to the public from the institute of Tianjin Industrial biotechnology, national academy of sciences, to repeat the experiments of the present application, are not useful for other purposes.

Yarrowialipolyticastrain W29 (CLIB 89) in the examples described below is ARS Culture Collection (NRRL) product.

Yarrowia lipolytica industrial strain eri 01 in the following examples was deposited with the China general microbiological culture Collection center, accession number: CGMCC No.22966, classification name: yarrowia lipolytica (Yarrowia lipolytica), date of preservation: 2021, 7, 27, deposit unit address: no. 1 and No. 3 of the north cinquefoil of the morning sun area of beijing city.

2 Medium

The seed liquid culture medium consists of a solute and a solvent, wherein the solvent is water, and the concentration of the solute is as follows: glucose 20% (w/v: g/mL), yeast extract 1%, potassium dihydrogen phosphate 0.1%, ammonium citrate 0.5%, magnesium sulfate heptahydrate 0.05%, and North fungus 800mg/L.

The fermentation medium consists of a solute and a solvent, wherein the solvent is water, and the concentration of the solute is as follows: 337.5g/L of food-grade glucose (one crystal water), 8.6g/L of yeast extract, 6.1g/L of corn steep liquor, 0.173g/L of magnesium sulfate (seven crystal water), 3.07g/L of diammonium hydrogen phosphate, VB10.0086 g/L, 0.013g/L of manganese sulfate (one crystal water), 0.002g/L of copper sulfate (anhydrous), 0.0173g/L of sodium glutamate and 800mg/L of Noralserin.

In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

Example 1

The technical route for achieving the purpose of the application is as follows:

(1) And searching the heat-resistant genes of Saccharomyces cerevisiae origin and thermophilic microorganism origin, which have gene sequences in the biological information database and are reported in the prior literature, so as to obtain a heat-resistant element library.

The sequenced Saccharomyces cerevisiae, thermophilic microorganisms and heat-resistant gene information thereof are excavated and sorted through NCBI, PDB and other databases, and genes with different functions and obvious effects in the prior literature report are combined as candidate elements to form a heat-resistant element library.

(2) Genes in the heat-resistant element library are classified according to sources and functions, and heat-resistant genes with different functions from different species are screened as candidate genes.

Classifying genes in the heat-resistant element library in the step (1) according to functions to obtain heat-resistant gene types, wherein the specific types of the heat-resistant genes are shown in Table 1:

TABLE 1 Heat resistance Gene information for different functions

(3) Performing PCR amplification on candidate genes derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) BY using a Saccharomyces cerevisiae BY4741 genome as a template; candidate genes derived from thermophilic bacteria (Thermusthermophilus) were synthesized codon optimized according to yarrowia lipolytica.

The candidate genes Yap1, hsp12, vma2, hul and Tsa1 derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) were amplified BY PCR using the genome of Saccharomyces cerevisiae BY4741 as a template, and the primers used were as follows:

amplifying the Yap1 gene fragment (the nucleotide sequence is shown as the 1 st to 1953 rd positions of the sequence 1 in the sequence table) by using a primer pair Yap1-F/Yap 1-R:

Yap1-F：5′-GACATATCTACAGCAATGAGTGTGTCTACCGCCAA-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB);

Yap1-R：5′-ACCGGCAACGTGGGGTTAGTTCATATGCTTATTCA-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB).

The Hsp12 gene fragment is amplified by a primer pair Hsp12-F/Hsp12-R (the nucleotide sequence is shown as the 1 st to 330 th positions of the sequence 2 in the sequence table):

Hsp12-F：5′-GACATATCTACAGCAATGTCTGACGCAGGTAGAAA-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB);

Hsp12-R：5′-ACCGGCAACGTGGGGTTACTTCTTGGTTGGGTCTT-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB).

Amplifying a Vma2 gene fragment (the nucleotide sequence is shown as 1 st to 1554 th positions of sequence 3 in a sequence table) by using a primer pair Vma2-F/Vma 2-R:

Vma2-F：5′-GACATATCTACAGCAATGGTTTTGTCTGATAAGGA-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB);

Vma2-R：5′-ACCGGCAACGTGGGGTTAGATTAGAGATTCTTCTT-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB).

Amplifying Hul gene fragment (nucleotide sequence is shown in 1 st to 2733 th positions of sequence 4 of a sequence table) by using a primer pair Hul5-F/Hul 5-R:

Hul5-F：5′-GACATATCTACAGCAATGTTAAACTTCACCGGTCA-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB);

Hul5-R：5′-ACCGGCAACGTGGGGTTATGATAAGTCAAACCTGG-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB).

Amplifying Tsa1 gene fragment (the nucleotide sequence is shown as the 1 st to 591 st positions of sequence 5 in a sequence table) by using a primer pair Tsa1-F/Tsa 1-R:

Tsa1-F：5′-GACATATCTACAGCAATGGTCGCTCAAGTTCAAAA-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB);

Tsa1-R：5′-ACCGGCAACGTGGGGTTATTTGTTGGCAGCTTCGA-3' (underlined nucleotides are homologous sequences that match perfectly with plasmid pTIB).

The candidate gene Groes of thermophilic bacteria (Thermusthermophilus) is delivered to a company to carry out codon optimization synthesis according to yarrowia lipolytica genome, so that Groes gene fragments are synthesized, and the nucleotide sequence of the Groes gene fragments is shown as the 1 st to 306 th positions of sequence 6 in a sequence table.

(4) Construction of the overexpression vector pTIB:

the commercial plasmid pUC57 is used as a template, and a primer17/primer18 is used for amplifying a prokaryotic replication initiation site and an ampicillin antibiotic gene expression cassette fragment, which is named ori-Amp:

Primer 17：ATCAATGGGCCTTGGTTTCCATAGGCTCCGCCCCC (underlined nucleotides are homologous sequences that match exactly to ChrE 1-DOWN)

Primer 18：CGCCCAAAATGCCAGCGCGGAACCCCTATTTGTTT (underlined nucleotides are homologous sequences which match perfectly with pXPR 2)

The promoter of gene XPR2 was amplified using primer1/primer2 using Yarrowialipolyticastrain W (CLIB 89) genome as template and designated pXPR2:

Primer 1：AATAGGGGTTCCGCGCTGGCATTTTGGGCGTTTTC (underlined nucleotides are homologous sequences that match perfectly with ori-Amp)

Primer 2：CAAAGTAGTACCCATTGTTGGATTGGAGGATTGGA (underlined nucleotides are homologous sequences that match exactly to Nat)

The amino acid sequence of the North-si-resistance gene (from Cloning vectorpNZ) was searched for at NCBI, and was synthesized by Jin Weizhi company after optimization according to the codon of yarrowia lipolytica, and the North-si-resistance gene was amplified using primer3/primer4 and designated as Nat:

Primer 3：TCCTCCAATCCAACAATGGGTACTACTTTGGATGA (underlined nucleotides are homologous sequences which match perfectly with pXPR 2)

Primer 4：GATTCCGAACAGAAGTCATGGACATGGCATAGACA (underlined nucleotides are homologous sequences which match perfectly with Tlip 2)

ERY01 genome is used as a template, and a primer5/primer6 is used for amplifying a terminator of gene lip2, which is named Tlip2: primer 5:ATGCCATGTCCATGACTTCTGTTCGGAATCAACCT (underlined nucleotides are homologous sequences that match exactly to Nat)

Primer 6：TCCATTATCTACGAACAGATGCATTCTTGGGCGGT (underlined nucleotides are homologous sequences which match exactly to CEN 1)

The eukaryotic replication initiation site was amplified using the Yarrowia lipolytica strain W (CLIB 89) genome as template, using primer7/primer8, designated CEN1:

Primer 7：CCAAGAATGCATCTGTTCGTAGATAATGGAATACA (underlined nucleotides are homologous sequences which match perfectly with Tlip 2)

Primer 8：TTCGGGGTCTGCCAGCATCAAATTTAGGGATGCCA (underlined nucleotides are homologous sequences that match exactly with ChrE 1-UP)

The ERY01 genome is used as a template, and a primer9/primer10 is used for amplifying an upstream homology arm 500bp sequence fragment of a gene insertion site ChrE1, which is named ChrE1-UP:

Primer 9：TCCCTAAATTTGATGCTGGCAGACCCCGAAACCTA (underlined nucleotides are homologous sequences which match exactly to CEN 1)

Primer 10：GGCGCCAAACTCCTTACAACAGCCAGTCCTCCACG (underlined nucleotides are homologous sequences that match exactly to pExp 1)

The promoter pExp1 fragment was amplified using the Yarrowia lipolytica strain W (CLIB 89) genome as template and primer11/primer12, designated pExp1:

Primer 11：AGGACTGGCTGTTGTAAGGAGTTTGGCGCCCGTTT (underlined nucleotides are homologous sequences that match exactly with ChrE 1-UP)

Primer 12：ACCGGCAACGTGGGGGCGATCGCTGCTGTAGATATGTCTTGTG (underlined nucleotides are homologous sequences that match exactly to TTef)

The terminator TTef fragment was amplified using the Yarrowia lipolytica strain W (CLIB 89) genome as template, primer13/primer14, named TTef:

Primer 13：TACAGCAGCGATCGCCCCCACGTTGCCGGTCTTGC (underlined nucleotides are homologous sequences that match exactly to pExp 1)

Primer 14：GGTGTCCGAGCGTCGGAATTCGGACACGGGCATCT (underlined nucleotides are homologous sequences that match exactly to ChrE 1-DOWN)

The ERY01 genome is used as a template, and a primer15/primer16 is used for amplifying a 500bp sequence fragment of a downstream homology arm of a gene insertion site ChrE1, which is named ChrE1-DOWN:

Primer 15：CCCGTGTCCGAATTCCGACGCTCGGACACCTCTGG (underlined nucleotides are homologous sequences that match exactly to TTef)

Primer 16：CGGAGCCTATGGAAACCAAGGCCCATTGATTGAGA (underlined nucleotides are homologous sequences that match perfectly with ori-Amp)

Fusing the amplified ori-Amp and pXPR2 through fusion PCR to obtain fragment ori-Amp-pXPR2; the Tlip2 and CEN1 are fused by fusion PCR to obtain a fragment Tlip2-CEN1; fusing the Nat and the Tlip2-CEN1 by fusion PCR to obtain a fragment Nat-Tlip2-CEN1; fusing ori-Amp-pXPR2 and Nat-Tlip2-CEN1 through fusion PCR to obtain fragment ori-Amp-pXPR2-Nat-Tlip2-CEN1; fusion of the Chu E1-UP and the pExp1 is carried out through fusion PCR, so as to obtain a fragment Chu E1-UP-pExp1; fusion of TTef and ChrE1-DOWN is carried out through fusion PCR, so that fragments TTef-ChrE1-DOWN are obtained; the fragments ori-Amp-pXPR2-Nat-Tlip2-CEN1, chrE1-UP-pExp1 and TTef-ChrE1-DOWN were assembled using a Trelief SoSoo Cloning Kit Ver.2 kit, and sequenced to obtain the correct overexpressing vector pTIB (nucleotide sequence is shown as sequence 13 in the sequence Listing, wherein positions 1-1752 are pXPR2 promoter sequence, positions 1753-2325 are Nat sequence, positions 2326-3262 are Tlip2 sequence, positions 3263-3481 are CEN1 sequence, positions 3482-3966 are ChrE1-UP sequence, positions 3967-4967 are pExp1 sequence, positions 4968-4975 are AsiSI enzyme recognition site, positions 4976-5385 are TTef sequence, positions 5386-5885 are ChrE1-DOWN sequence, and positions 5886-7610 are ori-Amp sequence).

(5) And (3) connecting the heat-resistant gene fragment with an over-expression vector pTIB to obtain a recombinant expression vector.

The heat-resistant gene fragments obtained by PCR amplification in the step (3) are connected to a vector pTIB cut by restriction enzyme AsiSI, and the correct recombinant vector is obtained by sequencing, specifically as follows:

the Yap1 gene fragment (the nucleotide sequence is shown as the 1 st to 1953 rd positions of the sequence 1 in the sequence table) is connected to a body pTIB which is cut by restriction enzyme AsiSI to obtain a recombinant expression vector of Yap1 protein, which is named pTIB-Yap1.pTIB-Yap1 contains a Yap1 gene whose coding sequence (CDS) is shown in the 1 st to 1953 rd positions of sequence 1 in the sequence table, and transcription of the Yap1 gene is initiated by the promoter pExp 1.

The Hsp12 gene fragment (the nucleotide sequence is shown as the 1 st to 330 th positions of the sequence 2 in the sequence table) is connected to the body pTIB which is cut by restriction enzyme AsiSI to obtain a recombinant expression vector of the Hsp12 protein, which is named pTIB-Hsp12.pTIB-Hsp12 contains Hsp12 genes whose coding sequences (CDS) are shown in the 1 st to 330 th positions of sequence 2 in a sequence table, and the transcription of the Hsp12 genes is started by a promoter pExp 1.

The Vma2 gene fragment (the nucleotide sequence is shown as the 1 st to 1554 th positions of the sequence 3 in the sequence table) is connected to the body pTIB which is cut by restriction enzyme AsiSI to obtain a recombinant expression vector of the Vma2 protein, which is named pTIB-Vma2.pTIB-Vma2 contains a coding sequence (CDS) which is the Vma2 gene shown in the 1 st to 1554 th positions of the sequence 3 in the sequence table, and the transcription of the Vma2 gene is started by the promoter pExp 1.

The Hul gene fragment (the nucleotide sequence is shown as the 1 st to 2733 th positions of the sequence 4 in the sequence table) is connected to a body pTIB which is cut by restriction enzyme AsiSI to obtain a recombinant expression vector of Hul protein, which is named pTIB-Hul5.pTIB-Hul contains Hul gene whose coding sequence (CDS) is shown in sequence 4 of the sequence table at positions 1-2733, and transcription of Hul gene is initiated by promoter pExp 1.

The Tsa1 gene fragment (the nucleotide sequence is shown as the 1 st to 591 st positions of the sequence 5 in the sequence table) is connected to a body pTIB which is cut by restriction enzyme AsiSI to obtain a recombinant expression vector of Tsa1 protein, which is named pTIB-Tsa1.pTIB-Tsa1 contains a coding sequence (CDS) which is a Tsa1 gene shown in the 1 st to 591 st positions of a sequence 5 in a sequence table, and transcription of the Tsa1 gene is started by a promoter pExp 1.

And (3) directly connecting the Groes gene fragment synthesized in the step (3) to an AsiSI enzyme cutting site of pTIB, keeping other sequences of the pTIB vector unchanged, and obtaining a recombinant expression vector of Groes protein, which is named pTIB-Groes. pTIB-Groes contains the Groes gene whose coding sequence (CDS) is shown in positions 1 to 306 of sequence 6 in the sequence listing, and transcription of the Groes gene is initiated by the promoter pExp 1.

(5) The recombinant vector is transformed into yarrowia lipolytica industrial strain ERY01 with high erythritol yield to obtain recombinant strain.

The recombinant vectors (pTIB-Yap 1, pTIB-Hsp12, pTIB-Vma2, pTIB-Hul, pTIB-Tsa1 and pTIB-Groes, with empty plasmid pTIB as a control) obtained in the step (4) are respectively transformed into a yarrowia lipolytica industrial strain ERY01 with high erythritol yield, and the correctly transformed recombinant strains are obtained by sequencing, wherein the following specific operation steps are performed:

preparation of competent cells:

the original strain ERY01 is placed in a 30 ℃ incubator for culturing 24 hours after being streaked on a YPD flat plate; the cultured strain is streaked on YPD plates again and then is placed in a 30 ℃ incubator for culturing for 24 hours; scraping off the cultured cells, re-suspending the cells in 1mL of sterile water, centrifuging for 5min at 3000g, and removing the supernatant, wherein the steps are repeated twice; cells were resuspended with 1mL of sterile water and OD was determined ₆₀₀ The method comprises the steps of carrying out a first treatment on the surface of the The bacteria with OD value of 9.2 are taken out and placed in a new sterile centrifuge tube, and the supernatant is removed by centrifugation at 3000g for 5min, so as to obtain ERY01 competent cells for one-time transformation.

The transformation process comprises the following steps:

1) 500ng of plasmids (pTIB-Yap 1, pTIB-Hsp12, pTIB-Vma2, pTIB-Hul5, pTIB-Tsa1, pTIB-Groes and empty plasmid pTIB, respectively) were added to ERY01 competent cells;

2) Resuspension of cells with the transformation mixture:

TABLE 2

Composition of the components	Content of
		PEG(Stock50％；sterile-filtrated；end43.8％)	87.5μl
LiAc(Stock2M；sterile-filtrated；end0.1M)	5.0μl
		ssDNA(Stock10mg/ml；end0.25g/l)	2.5μl
DTT(stock2M；sterile-filtrated；end100mM)	5.0μl

3) Incubating at 39 ℃ for 1h;

4) Centrifuging 3000g for 5min, removing supernatant, adding 500 μl of YPD medium, suspending, and shake culturing at 30deg.C for 2 hr;

5) After centrifugation at 3000g for 5min, the supernatant was removed, resuspended in 100. Mu.l of sterile water and plated onto YPD plates containing Noralserin (800 mg/L) and incubated at 30 ℃.

According to the above operation steps, the recombinant vector pTIB-Yap1 is transformed into a yarrowia lipolytica industrial strain ERY01 with high erythritol yield, and the recombinant yarrowia lipolytica strain containing pTIB-Yap1 is obtained by sequencing and named ERY01pTIB-Yap1.

According to the above operation steps, the recombinant vector pTIB-Hsp12 is transformed into a yarrowia lipolytica industrial strain ERY01 with high erythritol yield, and the recombinant yarrowia lipolytica strain containing pTIB-Hsp12 is obtained through sequencing and named ERY01pTIB-Hsp12.

According to the above operation steps, the recombinant vector pTIB-Vma2 is transformed into a yarrowia lipolytica industrial strain ERY01 with high erythritol yield, and the recombinant yarrowia lipolytica strain containing pTIB-Vma2 is obtained through sequencing and named ERY01pTIB-Vma2.

According to the above procedure, the recombinant vector pTIB-Hul5 was transformed into the yarrowia lipolytica industrial strain ERY01 with high erythritol yield, and the recombinant yarrowia lipolytica strain containing pTIB-Hul5 was obtained by sequencing and named ERY01 pTIB-Hul.

According to the above operation steps, the recombinant vector pTIB-Tsa1 is transformed into a yarrowia lipolytica industrial strain ERY01 with high erythritol yield, and the recombinant yarrowia lipolytica strain containing pTIB-Tsa1 is obtained through sequencing and named ERY01pTIB-Tsa1.

According to the above procedure, the recombinant vector pTIB-Groes was transformed into the industrial strain ERY01 of yarrowia lipolytica producing erythritol at high yield, and the recombinant strain of yarrowia lipolytica containing pTIB-Groes was obtained by sequencing and named ERY01pTIB-Groes.

According to the above procedure, the empty plasmid pTIB was transformed into the industrial strain ERY01 of yarrowia lipolytica which was highly erythritol-producing, and the recombinant yarrowia lipolytica strain containing pTIB was obtained by sequencing and designated ERY01pTIB.

(6) Fermenting and culturing each recombinant strain at 35 ℃, and measuring the growth condition of cells by a spectrophotometer; the yield of erythritol was determined by HPLC.

YPD plates containing Norrissin were streaked on the above recombinant yarrowia lipolytica strains (ERY 01pTIB-Yap1, ERY01pTIB-Hsp12, ERY01pTIB-Vma2, ERY01pTIB-Hul5, ERY01pTIB-Tsa1, ERY01pTIB-Groes, ERY01 pTIB) respectively, and after growing, the single clone was selected to a seed liquid medium for cultivation. The culture temperature is 30 ℃, and the seed liquid is obtained after the culture for 36 hours.

Transferring the seed liquid to the fermentation medium to an initial OD ₆₀₀ The culture was carried out at 35℃for 72 hours at 0.1, and the fermentation broth was collected. 3 replicates were run for each strain.

Diluting the fermentation broth, and performing OD ₆₀₀ Determination of erythritol content was performed simultaneously by HPLC. In HPLC, erythritol (product CAS number 149-32-6, beijing Soy Co., ltd.) was used as a standard substance and quantitative analysis of erythritol was performed by a standard curve method (external standard method) based on the retention time of the standard substance. HPLC detection conditions: HPLC (HPX-87H chromatography column, 300 mm. Times.7.8 mm, bio-Rad, hercules, calif., USA) at 55℃with a mobile phase of 0.008M sulfuric acid solution, flow rate of 0.6M L/min and sample loading of 5. Mu.L.

Data were processed using Excel software and experimental results were expressed as mean ± standard deviation.

The measurement results are shown in fig. 1 and 2. Compared with the control strain ERY01pTIB transferred into empty plasmid pTIB, the growth of all recombinant plasmid-type strains (ERY 01pTIB-Yap1, ERY01pTIB-Hsp12, ERY01pTIB-Vma2, ERY01pTIB-Hul5, ERY01pTIB-Tsa1 and ERY01 pTIB-Groes) expressing heat-resistant genes under the condition of 35 ℃ is improved, and the erythritol yield is also obviously increased. Wherein, the yield of erythritol of ERY01pTIB-Groes is highest and is 31.6+/-0.6 g erythritol/L fermentation liquor; the erythritol yield of ERY01pTIB-Yap1 is 14.2+ -0.3 g erythritol/L fermentation broth; the erythritol yield of ERY01pTIB-Hsp12 is 22+ -1.4 g erythritol/L fermentation broth; the erythritol yield of ERY01pTIB-Vma2 is 19.8+ -0.7 g erythritol/L fermentation broth; the erythritol yield of ERY01pTIB-Hul5 is 20.3+ -1.5 g erythritol/L broth; the erythritol yield of ERY01pTIB-Tsa1 is 21.3+ -1.1 g erythritol/L fermentation broth; the erythritol yield of ERY01pTIB was 11.+ -. 0.9g erythritol/L broth.

(7) Screening to obtain heat-resistant genes with different functions, which can enable industrial strains of yarrowia lipolytica to grow well under the condition of 35 ℃ and produce erythritol in high yield.

According to the result of the step (6), different heat-resistant genes Yap1, hsp12, vma2, hul5, tsa1 and Groes which can enable the yarrowia lipolytica industrial strain to grow well under the condition of 35 ℃ and produce erythritol with high yield are obtained through screening.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> institute of Tianjin Industrial biotechnology, national academy of sciences

<120> a method for constructing recombinant yarrowia lipolytica and use thereof

<130> GNCSY212191

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1953

<212> DNA

<213> Saccharomyces cerevisiae (Saccharomyces cerevisiae)

<400> 1

atgagtgtgt ctaccgccaa gaggtcgctg gatgtcgttt ctccgggttc attagcggag 60

tttgagggtt caaaatctcg tcacgatgaa atagaaaatg aacatagacg tactggtaca 120

cgtgatggcg aggatagcga gcaaccgaag aagaagggta gcaaaactag caaaaagcaa 180

gatttggatc ctgaaactaa gcagaagagg actgcccaaa atcgggccgc tcaaagagct 240

tttagggaac gtaaggagag gaagatgaag gaattggaga agaaggtaca aagtttagag 300

agtattcagc agcaaaatga agtggaagct acttttttga gggaccagtt aatcactctg 360

gtgaatgagt taaaaaaata tagaccagag acaagaaatg actcaaaagt gctggaatat 420

ttagcaaggc gagatcctaa tttgcatttt tcaaaaaata acgttaacca cagcaatagc 480

gagccaattg acacacccaa tgatgacata caagaaaatg ttaaacaaaa gatgaatttc 540

acgtttcaat atccgcttga taacgacaac gacaacgaca acagtaaaaa tgtggggaaa 600

caattacctt caccaaatga tccaagtcat tcggctccta tgcctataaa tcagacacaa 660

aagaaattaa gtgacgctac agattcctcc agcgctactt tggattccct ttcaaatagt 720

aacgatgttc ttaataacac accaaactcc tccacttcga tggattggtt agataatgta 780

atatatacta acaggtttgt gtcaggtgat gatggcagca atagtaaaac taagaattta 840

gacagtaata tgttttctaa tgactttaat tttgaaaacc aatttgatga acaagtttcg 900

gagttttgtt cgaaaatgaa ccaggtatgt ggaacaaggc aatgtcccat tcccaagaaa 960

cccatctcgg ctcttgataa agaagttttc gcgtcatctt ctatactaag ttcaaattct 1020

cctgctttaa caaatacttg ggaatcacat tctaatatta cagataatac tcctgctaat 1080

gtcattgcta ctgatgctac taaatatgaa aattccttct ccggttttgg ccgacttggt 1140

ttcgatatga gtgccaatca ttacgtcgtg aatgataata gcactggtag cactgatagc 1200

actggtagca ctggcaataa gaacaaaaag aacaataata atagcgatga tgtactccca 1260

ttcatatccg agtcaccgtt tgatatgaac caagttacta atttttttag tccgggatct 1320

accggcatcg gcaataatgc tgcctctaac accaatccca gcctactgca aagcagcaaa 1380

gaggatatac cttttatcaa cgcaaatctg gctttcccag acgacaattc aactaatatt 1440

caattacaac ctttctctga atctcaatct caaaataagt ttgactacga catgtttttt 1500

agagattcat cgaaggaagg taacaattta tttggagagt ttttagagga tgacgatgat 1560

gacaaaaaag ccgctaatat gtcagacgat gagtcaagtt taatcaagaa ccagttaatt 1620

aacgaagaac cagagcttcc gaaacaatat ctacaatcgg taccaggaaa tgaaagcgaa 1680

atctcacaaa aaaatggcag tagtttacag aatgctgaca aaatcaataa tggcaatgat 1740

aacgataatg ataatgatgt cgttccatct aaggaaggct ctttactaag gtgttcggaa 1800

atttgggata gaataacaac acatccgaaa tactcagata ttgatgtcga tggtttatgt 1860

tccgagctaa tggcaaaggc aaaatgttca gaaagagggg ttgtcatcaa tgcagaagac 1920

gttcaattag ctttgaataa gcatatgaac taa 1953

<210> 2

<211> 330

<212> DNA

<213> Saccharomyces cerevisiae (Saccharomyces cerevisiae)

<400> 2

atgtctgacg caggtagaaa aggattcggt gaaaaagctt ctgaagcttt gaagccagac 60

tctcaaaagt catacgctga acaaggtaag gaatacatca ctgacaaggc cgacaaggtc 120

gctggtaagg ttcaaccaga agacaacaag ggtgtcttcc aaggtgtcca cgactctgcc 180

gaaaaaggca aggataacgc tgaaggtcaa ggtgaatctt tggcagacca agctagagat 240

tacatgggag ccgccaagtc caagttgaac gatgccgtcg aatatgtttc cggtcgtgtc 300

cacggtgaag aagacccaac caagaagtaa 330

<210> 3

<211> 1554

<212> DNA

<213> Saccharomyces cerevisiae (Saccharomyces cerevisiae)

<400> 3

atggttttgt ctgataagga gttgtttgcc ataaataaga aagccgtcga acaaggtttc 60

aatgtgaagc ctagattgaa ctataatacg gtcagtggtg tgaacggtcc attagtcatt 120

ttggaaaagg tcaagttccc acgttacaac gaaattgtta atttgacatt gccagatgga 180

accgtgagac aaggtcaagt tttggaaatt agaggagata gagccattgt gcaagtgttt 240

gaaggtacat ctggtattga tgtcaagaag actaccgtgg aattcactgg tgagagtttg 300

agaattcctg tgtctgaaga catgttgggt agaatttttg acggttctgg tagacccatt 360

gacaacggtc ctaaagtttt cgcagaggat tacttggaca ttaacggttc tcctatcaac 420

ccatatgctc gtatttatcc agaagaaatg atttctactg gtgtttctgc tattgacaca 480

atgaactcca ttgccagagg tcaaaagatc ccaattttct ccgcatcagg tttaccacac 540

aacgaaattg cagcacaaat ttgtagacag gctggtttgg tgagacctac caaggatgtt 600

catgatggtc atgaagaaaa tttctccatc gtttttgctg ccatgggtgt caacttggaa 660

accgctagat ttttcaaaca ggatttcgaa gaaaatgggt ctttggaaag aacttcatta 720

tttttgaact tggctaatga ccctaccatt gaaagaatta tcactccaag attggccttg 780

accaccgctg aataccttgc ttaccaaacg gaacgtcatg tgttgaccat cttgaccgat 840

atgtcatcgt atgctgatgc tcttagagaa gtttccgctg ctagagaaga agttccaggt 900

agaagaggtt atcctggtta catgtataca gatttgtcca caatttatga aagagcaggt 960

agagtagagg gtcgtaacgg gtccatcact caaataccta tcttgacaat gcctaacgat 1020

gatattacgc atccaattcc ggatttgacc ggttatatta ccgagggtca aatcttcgtt 1080

gaccgtcaat tacataacaa gggtatctac ccaccaatca acgtcttgcc ttcgttgagt 1140

agattgatga aatctgccat cggtgaaggt atgaccagaa aggaccacgg tgacgtttct 1200

aaccaattgt atgccaagta cgccatcggt aaggacgctg ctgctatgaa ggccgttgtc 1260

ggtgaagagg cgttatccat cgaagataag ttatctttgg aatttttgga aaaattcgaa 1320

aagaccttta tcacacaagg cgcctacgag gacagaaccg ttttcgaaag tttggaccag 1380

gcatggagtt tgctaagaat ctaccctaag gagatgttga atagaatctc cccaaagatt 1440

cttgatgaat tttacgatag agccagagac gatgccgacg aagatgaaga agatcccgac 1500

acaagaagct ccggtaagaa gaaggacgcc agccaagaag aatctctaat ctaa 1554

<210> 4

<211> 2733

<212> DNA

<213> Saccharomyces cerevisiae (Saccharomyces cerevisiae)

<400> 4

atgttaaact tcaccggtca aacaaggaga agaaatgtca atttagggaa taggactcga 60

aattcaaaga aggatttact ggaaaaggcc aaaagggaac gtgaaaggag agcacaagat 120

aagctcaaag aagacgccag taaaaccatt caaaaaagca tcagaagaca tttttcaaat 180

gtgagactct tcaaaaacac atttactagt tcgcaacttg ttcatatgat accagcttac 240

gggggcaaat taatctatta catttctcaa tatgatctgc agcaactgct aaaattatct 300

cataattttt tgagttctta tcctaattct ttaggcaaca gacagctatt gagcttgttg 360

aagctatatc aagatgatgc actggtggct gaaactctaa gcgatcttaa catggactgc 420

cctacagttg acgaattttt agatagtcta tccgtttatc tctgtcgggc ttcctccttg 480

agttattcct cagcttctaa gctagctgat gtcatagaag catgggaagt aatgcatagc 540

agtgcctcca ttagtatttt ttcgatatcg ataggatctt acgaaaaacg gccatttgca 600

ctacagtttt attgcatact tgccgaaaga aaccttttgc cccaacttat caacacaaat 660

ccgatattat gggataacat ggcaaagaca tattcacact gtagtaaagg tggccaaaaa 720

aatatcgcca agctactcat accaaacttc aacaatcata ttgctccatc agtcttgcgt 780

agtgataacg actatgtctt gaaattttat gaaaaggcat ttatagacga agttattgct 840

actactgcaa attacgtttc tgatgaagat cacgtgaaga atttgatgtg ctacattgca 900

agctctccca atcaaagctg taagaattct gtccttatta ccttactgtc taacaaagac 960

ttcgtgagaa ggctctcatg ggaattcttt cacactaaat tcaacgccag caagactgag 1020

gctcaccccc tgttttcagt tttggcacag cttatcgaca tgcacctttt aatatcgaca 1080

gatcgggagt tattagacta caactctgtg atacctatcg aagaactaaa gaaatttaca 1140

tccacgttaa aagattttac tttccgacaa tattgggaac tacctaaaag tgaaaggaac 1200

cctatgttaa aggaagcagt accacttttg agcaaagtct acgaaaggga ctcaagattg 1260

cactttctat ccacggagaa taatccaacc tattgggaaa actctgaaaa gcaattttta 1320

aatttgagat tttacgaaga attacaggag tacgaagatc tgtatagaga acacttagaa 1380

gaggaaagtg atgaggatat ggaaaaggaa atagatcttg ataaagaaag gcctcctttg 1440

aagtctttat tattgaacaa aatgaaaaag agattaaagt catcattacg tttccgaaag 1500

ttggaaatac ttttggaatt accatttttt attccttttg aagaaagggt ggacttattt 1560

tatatgttca tcgcactgga caagaagcga ttatctttag atgacgatca caacttgatc 1620

aatatgttta ccccctgggc ctccaccggt atgaggaagc aatccgctat catctctagg 1680

gataatgtct tagaagatgc tttcaacgca tttaactcta taggagaaag gttcaaagct 1740

tcattagatg ttacttttat taatgaattt ggtgaagaag ctggtattga tgggggcggc 1800

attaccaagg aatttttaac tactgtgtct gatgaaggat ttaaagatcc aaagcacgag 1860

ttatttcgga cgaatgatcg ctacgaatta tatccttctg ttgtttatga cgctacgaaa 1920

cttaagtata tatggtttct gggaaaggtt gtaggcaaat gtctatatga gcatgttttg 1980

atagatgtat cttttgctga tttctttttg aaaaaattat tgaattactc gaacgggttt 2040

ttatcttctt tttctgatct gggaagctat gattcggtgt tgtataataa tttgatcaaa 2100

ttattgaaca tgaccactga cgagatcaag tctttagatt taacctttga aatagatgag 2160

cctgaaagtt ccgcaaaagt tgttgactta attccgaatg gttcaaaaac gtacgtgacg 2220

aaggataatg tgttgctcta cgttactaaa gtaacggatt acaaattaaa caaaagatgc 2280

ttcaaaccag tttcggcata ccatggaggg ctcagtgtta tcattgcccc acattggatg 2340

gagatgttta actctataga actacaaatg ttaatatcag gtgagagaga taatatcgat 2400

ttagacgatc tgaaatctaa cacagaatac gggggttata aagaagaaga tcagacaatt 2460

gttgattttt gggaggtttt gaatgagttt aagtttgaag agaaattgaa ttttttgaaa 2520

tttgtcacgt ccgttccgca agctcctctg caaggcttca aggcattaga tccaaaattt 2580

ggtatcagaa atgcagggac agagaaatac aggctgccta cggcatctac ctgtgttaat 2640

ttattaaaat tgccagatta tagaaacaaa acaattttga gagagaaatt attatatgca 2700

ataaactcag gcgccaggtt tgacttatca taa 2733

<210> 5

<211> 591

<212> DNA

<213> Saccharomyces cerevisiae (Saccharomyces cerevisiae)

<400> 5

atggtcgctc aagttcaaaa gcaagctcca acttttaaga aaactgccgt cgtcgacggt 60

gtctttgacg aagtctcctt ggacaaatac aagggtaagt acgttgtcct agcctttatt 120

ccattggcct tcactttcgt ctgtccaacc gaaatcattg ctttctcaga agctgctaag 180

aaattcgaag aacaaggcgc tcaagttctt ttcgcctcca ctgactccga atactccctt 240

ttggcatgga ccaatatccc aagaaaggaa ggtggtttgg gcccaatcaa cattccattg 300

ttggctgaca ccaaccactc tttgtccaga gactatggtg tcttgatcga agaagaaggt 360

gtcgccttga gaggtttgtt catcatcgac ccaaagggtg tcattagaca catcaccatt 420

aacgatttgc cagtcggtag aaacgttgac gaagccttga gattggttga agccttccaa 480

tggaccgaca agaacggtac tgtcttgcca tgtaactgga ctccaggtgc tgctaccatc 540

aagccaaccg ttgaagactc caaggaatac ttcgaagctg ccaacaaata a 591

<210> 6

<211> 306

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atggccgccg aggtgaagac cgtgatcaag cccctgggcg accgagtggt cgtgaagcga 60

atcgaggaag agcccaagac caagggcggc atcgtgctgc ccgacaccgc caaggagaag 120

cctcagaagg gcaaggtgat cgccgtgggc accggccgag tgctggagaa cggacagcga 180

gtgcccctgg aggtgaagga gggcgacatc gtggtgttcg ccaagtacgg cggcaccgag 240

atcgagatcg acggcgagga gtacgtgatc ctgtctgagc gagacctgct ggccgtgctg 300

cagtaa 306

<210> 7

<211> 650

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 7

Met Ser Val Ser Thr Ala Lys Arg Ser Leu Asp Val Val Ser Pro Gly

1 5 10 15

Ser Leu Ala Glu Phe Glu Gly Ser Lys Ser Arg His Asp Glu Ile Glu

20 25 30

Asn Glu His Arg Arg Thr Gly Thr Arg Asp Gly Glu Asp Ser Glu Gln

35 40 45

Pro Lys Lys Lys Gly Ser Lys Thr Ser Lys Lys Gln Asp Leu Asp Pro

50 55 60

Glu Thr Lys Gln Lys Arg Thr Ala Gln Asn Arg Ala Ala Gln Arg Ala

65 70 75 80

Phe Arg Glu Arg Lys Glu Arg Lys Met Lys Glu Leu Glu Lys Lys Val

85 90 95

Gln Ser Leu Glu Ser Ile Gln Gln Gln Asn Glu Val Glu Ala Thr Phe

100 105 110

Leu Arg Asp Gln Leu Ile Thr Leu Val Asn Glu Leu Lys Lys Tyr Arg

115 120 125

Pro Glu Thr Arg Asn Asp Ser Lys Val Leu Glu Tyr Leu Ala Arg Arg

130 135 140

Asp Pro Asn Leu His Phe Ser Lys Asn Asn Val Asn His Ser Asn Ser

145 150 155 160

Glu Pro Ile Asp Thr Pro Asn Asp Asp Ile Gln Glu Asn Val Lys Gln

165 170 175

Lys Met Asn Phe Thr Phe Gln Tyr Pro Leu Asp Asn Asp Asn Asp Asn

180 185 190

Asp Asn Ser Lys Asn Val Gly Lys Gln Leu Pro Ser Pro Asn Asp Pro

195 200 205

Ser His Ser Ala Pro Met Pro Ile Asn Gln Thr Gln Lys Lys Leu Ser

210 215 220

Asp Ala Thr Asp Ser Ser Ser Ala Thr Leu Asp Ser Leu Ser Asn Ser

225 230 235 240

Asn Asp Val Leu Asn Asn Thr Pro Asn Ser Ser Thr Ser Met Asp Trp

245 250 255

Leu Asp Asn Val Ile Tyr Thr Asn Arg Phe Val Ser Gly Asp Asp Gly

260 265 270

Ser Asn Ser Lys Thr Lys Asn Leu Asp Ser Asn Met Phe Ser Asn Asp

275 280 285

Phe Asn Phe Glu Asn Gln Phe Asp Glu Gln Val Ser Glu Phe Cys Ser

290 295 300

Lys Met Asn Gln Val Cys Gly Thr Arg Gln Cys Pro Ile Pro Lys Lys

305 310 315 320

Pro Ile Ser Ala Leu Asp Lys Glu Val Phe Ala Ser Ser Ser Ile Leu

325 330 335

Ser Ser Asn Ser Pro Ala Leu Thr Asn Thr Trp Glu Ser His Ser Asn

340 345 350

Ile Thr Asp Asn Thr Pro Ala Asn Val Ile Ala Thr Asp Ala Thr Lys

355 360 365

Tyr Glu Asn Ser Phe Ser Gly Phe Gly Arg Leu Gly Phe Asp Met Ser

370 375 380

Ala Asn His Tyr Val Val Asn Asp Asn Ser Thr Gly Ser Thr Asp Ser

385 390 395 400

Thr Gly Ser Thr Gly Asn Lys Asn Lys Lys Asn Asn Asn Asn Ser Asp

405 410 415

Asp Val Leu Pro Phe Ile Ser Glu Ser Pro Phe Asp Met Asn Gln Val

420 425 430

Thr Asn Phe Phe Ser Pro Gly Ser Thr Gly Ile Gly Asn Asn Ala Ala

435 440 445

Ser Asn Thr Asn Pro Ser Leu Leu Gln Ser Ser Lys Glu Asp Ile Pro

450 455 460

Phe Ile Asn Ala Asn Leu Ala Phe Pro Asp Asp Asn Ser Thr Asn Ile

465 470 475 480

Gln Leu Gln Pro Phe Ser Glu Ser Gln Ser Gln Asn Lys Phe Asp Tyr

485 490 495

Asp Met Phe Phe Arg Asp Ser Ser Lys Glu Gly Asn Asn Leu Phe Gly

500 505 510

Glu Phe Leu Glu Asp Asp Asp Asp Asp Lys Lys Ala Ala Asn Met Ser

515 520 525

Asp Asp Glu Ser Ser Leu Ile Lys Asn Gln Leu Ile Asn Glu Glu Pro

530 535 540

Glu Leu Pro Lys Gln Tyr Leu Gln Ser Val Pro Gly Asn Glu Ser Glu

545 550 555 560

Ile Ser Gln Lys Asn Gly Ser Ser Leu Gln Asn Ala Asp Lys Ile Asn

565 570 575

Asn Gly Asn Asp Asn Asp Asn Asp Asn Asp Val Val Pro Ser Lys Glu

580 585 590

Gly Ser Leu Leu Arg Cys Ser Glu Ile Trp Asp Arg Ile Thr Thr His

595 600 605

Pro Lys Tyr Ser Asp Ile Asp Val Asp Gly Leu Cys Ser Glu Leu Met

610 615 620

Ala Lys Ala Lys Cys Ser Glu Arg Gly Val Val Ile Asn Ala Glu Asp

625 630 635 640

Val Gln Leu Ala Leu Asn Lys His Met Asn

645 650

<210> 8

<211> 109

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 8

Met Ser Asp Ala Gly Arg Lys Gly Phe Gly Glu Lys Ala Ser Glu Ala

1 5 10 15

Leu Lys Pro Asp Ser Gln Lys Ser Tyr Ala Glu Gln Gly Lys Glu Tyr

20 25 30

Ile Thr Asp Lys Ala Asp Lys Val Ala Gly Lys Val Gln Pro Glu Asp

35 40 45

Asn Lys Gly Val Phe Gln Gly Val His Asp Ser Ala Glu Lys Gly Lys

50 55 60

Asp Asn Ala Glu Gly Gln Gly Glu Ser Leu Ala Asp Gln Ala Arg Asp

65 70 75 80

Tyr Met Gly Ala Ala Lys Ser Lys Leu Asn Asp Ala Val Glu Tyr Val

85 90 95

Ser Gly Arg Val His Gly Glu Glu Asp Pro Thr Lys Lys

100 105

<210> 9

<211> 517

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 9

Met Val Leu Ser Asp Lys Glu Leu Phe Ala Ile Asn Lys Lys Ala Val

1 5 10 15

Glu Gln Gly Phe Asn Val Lys Pro Arg Leu Asn Tyr Asn Thr Val Ser

20 25 30

Gly Val Asn Gly Pro Leu Val Ile Leu Glu Lys Val Lys Phe Pro Arg

35 40 45

Tyr Asn Glu Ile Val Asn Leu Thr Leu Pro Asp Gly Thr Val Arg Gln

50 55 60

Gly Gln Val Leu Glu Ile Arg Gly Asp Arg Ala Ile Val Gln Val Phe

65 70 75 80

Glu Gly Thr Ser Gly Ile Asp Val Lys Lys Thr Thr Val Glu Phe Thr

85 90 95

Gly Glu Ser Leu Arg Ile Pro Val Ser Glu Asp Met Leu Gly Arg Ile

100 105 110

Phe Asp Gly Ser Gly Arg Pro Ile Asp Asn Gly Pro Lys Val Phe Ala

115 120 125

Glu Asp Tyr Leu Asp Ile Asn Gly Ser Pro Ile Asn Pro Tyr Ala Arg

130 135 140

Ile Tyr Pro Glu Glu Met Ile Ser Thr Gly Val Ser Ala Ile Asp Thr

145 150 155 160

Met Asn Ser Ile Ala Arg Gly Gln Lys Ile Pro Ile Phe Ser Ala Ser

165 170 175

Gly Leu Pro His Asn Glu Ile Ala Ala Gln Ile Cys Arg Gln Ala Gly

180 185 190

Leu Val Arg Pro Thr Lys Asp Val His Asp Gly His Glu Glu Asn Phe

195 200 205

Ser Ile Val Phe Ala Ala Met Gly Val Asn Leu Glu Thr Ala Arg Phe

210 215 220

Phe Lys Gln Asp Phe Glu Glu Asn Gly Ser Leu Glu Arg Thr Ser Leu

225 230 235 240

Phe Leu Asn Leu Ala Asn Asp Pro Thr Ile Glu Arg Ile Ile Thr Pro

245 250 255

Arg Leu Ala Leu Thr Thr Ala Glu Tyr Leu Ala Tyr Gln Thr Glu Arg

260 265 270

His Val Leu Thr Ile Leu Thr Asp Met Ser Ser Tyr Ala Asp Ala Leu

275 280 285

Arg Glu Val Ser Ala Ala Arg Glu Glu Val Pro Gly Arg Arg Gly Tyr

290 295 300

Pro Gly Tyr Met Tyr Thr Asp Leu Ser Thr Ile Tyr Glu Arg Ala Gly

305 310 315 320

Arg Val Glu Gly Arg Asn Gly Ser Ile Thr Gln Ile Pro Ile Leu Thr

325 330 335

Met Pro Asn Asp Asp Ile Thr His Pro Ile Pro Asp Leu Thr Gly Tyr

340 345 350

Ile Thr Glu Gly Gln Ile Phe Val Asp Arg Gln Leu His Asn Lys Gly

355 360 365

Ile Tyr Pro Pro Ile Asn Val Leu Pro Ser Leu Ser Arg Leu Met Lys

370 375 380

Ser Ala Ile Gly Glu Gly Met Thr Arg Lys Asp His Gly Asp Val Ser

385 390 395 400

Asn Gln Leu Tyr Ala Lys Tyr Ala Ile Gly Lys Asp Ala Ala Ala Met

405 410 415

Lys Ala Val Val Gly Glu Glu Ala Leu Ser Ile Glu Asp Lys Leu Ser

420 425 430

Leu Glu Phe Leu Glu Lys Phe Glu Lys Thr Phe Ile Thr Gln Gly Ala

435 440 445

Tyr Glu Asp Arg Thr Val Phe Glu Ser Leu Asp Gln Ala Trp Ser Leu

450 455 460

Leu Arg Ile Tyr Pro Lys Glu Met Leu Asn Arg Ile Ser Pro Lys Ile

465 470 475 480

Leu Asp Glu Phe Tyr Asp Arg Ala Arg Asp Asp Ala Asp Glu Asp Glu

485 490 495

Glu Asp Pro Asp Thr Arg Ser Ser Gly Lys Lys Lys Asp Ala Ser Gln

500 505 510

Glu Glu Ser Leu Ile

515

<210> 10

<211> 910

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 10

Met Leu Asn Phe Thr Gly Gln Thr Arg Arg Arg Asn Val Asn Leu Gly

1 5 10 15

Asn Arg Thr Arg Asn Ser Lys Lys Asp Leu Leu Glu Lys Ala Lys Arg

20 25 30

Glu Arg Glu Arg Arg Ala Gln Asp Lys Leu Lys Glu Asp Ala Ser Lys

35 40 45

Thr Ile Gln Lys Ser Ile Arg Arg His Phe Ser Asn Val Arg Leu Phe

50 55 60

Lys Asn Thr Phe Thr Ser Ser Gln Leu Val His Met Ile Pro Ala Tyr

65 70 75 80

Gly Gly Lys Leu Ile Tyr Tyr Ile Ser Gln Tyr Asp Leu Gln Gln Leu

85 90 95

Leu Lys Leu Ser His Asn Phe Leu Ser Ser Tyr Pro Asn Ser Leu Gly

100 105 110

Asn Arg Gln Leu Leu Ser Leu Leu Lys Leu Tyr Gln Asp Asp Ala Leu

115 120 125

Val Ala Glu Thr Leu Ser Asp Leu Asn Met Asp Cys Pro Thr Val Asp

130 135 140

Glu Phe Leu Asp Ser Leu Ser Val Tyr Leu Cys Arg Ala Ser Ser Leu

145 150 155 160

Ser Tyr Ser Ser Ala Ser Lys Leu Ala Asp Val Ile Glu Ala Trp Glu

165 170 175

Val Met His Ser Ser Ala Ser Ile Ser Ile Phe Ser Ile Ser Ile Gly

180 185 190

Ser Tyr Glu Lys Arg Pro Phe Ala Leu Gln Phe Tyr Cys Ile Leu Ala

195 200 205

Glu Arg Asn Leu Leu Pro Gln Leu Ile Asn Thr Asn Pro Ile Leu Trp

210 215 220

Asp Asn Met Ala Lys Thr Tyr Ser His Cys Ser Lys Gly Gly Gln Lys

225 230 235 240

Asn Ile Ala Lys Leu Leu Ile Pro Asn Phe Asn Asn His Ile Ala Pro

245 250 255

Ser Val Leu Arg Ser Asp Asn Asp Tyr Val Leu Lys Phe Tyr Glu Lys

260 265 270

Ala Phe Ile Asp Glu Val Ile Ala Thr Thr Ala Asn Tyr Val Ser Asp

275 280 285

Glu Asp His Val Lys Asn Leu Met Cys Tyr Ile Ala Ser Ser Pro Asn

290 295 300

Gln Ser Cys Lys Asn Ser Val Leu Ile Thr Leu Leu Ser Asn Lys Asp

305 310 315 320

Phe Val Arg Arg Leu Ser Trp Glu Phe Phe His Thr Lys Phe Asn Ala

325 330 335

Ser Lys Thr Glu Ala His Pro Leu Phe Ser Val Leu Ala Gln Leu Ile

340 345 350

Asp Met His Leu Leu Ile Ser Thr Asp Arg Glu Leu Leu Asp Tyr Asn

355 360 365

Ser Val Ile Pro Ile Glu Glu Leu Lys Lys Phe Thr Ser Thr Leu Lys

370 375 380

Asp Phe Thr Phe Arg Gln Tyr Trp Glu Leu Pro Lys Ser Glu Arg Asn

385 390 395 400

Pro Met Leu Lys Glu Ala Val Pro Leu Leu Ser Lys Val Tyr Glu Arg

405 410 415

Asp Ser Arg Leu His Phe Leu Ser Thr Glu Asn Asn Pro Thr Tyr Trp

420 425 430

Glu Asn Ser Glu Lys Gln Phe Leu Asn Leu Arg Phe Tyr Glu Glu Leu

435 440 445

Gln Glu Tyr Glu Asp Leu Tyr Arg Glu His Leu Glu Glu Glu Ser Asp

450 455 460

Glu Asp Met Glu Lys Glu Ile Asp Leu Asp Lys Glu Arg Pro Pro Leu

465 470 475 480

Lys Ser Leu Leu Leu Asn Lys Met Lys Lys Arg Leu Lys Ser Ser Leu

485 490 495

Arg Phe Arg Lys Leu Glu Ile Leu Leu Glu Leu Pro Phe Phe Ile Pro

500 505 510

Phe Glu Glu Arg Val Asp Leu Phe Tyr Met Phe Ile Ala Leu Asp Lys

515 520 525

Lys Arg Leu Ser Leu Asp Asp Asp His Asn Leu Ile Asn Met Phe Thr

530 535 540

Pro Trp Ala Ser Thr Gly Met Arg Lys Gln Ser Ala Ile Ile Ser Arg

545 550 555 560

Asp Asn Val Leu Glu Asp Ala Phe Asn Ala Phe Asn Ser Ile Gly Glu

565 570 575

Arg Phe Lys Ala Ser Leu Asp Val Thr Phe Ile Asn Glu Phe Gly Glu

580 585 590

Glu Ala Gly Ile Asp Gly Gly Gly Ile Thr Lys Glu Phe Leu Thr Thr

595 600 605

Val Ser Asp Glu Gly Phe Lys Asp Pro Lys His Glu Leu Phe Arg Thr

610 615 620

Asn Asp Arg Tyr Glu Leu Tyr Pro Ser Val Val Tyr Asp Ala Thr Lys

625 630 635 640

Leu Lys Tyr Ile Trp Phe Leu Gly Lys Val Val Gly Lys Cys Leu Tyr

645 650 655

Glu His Val Leu Ile Asp Val Ser Phe Ala Asp Phe Phe Leu Lys Lys

660 665 670

Leu Leu Asn Tyr Ser Asn Gly Phe Leu Ser Ser Phe Ser Asp Leu Gly

675 680 685

Ser Tyr Asp Ser Val Leu Tyr Asn Asn Leu Ile Lys Leu Leu Asn Met

690 695 700

Thr Thr Asp Glu Ile Lys Ser Leu Asp Leu Thr Phe Glu Ile Asp Glu

705 710 715 720

Pro Glu Ser Ser Ala Lys Val Val Asp Leu Ile Pro Asn Gly Ser Lys

725 730 735

Thr Tyr Val Thr Lys Asp Asn Val Leu Leu Tyr Val Thr Lys Val Thr

740 745 750

Asp Tyr Lys Leu Asn Lys Arg Cys Phe Lys Pro Val Ser Ala Tyr His

755 760 765

Gly Gly Leu Ser Val Ile Ile Ala Pro His Trp Met Glu Met Phe Asn

770 775 780

Ser Ile Glu Leu Gln Met Leu Ile Ser Gly Glu Arg Asp Asn Ile Asp

785 790 795 800

Leu Asp Asp Leu Lys Ser Asn Thr Glu Tyr Gly Gly Tyr Lys Glu Glu

805 810 815

Asp Gln Thr Ile Val Asp Phe Trp Glu Val Leu Asn Glu Phe Lys Phe

820 825 830

Glu Glu Lys Leu Asn Phe Leu Lys Phe Val Thr Ser Val Pro Gln Ala

835 840 845

Pro Leu Gln Gly Phe Lys Ala Leu Asp Pro Lys Phe Gly Ile Arg Asn

850 855 860

Ala Gly Thr Glu Lys Tyr Arg Leu Pro Thr Ala Ser Thr Cys Val Asn

865 870 875 880

Leu Leu Lys Leu Pro Asp Tyr Arg Asn Lys Thr Ile Leu Arg Glu Lys

885 890 895

Leu Leu Tyr Ala Ile Asn Ser Gly Ala Arg Phe Asp Leu Ser

900 905 910

<210> 11

<211> 196

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 11

Met Val Ala Gln Val Gln Lys Gln Ala Pro Thr Phe Lys Lys Thr Ala

1 5 10 15

Val Val Asp Gly Val Phe Asp Glu Val Ser Leu Asp Lys Tyr Lys Gly

20 25 30

Lys Tyr Val Val Leu Ala Phe Ile Pro Leu Ala Phe Thr Phe Val Cys

35 40 45

Pro Thr Glu Ile Ile Ala Phe Ser Glu Ala Ala Lys Lys Phe Glu Glu

50 55 60

Gln Gly Ala Gln Val Leu Phe Ala Ser Thr Asp Ser Glu Tyr Ser Leu

65 70 75 80

Leu Ala Trp Thr Asn Ile Pro Arg Lys Glu Gly Gly Leu Gly Pro Ile

85 90 95

Asn Ile Pro Leu Leu Ala Asp Thr Asn His Ser Leu Ser Arg Asp Tyr

100 105 110

Gly Val Leu Ile Glu Glu Glu Gly Val Ala Leu Arg Gly Leu Phe Ile

115 120 125

Ile Asp Pro Lys Gly Val Ile Arg His Ile Thr Ile Asn Asp Leu Pro

130 135 140

Val Gly Arg Asn Val Asp Glu Ala Leu Arg Leu Val Glu Ala Phe Gln

145 150 155 160

Trp Thr Asp Lys Asn Gly Thr Val Leu Pro Cys Asn Trp Thr Pro Gly

165 170 175

Ala Ala Thr Ile Lys Pro Thr Val Glu Asp Ser Lys Glu Tyr Phe Glu

180 185 190

Ala Ala Asn Lys

195

<210> 12

<211> 101

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 12

Met Ala Ala Glu Val Lys Thr Val Ile Lys Pro Leu Gly Asp Arg Val

1 5 10 15

Val Val Lys Arg Ile Glu Glu Glu Pro Lys Thr Lys Gly Gly Ile Val

20 25 30

Leu Pro Asp Thr Ala Lys Glu Lys Pro Gln Lys Gly Lys Val Ile Ala

35 40 45

Val Gly Thr Gly Arg Val Leu Glu Asn Gly Gln Arg Val Pro Leu Glu

50 55 60

Val Lys Glu Gly Asp Ile Val Val Phe Ala Lys Tyr Gly Gly Thr Glu

65 70 75 80

Ile Glu Ile Asp Gly Glu Glu Tyr Val Ile Leu Ser Glu Arg Asp Leu

85 90 95

Leu Ala Val Leu Gln

100

<210> 13

<211> 7610

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ctggcatttt gggcgttttc ggccttcatg gagcgcatgg agcgaaacta cctccgggac 60

cagagtggca tgagaaacca gcttctttgt ctggaccatt tggtccaatt tatgcttccc 120

tcactgtaca agcaccttga gaagaccgag tcaaccaatc tgtttttctt cttcagaatg 180

ctgctggtgt ggttcaagcg agagttgctc tgggatgacg ttttgcgtct gtgggaggtg 240

ttgtggacag attacctgtc gtcccaattt gttctatttg tgtgcctggc tatcctcgat 300

aagcacaagg acgtcatgat tgaccatctg gctgggtttg atgagattct gaagtacatg 360

aacgagctgt ccatgaccat cgatttggac gagcttcttg ttcgtgccga gctcttgttc 420

taccgattca gacgtacggt cgagcttatt gaccgaaaga acgaggacag acgcaactca 480

gcggacggct ccgagcctgt ttccatcaca gaggacctgc gggaattgtt atctcggaaa 540

gtcattgttg tgcgtgaggg tgagcgtcct gaaggcgtaa tgggtgggta ggtaatgcag 600

tttgcatgca tgaagacact aaacaagcca accatacagc agaagtatgt agccttgcac 660

atgatttatt gacaggccac ccaaacaggc gtatgtatag tactgtacct tcagtagact 720

attgtagcta acatgtcgtt gcgtggcgta tgtaccaagc cacagaaatt atgtcagaga 780

taaggtcgcg acagttagag cagcaacgcg tggagagttt gggttttggg ttacgtacgt 840

agagccgttt gatagatggt acatccaccg gctagcggaa cacagtgtca agacaagcct 900

gcaacacagt cataatattt gcgatattca ggcgtatcag gtacaatctg aggtgtctca 960

caagtgccgt gcagtcccgc ccccacttgc ttctctttgt gtgtagtgta cgtacattat 1020

cgagaccgtt gttcccgccc acctcgatcc ggggtcctat gcatccctga aacattgatt 1080

ggaaattaac atatgagctg cgtgcttttt gcattcaagg gcgcagctta tcttgtatcc 1140

ttaattacac atgacctctt gagcgccacg gtacattcct ggcgtcagtt cggtggagcg 1200

gacacttttc tctcctttgt ctgacatgtt ggttaagttg tagtccaggg acacaagggg 1260

ttccaacggc agtggcagcc taccccacgc tacccaccac tggccctggt ctaacttcga 1320

cgatcggcat cagggttcat ggataggcgg tgtgatttac gatgtgatgg acaatgttag 1380

agagatccca ctacttgtag tcaggccatc ttttacgtac gcactgtacc atgatgtcaa 1440

tggagtatga tgaaccgact ttgagagact cacatctgca caacaccatg tttcagcgga 1500

atccgacttc caacccaaac ccaagcccct gtcagatatc gtgagaaggc acggcaccaa 1560

ctaatgcaca cactccacct gtattgcacc aagataatga gggcatcgtc ttggcgcgtc 1620

ttggcgagag ccgtgtttcg tgacgcaatc agagcagttt ctggatagta tcttgtccag 1680

aaacacgata taaaccccat cgacgggccc gttgaagagc accaacccac tatccaatcc 1740

tccaatccaa caatgggtac tactttggat gatactgctt acagatacag aacttctgtt 1800

ccaggtgatg ctgaagctat tgaagctttg gatggttctt tcactactga cactgttttc 1860

agagttactg ctactggtga tggtttcact ttgagagaag ttccagttga tccaccattg 1920

actaaggttt ttccagatga tgaatccgat gacgaatctg atgatggtga agatggtgat 1980

ccagattcta gaacttttgt tgcttatggt gatgacggtg acttggctgg ttttgttgtt 2040

gtttcttatt ctggttggaa tagaagattg accgtcgaag atattgaagt tgctccagaa 2100

catagaggtc atggtgttgg tagagctttg atgggtttgg ctactgaatt tgctagagaa 2160

agaggtgctg gtcatttgtg gttggaagtt actaatgtta acgctccagc tattcatgcc 2220

tatagaagaa tgggttttac cttgtgtggt ttggatactg cattatacga tggtactgca 2280

tcagatggtg aacaagcctt gtatatgtct atgccatgtc catgacttct gttcggaatc 2340

aacctcaagg ttaacggcca cgatcccctc gttgttactc ttggtcagcc cattgtcggt 2400

aacgctggct ttgctaactg ggtcgataaa ctcttctttg gccaggagaa ccccgatgtc 2460

tccaaggtgt ccaaagaccg aaagctctac cgaatcaccc accgaggaga tatcgtccct 2520

caagtgccct tctgggacgg ttaccagcac tgctctggtg aggtctttat tgactggccc 2580

ctgatccacc ctcctctctc caacgttgtc atgtgccagg gccagagcaa taaacagtgc 2640

tctgccggta acactctgct ccagcaggtc aatgtgattg gaaaccatct gcagtacttc 2700

gtcaccgagg gtgtctgtgg tatctaagct atttatcact ctttacaact tctacctcaa 2760

ctatctactt taataaatga atatcgttta ttctctatga ttactgtata tgcgttcctc 2820

taagacaaat cgaaaccagc atgcgatcga atggcataca aaagtttctt ccgaagttga 2880

tcaatgtcct gatagtcagg cagcttgaga agattgacac aggtggaggc cgtagggaac 2940

cgatcaacct gtctaccagc gttacgaatg gcaaatgacg ggttcaaagc cttgaatcct 3000

tgcaatggtg ccttggatac tgatgtcaca aacttaagaa gcagccgctt gtcctcttcc 3060

tcgaaactct caaacacagt ccagaagtcc tttatagttt gatctgtatc cagatagcct 3120

ccgtaattgg tgtgtgtctt caaatcccag acgtccacat tggcatgtcc tccactgata 3180

agcatttgaa gttcatctgc gttgaacatt gagacccacg aagggtcaat gagctggtat 3240

agaccgccca agaatgcatc tgttcgtaga taatggaata caaatggata tccagagtat 3300

acacatggat agtatacact gacacgacaa ttctgtatct ctttatgtta actactgtga 3360

ggcgttaaat agagcttgat atataaaatg ttacatttca cagtctgaac ttttgcagat 3420

tacctaattt ggtaagatat taattatgaa ctgaaagttg atggcatccc taaatttgat 3480

gctggcagac cccgaaacct atgtgggggg gggttagaag caattggaga agaaacgttc 3540

agtaacttca aaacgagttt tcctctgtca aattttggat cagatcaagt gtcctatcag 3600

tctcaccctt gtgtttgcac ggtctgccaa gttctctcag atgatctacg ttcaactaat 3660

gagacagaaa gagcacgcag gcttgaacgc aggcttgaac gcatttggtt gagtcattgt 3720

acggcaactg gaagggctga gttgatctat ctgtcttctt cttcctcttc ttcttcaaat 3780

gacatcagca ctggagattc tctcctagct catggactga gactactatg ttctatggag 3840

ttgtgctctc aatccaacca tctttcacaa catcaaactc aagtccactg agaacatctc 3900

gctcgacttg tctctatctc aacacccagg gctatctgag ctggatcgtg gaggactggc 3960

tgttgtaagg agtttggcgc ccgttttttc gagccccaca cgtttcggtg agtatgagcg 4020

gcggcagatt cgagcgtttc cggtttccgc ggcgggacga gagcccatga tgggggctcc 4080

caccaccagc aatcagggcc ctgattacac acccacctgt aatgtcatgc tgttcatcgt 4140

ggttaatgct gctgtgtgct gtgtgtgtgt gttgtttggc gctcattgtt gcgttatgca 4200

gcgtacacca caatattgga agcttattag cctttctatt ttttcgtttg caaggcttaa 4260

caacattgct gtggagaggg atggggatat ggaggccgct ggagggagtc ggagaggcgt 4320

tttggagcgg cttggcctgg cgcccactcg cgaaacgcac ctaggaccct ttggcacgcc 4380

gaaatgtgcc acttttcagt ctagtaacgc cttacctacg tcattccatg catgcatgtt 4440

tgcgcctttt ttcccttgcc cttgatcgcc acacagtaca gtgcactgta cagtggaggt 4500

tttggggggg tcttagatgg gagctaaaag cggcctagcg gtacactagt gggattgtat 4560

ggagtggcat ggagcctggg tggagcctga caggacgcac gaccggctag cccgtgacag 4620

acgatgggtg gctcctgttg tccaccgcgt acaaatgttt gggccaaagt cttgtcagcc 4680

ttgcttgcga acctaattcc caattttgtc acttcgcacc cccattgatc gagccctaac 4740

ccctgcccat caggcaatcc aattaagctc gcattgtctg ccttgtttag tttggctcct 4800

gcccgtttcg gcgtccactt gcacaaacac aaacaagcat tatatataag gctcgtctct 4860

ccctcccaac cacactcact tttttgcccg tcttcccttg ctaacacaaa agtcaagaac 4920

acaaacaacc accccaaccc ccttacacac aagacatatc tacagcagcg atcgccccca 4980

cgttgccggt cttgcctcct actacctgtc catcaatgac gaggttctca cccctgccca 5040

ggtcgaggct cttattactg agtccaacac cggtgttctt cccaccacca acctcaaggg 5100

ctctcccaac gctgttgcct acaacggtgt tggcatttag gcaattaaca gatagtttgc 5160

cggtgataat tctcttaacc tcccacactc ctttgacata acgatttatg taacgaaact 5220

gaaatttgac cagatattgt tgtaaataga aaatctggct tgtaggtggc aaaatcccgt 5280

ctttgttcat caattccctc tgtgactact cgtcatccct ttatgttcga ctgtcgtatt 5340

tttattttcc atacatacgc aagtgagatg cccgtgtccg aattccgacg ctcggacacc 5400

tctggacaca agcactatcc tctgctgcga cgaactacac gcgaaagtcc actaatggct 5460

tttctattgc cagcgttctg ctagatacag gaggagggtt tctgtcaatg ggacagctgg 5520

ttttcgacgg tatcttcgac cacgacaggt cagggtatct acaagaatgt gcccaagttt 5580

ttgctttcct gggtcaccat cttcttcgac gtggttctca tgctcccgcg cgactggttc 5640

ccaggagcta cagtacccac atccaagatg gtcaagatgt gagtgaagag cctgtgtata 5700

aggcaagggg agcactggcg tattttgaat agattgagta gcatgaagag catagacggg 5760

ttggcccagt ttctctcgtt agccttctgt tgcaagtgaa cagcgcacga tcttccatgt 5820

tccggtgcac aagtagacac cctagacacg ccgaaaatat ctccgtctca atcaatgggc 5880

cttggtttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 5940

aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 6000

gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 6060

ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 6120

cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 6180

ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 6240

actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 6300

tggcctaact acggctacac tagaagaaca gtatttggta tctgcgctct gctgaagcca 6360

gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 6420

ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 6480

cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 6540

ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt 6600

tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc 6660

agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc 6720

gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata 6780

ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg 6840

gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc 6900

cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct 6960

acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa 7020

cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt 7080

cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca 7140

ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac 7200

tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca 7260

atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt 7320

tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc 7380

actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca 7440

aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata 7500

ctcatactct tcctttttca atattattga agcatttatc agggttattg tctcatgagc 7560

ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg 7610

Claims (10)

1. A method of constructing a recombinant yarrowia lipolytica comprising: the method comprises introducing a high temperature tolerance gene into yarrowia lipolytica to obtain the recombinant yarrowia lipolytica; the high temperature tolerance gene is Groes gene;

the Groes gene codes the protein of which the amino acid sequence is the sequence 12 in the sequence table.

2. The method according to claim 1, characterized in that: the Groes gene is a gene shown in the following a 1) or a 2):

a1 Coding sequence (CDS) of the coding strand is a cDNA molecule or a DNA molecule of sequence 6 in the sequence table,

a2 The nucleotide of the coding strand is a cDNA molecule or a DNA molecule of sequence 6 in the sequence table.

3. The method according to claim 1 or 2, characterized in that: the recombinant yarrowia lipolytica has higher erythritol yield than the yarrowia lipolytica under high temperature conditions.

4. A method according to claim 3, characterized in that: the high temperature was 35 ℃.

5. Recombinant yarrowia lipolytica constructed by the method of any one of claims 1-4.

6. Use of a high temperature tolerance gene, said high temperature tolerance gene being a Groes gene, in increasing erythritol production by yarrowia lipolytica under high temperature conditions or in increasing high temperature tolerance by yarrowia lipolytica;

the Groes gene codes the protein of which the amino acid sequence is the sequence 12 in the sequence table.

7. The application of a high-temperature tolerance gene in constructing high-temperature resistant recombinant yarrowia lipolytica, wherein the high-temperature tolerance gene is Groes gene;

the Groes gene codes the protein of which the amino acid sequence is the sequence 12 in the sequence table.

8. Use according to claim 6 or 7, characterized in that: the high temperature was 35 ℃.

9. Use of the method of any one of claims 1-4 or the recombinant yarrowia lipolytica of claim 5 in erythritol production.

10. The use according to claim 9, characterized in that: the erythritol is produced by producing erythritol at high temperature.