CN104694406B - Phytase gene multi-site mutant strain of torulopsis delavayi and application thereof - Google Patents

Abstract

The invention discloses a phytase gene multi-site mutant strain of torulopsis delavayi and application thereof, and relates to the technical field of biology. The phytase gene mutation strain with high activity is obtained by mutating phytase gene with three amino acid sites by using ultraviolet mutagenic saccharomycetes, has extremely high phytic acid hydrolysis activity in the whole acidic environment, and meets the requirement of better hydrolyzing phytic acid under the condition of pH in the gastric environment. The strain can be used for producing feed and edible phytase, and can also be used for producing microorganism phosphate fertilizer and/or biological organic phosphate fertilizer, and the preservation number is as follows: CGMCC No. 8738. The mutated phytase gene sequence can be cloned to prokaryotic and/or eukaryotic gene expression vectors, and gene engineering strains and/or transgenic plants are constructed by the gene engineering technology to efficiently express phytase genes to produce phytase.

Description

Phytase gene multi-site mutant strain of torulopsis delavayi and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an optimized and improved Torulopsis delemar mutant strain with improved phytase PHY-M catalytic activity in an acidic range and a multi-site mutant phytase gene thereofphy-m and use.

Background

Phytic acid (IP 6), also known as Phytate, contains 6 phosphate groups and is an important storage form of phosphorus in feed. Phosphorus is an essential mineral element in animal bodies, and Phytase (Phytase, enzyme catalyzing hydrolysis of phytic acid and phytate) which decomposes phytic acid is lacking in monogastric animals, so that the utilization rate of phosphorus in the feed is only 1/3 or less. In order to supplement the deficiency of available phosphorus, inorganic phosphate, commonly calcium hydrogen phosphate and bone meal, must be added to the feed. Therefore, the cost of the feed is greatly increased, and a large amount of phytate phosphorus cannot be utilized and is directly discharged out of the body, so that the waste of phosphorus sources and serious environmental problems are caused.

Experiments prove that the phytase added into the feed can improve the utilization rate of phosphorus and other mineral elements in the plant feed and improve the utilization rate of nutrient substances such as starch, fat, protein and the like, thereby promoting the health of animals to grow rapidly, and reducing the phosphorus content in excrement so as to reduce the environmental pollution. It is believed that the addition of phytase to the feed increases the phosphorus utilization by 20-60%. The microbial phytase is added into the corn-soybean meal daily ration, so that the utilization rate of phosphorus is improved by 60 percent; by adding phytase to the broiler feed based on the bean cake, about 50% of phytate phosphorus is released.

The hydrolysis activity of the phytase in the pig feed is mainly to improve the phytic acid hydrolysis capability of the phytase for pigs in a gastric environment, wherein the important point is to improve the stability and the catalytic activity of the phytase in an acidic environment. Therefore, the yeast phytase is optimized to have high catalytic activity in the whole acidic range, and has great application potential and industrial value. With the development of biotechnology, especially the application of DNA recombination technology, large-scale expression of phytase genes derived from various microorganisms becomes possible. Are currently derived fromEscherichia coli，Aspergillus niger，A.fumigatusThe phytase of the microorganisms has been highly expressed in Pichia pastoris and successfully applied to feed. However, most phytase activities have an optimum pH of 4.5 to 5, and at a pH of 2 to 3, the enzyme activity is low, and only 30 to 40% of the enzyme activity under the optimum pH condition is disadvantageous for the phytase to exert the effect of hydrolyzing phytic acid in the gastric environment.

Disclosure of Invention

The invention aims to modify the phytase PHY-M of the yeast to ensure that the modified phytase has high catalytic activity in the whole acidic range and can better play a role in hydrolyzing phytic acid in animal stomachs.

The invention aims to provide an optimized and improved phytase PHY-M and a gene thereof.

The original strain was stored in the general microbiological center of the China Committee for culture Collection of microorganisms (No. 3 of Xilu 1 of Beijing province of rising of the republic of Beijing, institute of microbiology 100101 of China academy of sciences) at 17.01.2014, with the following storage numbers: CGMCC number 8742, classified and named as Torulaspora delbrueckii. The multi-site mutant strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms (No. 3 of West Lu 1 of Beijing province of rising area, Beijing, and Microbiol research institute of Chinese academy of sciences 100101) at 17.01.2014, and the preservation numbers are as follows: CGMCC number 8738, classified and named as Torulaspora delbrueckii.

Still another object of the present invention is to provide the use of the multi-site mutant strain containing the above phytase gene.

It is a further object of the present invention to provide the use of the above-mentioned phytase.

The invention adopts an ultraviolet irradiation method to modify the phytase active center from saccharomycetes, and obtains the phytase with high catalytic activity in the whole acid range through multiple screening. The phytase of the invention contains 1329 bases and codes 442 amino acids (SEQ ID NO. 1). Compared with the original yeast phytase, two amino acids are mutated, as shown in figure 1, Lys at the 305 th position of the amino acid sequence is mutated into Gln, Val at the 373 th position is mutated into Ile, and Lys at the 398 th position is mutated into Arg.

The pH activity range of the phytase is 2.5-5.5, the phytase activity in the fermentation supernatant is measured after the mutant strain is cultured in a calcium phytate yeast culture solution for 36h at 30 ℃, the phytase activity is 30.46U/ml at the pH of 2.5, and the phytase activity is 9.00U/ml at the pH of 5.5. The phytase activity of the unmodified original strain cultured under the same conditions was 14.78U/ml at pH2.5 and 0.00U/ml at pH 5.5. The improved phytase of the invention has extremely high phytic acid hydrolysis activity in the whole acidic environment, and meets the requirement of better hydrolyzing phytic acid under the pH condition in the gastric environment.

The invention also provides a gene sequence (SEQ ID NO. 2) of the optimized and improved phytase, and the gene sequence encodes the phytase. Compared with the original yeast phytase gene, the base A at the 913 th position of the coded phytase gene sequence is mutated into C, the base T at the 936 th position is mutated into C, the base G at the 1117 th position is mutated into A, and the base A at the 1193 th position is mutated into G, as shown in figure 2.

The invention also provides the application of the phytase in feed additives, mainly relates to the application of the phytase in preparing feed additives, and corresponding feed additives, wherein the effective components of the feed additives can be the phytase and host cells expressing the phytase.

Description of sequence listing

SEQ ID NO.1 mutated phytase amino acid sequence

SEQ ID NO.2 mutant phytase gene base sequence

Description of the drawings:

FIG. 1 is a comparison of the amino acid sequences of the mutated phytases of the invention with the original phytase which has not been mutated.

FIG. 2 is a comparison of the sequences of the mutated phytase gene of the invention with the original phytase gene without mutation.

The specific implementation mode is as follows:

experimental materials and reagents:

1. bacterial strains

Torulopsis delemar: (Torulaspora delbrueckii) The preservation number is CGMCC number 8742.

2. Enzymes and other biochemical reagents

Fastap endonuclease was purchased from Thermo scientific, ligase was purchased from Invitrogen, sodium phytate and other substrates were purchased from Sigma, and others were made reagents in China.

3. Culture medium

The E.coli medium was LB (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0). The yeast medium was YPD (1% yeast extract, 2% peptone, 2% glucose).

The genetic techniques used in this experiment are all conventional in the art.

Example 1 preliminary screening of high Phytase Activity mutant strains

Firstly, ultraviolet mutagenesis is carried out on yeast strains, Torulopsis delemar is coated in a calcium phytate flat plate, the calcium phytate flat plate is placed in a 15W ultraviolet lamp for irradiating for 30-90s, then a dish cover is covered, the calcium phytate flat plate is placed in a 30 ℃ constant temperature incubator in an inverted mode and is cultured in a dark place for 2-3 days, a yeast single strain with a large hydrolysis transparent ring diameter in the flat plate is selected to be spotted in another calcium phytate flat plate, the calcium phytate flat plate is cultured for 3-4 days, the hydrolysis transparent ring diameter (H) and the bacterial colony diameter (C) are measured, the ratio (H/C) of the hydrolysis transparent ring diameter and the bacterial colony diameter is calculated, the H/C value is compared with a control group, and a. Then, the selected yeast mutant strain and the selected control strain are spotted in calcium phytate flat plates, three parallel flat plates are spotted on each strain, and after the strains are cultured for several days, the H/C value is measured. Respectively inoculating the yeast mutant strain with larger H/C value and the control yeast strain which are screened out by mutagenesis treatment into a 250mL triangular flask containing 50mL liquid YPD culture medium, carrying out shaking culture at 30 ℃ and 160r/min for 36H, centrifuging by using a high-speed refrigerated centrifuge (4 ℃, 4000r/min, centrifuging for 10 min), taking fermentation supernatant, and properly diluting to measure the phytase activity.

Example 2 rescreening of highly active mutant strains of Phytase in acidic Environment

The yeast mutant strain and the control yeast strain with larger H/C value, which are screened out by mutagenesis treatment, are respectively inoculated into a 250mL triangular flask containing 50mL liquid YPD medium, are cultured for 36H under shaking at 30 ℃ and 160r/min, and then are centrifuged by a high-speed refrigerated centrifuge (4 ℃, 4000r/min and 10 min) to obtain fermentation supernatant, and the phytase activity under the whole acidic condition is respectively analyzed at pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0 and 5.5. At these pH conditions, the phytase activity of the yeast mutants was greatly increased relative to the control yeast strains.

Example 3 Synthesis of Phytase Gene of Yeast

Designing PCR primer 5' end according to the sequence of yeast phytase geneNotI endonuclease site, 3' end containingEcoRI endonuclease site, primer sequence as follows:

5' end primer TDphyFor: CCGGAATTCATGCTTTGGGAAAAAATTGGTACTCAGG

3' end primer TDphyRev: TAGCGGCCGCTTATTTTTTGATCAAACTAGCGT

The phytase gene of the yeast can be synthesized by taking the phytase gene as a template and carrying out PCR amplification by using the primer. And taking positive clone plasmid DNA for gene sequencing.

Determining the base A at the 913 th site of the mutant phytase gene sequence to be mutated into C, the base T at the 936 th site to be mutated into C, the base G at the 1117 th site to be mutated into A, and the base A at the 1193 th site to be mutated into G by a sequencing result; the mutation site of the coded amino acid sequence is that Lys at the 305 th position is mutated into Gln, Val at the 373 th position is mutated into Ile, and Lys at the 398 th position is mutated into Arg.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein, and any combination and expansion of the various embodiments may be made therein without departing from the spirit and scope of the present invention as defined by the following claims.

Sequence listing

<110> Anhui science and technology institute

<120> phytase gene multi-site mutant strain of Torulopsis delemar and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 442

<212> PRT

<213> Artificial Sequence

<400> 1

Met Leu Trp Glu Lys Ile Gly Thr Gln Glu Glu Ile Val Pro Phe Leu

1 5 10 15

Gly Gly Ala Gly Pro His Phe Ser Phe Pro Leu Asp Tyr Gly Ile Asp

20 25 30

Lys Ala Ile Pro Asp Thr Cys Glu Leu Thr Gln Val Gln Leu Phe Thr

35 40 45

Arg His Gly Glu Arg Tyr Pro Thr Lys Ser Lys Gly Ala Lys Ile Leu

50 55 60

Glu Thr Tyr Tyr Lys Leu Ala Asn Tyr Thr Gly Thr Phe Asn Gln Ser

65 70 75 80

Leu Ser Phe Leu Asp Asp Asp Tyr Glu Ile Phe Ile Gln Asp Thr Asn

85 90 95

Asn Phe Glu Glu Glu Thr Thr Leu Lys Asn Thr Val Asn Pro Leu Asn

100 105 110

Pro Tyr Thr Gly Glu Met Asp Ala Lys Arg His Ser Gln Glu Phe Leu

115 120 125

Ala Gln Tyr Ala Asp Leu Leu Glu Glu Thr Pro Ser Phe Ala Met Phe

130 135 140

Thr Ser Asn Ser Lys Arg Cys His Asp Thr Ala Lys Phe Phe Ile Asp

145 150 155 160

Gly Leu Gly Lys Asp Tyr Asn Val Ser Leu Gln Ile Ile Asp Glu Asp

165 170 175

Pro Ser Ser Gly Tyr Asn Thr Leu Thr Pro Arg Tyr Ala Cys Ser Asn

180 185 190

Phe Asn Glu Thr Glu Asn Asp Glu Tyr Val Asp Thr Tyr Ser His Lys

195 200 205

Tyr Leu Ser Asn Leu Ala Lys Arg Leu Asn Asp Glu Asn Ile Gly Leu

210 215 220

Asn Leu Thr Lys Ser Asp Ala Thr Asn Leu Phe Asp Trp Cys Ser Tyr

225 230 235 240

Glu Leu Asn Ala Arg Gly Tyr Ser Asp Ile Cys Asp Val Phe Thr Gln

245 250 255

Glu Glu Leu Val His Tyr Ser Tyr Gln Asp Asp Leu Glu Ser Tyr Tyr

260 265 270

Glu Asn Gly Asn Gly Asn Ser Leu Gly Ala Thr Ala Gly Ser Val Leu

275 280 285

Phe Asn Ala Ser Ala Glu Leu Leu Arg Gln Ser Asp Glu Leu Glu Gln

290 295 300

Gln Val Trp Leu Ser Phe Thr His Asp Ser Asp Leu Val Asn Tyr Ile

305 310 315 320

Ala Ala Val Gly Leu Phe Asp Asp Gly His Lys Leu Asn Ala Ser Gln

325 330 335

Val Pro Phe Arg Asp His Val Tyr Arg Lys Ser Trp Ile Val Pro Gln

340 345 350

Gly Ala Arg Ile Tyr Thr Gln Gln Phe Lys Cys Ser Asn Gln Thr Tyr

355 360 365

Val Arg Tyr Val Ile Asn Asp Val Val Ile Pro Ile Asp Ser Cys Ser

370 375 380

Ser Gly Pro Gly Phe Ser Arg Pro Ser Asp Gly Phe Phe Arg Tyr Val

385 390 395 400

Glu Glu Arg Ile Gly Gly Ile Asp Tyr Asn Glu Lys Cys Gly Gln Asn

405 410 415

Lys Ala Ser Asn Ala Thr Ser Leu Thr Phe Tyr Trp Asp Tyr Glu Ser

420 425 430

Lys Asn Tyr Asn Ala Ser Leu Ile Lys Lys

435 440

<210> 2

<211> 1329

<212> DNA

<213> Artificial Sequence

<400> 2

atgctttggg aaaaaattgg tactcaggaa gaaattgttc cgtttctagg aggtgctggt 60

ccacatttct ccttcccact tgactacggt atcgataagg caatcccaga tacctgcgaa 120

ttgactcaag ttcaattgtt cactagacat ggtgaaagat acccaaccaa gagcaaaggt 180

gctaagattt tagaaactta ctacaaattg gcaaactaca ctggtacttt taaccagtct 240

ttgtctttct tggacgatga ttatgaaatc ttcatccagg atactaacaa tttcgaagaa 300

gagactactt taaagaacac tgtcaaccct ttgaaccctt acactggtga aatggatgcg 360

aagagacaca gtcaggaatt cttagctcaa tatgctgact tgttggaaga gactccaagc 420

tttgctatgt tcacttccaa ctctaagaga tgtcatgaca ctgccaagtt tttcatcgac 480

gggttgggta aggattacaa cgtctccttg caaatcattg acgaggaccc atcatctggt 540

tacaacactt taaccccaag atatgcctgc tccaacttca acgaaaccga gaacgatgaa 600

tacgttgaca cttactctca caaatatttg tccaatcttg ctaagagact aaacgatgag 660

aacattggtt tgaacttgac caagagtgat gccactaatc tattcgactg gtgttcttac 720

gaacttaatg cccgtggtta cagtgatatc tgtgatgtct tcactcaaga agagcttgtt 780

cactactctt accaggatga tttggaaagc tactacgaga atggtaacgg taactccttg 840

ggtgccacag ccggttctgt tcttttcaac gcttccgctg aattgttgag acaaagcgac 900

gaattggaac aacaagtttg gttgagtttc actcacgact ctgaccttgt taattatatt 960

gctgctgttg gcctattcga cgatggccac aagctaaacg cttctcaagt tccattccgt 1020

gaccatgtct accgtaagtc atggatcgtt cctcaaggtg ctagaatcta tactcaacag 1080

ttcaaatgct ctaaccaaac ttacgtccgt tacgttatca acgacgtcgt cattccaatc 1140

gacagctgct cctctggtcc tggtttctct cgtccatctg atggtttctt caggtacgtc 1200

gaagaacgta tcggtggtat cgactacaac gaaaagtgtg gtcaaaacaa ggcaagcaac 1260

gccacttctc tgacctttta ctgggattac gagagcaaaa actacaacgc tagtttgatc 1320

aaaaaataa 1329

Claims (3)

1. A multi-site mutant strain of a Torulopsis delemar phytase gene phy-m is characterized in that the strain is used for producing phytase for feeding and eating or is used for producing microorganism phosphate fertilizer and/or biological organic phosphate fertilizer, and the preservation number is as follows: CGMCC No. 8738.

2. An optimized and improved Torulopsis delemar multi-site mutation phytase PHY-M is characterized in that the amino acid sequence is shown as SEQ ID NO.1, and the mutated sites are: lys at position 305 is mutated into Gln, Val at position 373 is mutated into Ile, Lys at position 398 is mutated into Arg, and the pH range of phytase activity is 2.5-5.5.

3. An optimized and improved Torulopsis delavayi multi-site mutation phytase gene phy-m is characterized in that the nucleotide sequence is shown as SEQ ID NO.2, and the mutated sites are: the 913 th base A was mutated to C, the 936 th base T was mutated to C, the 1117 th base G was mutated to A, and the 1193 th base A was mutated to G.