CN104650202A - Malus zumi water channel protein MzPIP2;1 as well as encoding gene and application of Malus zumi water channel protein MzPIP2;1 - Google Patents
Malus zumi water channel protein MzPIP2;1 as well as encoding gene and application of Malus zumi water channel protein MzPIP2;1 Download PDFInfo
- Publication number
- CN104650202A CN104650202A CN201510063598.3A CN201510063598A CN104650202A CN 104650202 A CN104650202 A CN 104650202A CN 201510063598 A CN201510063598 A CN 201510063598A CN 104650202 A CN104650202 A CN 104650202A
- Authority
- CN
- China
- Prior art keywords
- sequence
- plant
- gene
- mzpip2
- encoding gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a Malus zumi water channel protein MzPIP2;1 as well as an encoding gene and application of the Malus zumi water channel protein MzPIP2;1. The protein is as shown in (a) or (b), wherein (a) is composed of an amino acid sequence as shown in a sequence 2 in a sequence table; and (b) is obtained by substituting and/or deleting and/or adding one or several amino acid residues of the amino acid sequence as shown in the sequence 2 in the sequence table, is related to stress resistance of a plant and is derived from (a). Experiments prove that the protein and the encoding gene thereof have the function of improving the stress resistance of the plant, the stress resistance of the plant in which the gene disclosed by the invention is transferred is remarkably higher than that of a plant (for example, transgenic arabidopsis) in which the gene disclosed by the invention is not transferred, and an adult plant is remarkably higher than a wild control plant; and after salt treatment and drought treatment, the growth condition of a transgenic plant is remarkably better than that of non-transgenic arabidopsis, and the survival rate is remarkably increased as comparison with that of a control group. Therefore, the protein and the encoding gene thereof have wide application prospects in the fields such as stress-resistant plant culturing and crop breeding.
Description
Technical field
The present invention relates to a kind of plant stress tolerance to be correlated with aquaporin MzPIP2; 1 and encoding gene and application, the resistance of reverse particularly deriving from Mains Zumi (Mulas Zumi Mats) is correlated with aquaporin MzPIP2; The application of 1 gene and proteins encoded thereof.Belong to biological technical field.
Background technology
Various Stress Factors in environment, as arid, saline and alkaline, low temperature etc. has a strong impact on growing and quality responses of plant.Therefore, the resistance of reverse improving plant is one of major objective of plant breeding.
At present, genetic engineering breeding has become one of important method strengthening plant stress tolerance.Higher plant has the various environment stresses in number of ways response environment.Plant can accumulate high molecular weight protein in vivo, and ooze albumen, aquaporin, enrichment protein of late stage embryo etc. as adjusted, these albumen can participate in Stress response.Wherein, the quantity of aquaporin and switch can limit water loss in plant materials, maintain water balance, thus can change the tolerance of plant to stress factors.
Aquaporin is prevalent in animal, plant and microorganism, it is a kind of channel protein that can mediate moisture active transdermal delivery, belong to transmembrane channel MIP (Membrane IntrinsicProtein) extended familys (Maurel, 1997), water balance is maintained to plant extremely important.The free water mediated by the studies on plant aquaporins, can transport across biological membranes fast, constitutes the main path of plant materials water turnover cell.The studies on plant aquaporins all plays very important effect to the balance of maintenance moisture at cell levels or in whole plant level.
Aquaporin has the characteristic feature (Heymann and Engel, 2001) of MIP family structure.Sequence hydrophilicity analysis shows: aquaporin have by six connected transmembrane spanning α-heliceses of five becates (1oop A-E) and stretch into cytoplasmic N hold and C end form.Every half part of albumen all comprises a structural domain NPA box (Asp-Pro-Alabox) be made up of three amino acid, and NPA box high conservative, in known MIP gene, nearly all gene all has this structural domain.According to peptide sequence and position distribution, plant MIP can be divided into four classes: plasma membrane integrated protein (PIP), tonoplast intrinsic protein (TIP), the similar inner membrane protein of NOD26 (NIP) and the little integrated protein of alkalescence (SIP).
Large quantity research shows, plant resists various environment stress by the quantity and activity controlling aquaporin.Research find Arabidopis thaliana water channel protein gene to salt, arid, low temperature, anoxic is coerced and dormin all produces response.People clone the water channel protein gene obtaining working under adverse circumstance in succession from different plant, but not yet clone this genoid relevant to abiotic stress in Mains Zumi.
Summary of the invention
The object of the present invention is to provide Mains Zumi aquaporin MzPIP2; 1 and encoding gene, another object of the present invention is to provide Mains Zumi aquaporin MzPIP2; The application of 1, and corresponding method of cultivating resistance of reverse plant, in the widespread use of stress resistance of plant research field, strengthen conscientiously the resistance of reverse of plant and crop and improve its economic benefit.
The invention provides a kind of albumen relevant to plant stress tolerance and encoding gene thereof, albumen provided by the present invention, name is called MzPIP2; 1, derive from Mains Zumi.
Mains Zumi aquaporin MzPIP2 provided by the invention; 1, be specially following albumen shown in (a) or (b):
A protein that () is made up of the aminoacid sequence shown in sequence in sequence table 2;
(b) by the aminoacid sequence of sequence in sequence table 2, through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation, obtain and by (a) the derivative protein relevant to plant stress tolerance.
In sequence table, sequence 2 is made up of 283 amino-acid residues, belongs to the aquaporin family of Mains Zumi.This sequence tool 6 cross-film districts wherein, are TM1 from sequence N-terminal 21-43 amino acids residue; 58-80 amino acids residue is TM2; 100-122 amino acids residue is TM3; 143-164 amino acids residue is TM4, and 177-199 amino acids residue is TM5; 225-247 amino acids residue is TM6.There is characteristic sequence GGGANXXXXGY (from sequence N-terminal 133-142 bit amino residue) and the TGI/TNPARSL/FGAAI/VI/VF/YN (from sequence N-terminal 202-217 bit amino residue) of plasma membrane aquaporin family.Wherein between TM2 and TM3, TM5 and TM6 across between, respectively include NPA (Asn-Pro-Ala) conserved domain, lay respectively at from sequence N-terminal 84-86 bit amino residue and 205-207 bit amino residue, there is the characteristic feature of aquaporin.
The replacement of one or several amino-acid residue described and/or disappearance and/or interpolation refer to be carried out replacing and/or lacking and/or add outside the NPA structural domain of sequence 2, plasma membrane aquaporin family's characteristic sequence and cross-film district; Described NPA structural domain is N-terminal 84-86 bit amino residue from sequence 2 and 205-207 bit amino residue.Characteristic sequence is from sequence N-terminal 133-142 bit amino residue and 202-217 bit amino residue.Cross-film district has 6, be respectively from sequence N-terminal 21-43 amino acids residue be TM1; 58-80 amino acids residue is TM2; 100-122 amino acids residue is TM3; 143-164 amino acids residue is TM4, and 177-199 amino acids residue is TM5; 225-247 amino acids residue is TM6.
In order to make the albumen in (a) or (b) be convenient to purifying, (aminoterminal) or C can be held to hold label as shown in table 1 in (carboxyl terminal) connection at the N of described albumen.
The sequence of table 1. label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being generally 5) | RRRRR |
| Poly-His | 2-10 (being generally 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Albumen in above-mentioned (a) or (b) can synthetic, also can first synthesize its encoding gene, then carries out biological expression and obtain.The encoding gene of the albumen in above-mentioned (b) is by lacking the codon of one or several amino-acid residue by the DNA sequence dna shown in sequence in sequence table 1, and/or carry out the missense mutation of one or several base pair, and/or the encoding sequence connecting the label shown in table 1 is held to obtain at its 5 ' end and/or 3 '.
The replacement of one or several amino-acid residue in the aminoacid sequence of above-mentioned albumen, replacement and/or interpolation, have plenty of because abiogenous variation causes, have plenty of and caused by induced mutations process.
The encoding gene of described protein also belongs to protection scope of the present invention.
Encoding gene provided by the present invention specifically can be following 1) or 2) or 3) shown in gene:
1) DNA molecular shown in sequence 1 in sequence table;
2) under strict conditions with 1) DNA molecule hybridize that limits and the DNA molecular of described plant stress tolerance correlative protein of encoding;
3) with 1) DNA sequence dna that limits at least has 70% homology and the DNA molecular of described plant stress tolerance correlative protein of encoding.Above-mentioned stringent condition can be in the solution of 6 × SSC, 0.5%SDS, and hybridize at 65 DEG C, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
Albumen MzPIP2; The encoding gene of 1 is denoted as MzPIP2; 1, the sequence 1 in sequence table is made up of 1094 deoxyribonucleotides, is MzPIP2 from 5 ' the 1 to 1091 deoxyribonucleotide held; The open reading frame (Open Reading Frame, ORF) of 1.
Recombinant vectors containing above-mentioned arbitrary described encoding gene, recombinant bacterium, transgenic cell line or expression cassette also belong to protection scope of the present invention.
Described recombinant expression vector specifically can be and oppositely insert the pCB302-3-MzPIP2 that the deoxynucleotide of sequence 1 obtains in sequence table between XbaI and the BamHI site of pCB302-3; 1.
Available existing plant expression vector construction contains MzPIP2; The recombinant expression vector of 1 gene.
Described plant expression vector comprises double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Described plant expression vector also can comprise 3 ' end untranslated region of foreign gene, namely comprises the DNA fragmentation of polyadenylation signals and any other participation mRNA processing or genetic expression.The bootable polyadenylic acid of described polyadenylation signals joins 3 ' end of mRNA precursor, as Agrobacterium crown-gall nodule induction (Ti) plasmid gene (as kermes synthetic enzyme Nos gene), plant gene (as soybean storage protein genes) 3 ' hold the non-translational region of transcribing all to have similar functions.
Use MzPIP2; During 1 structure recombinant plant expression vector, any one enhancement type promotor or constitutive promoter can be added before its transcription initiation Nucleotide, as the ubiquitin promoter (Ubiquitin) of cauliflower mosaic virus (CAMV) 35S promoter, corn, they can be used alone or are combined with other plant promoter; In addition, when using gene constructed plant expression vector of the present invention, also enhanser can be used, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can be synthesis.Translation initiation region can from transcription initiation region or structure gene.
For the ease of identifying transgenic plant cells or plant and screening, can process plant expression vector used, the coding can expressed in plant as added can produce enzyme or the gene (gus gene, luciferase genes etc.) of luminophor, the antibiotic marker thing (gentamicin marker, kantlex marker etc.) with resistance or the chemical resistance reagent marker gene (as anti-weedkiller gene) etc. of colour-change.From the security consideration of transgenic plant, any selected marker can not be added, directly with adverse circumstance screening transformed plant.
The primer pair of above-mentioned arbitrary described encoding gene total length or its any fragment of increasing also belongs to protection scope of the present invention.
Described primer pair specifically can be as follows:
1) sequence of a primer is as shown in sequence in sequence table 3, and the sequence of another primer is as shown in sequence in sequence table 4; This primer is the primer of amplification gene total length.
Last object of the present invention is to provide a kind of method of cultivating resistance of reverse plant.
The method of cultivation resistance of reverse plant provided by the present invention, is in plant, import above-mentioned arbitrary described encoding gene, after cultivating, obtains resistance of reverse plant.
In said process, described resistance of reverse specifically can be salt tolerant and drought-enduring.
The carrier utilizing any one can guide foreign gene to express in plant, by Mains Zumi MzPIP1 provided by the present invention; The encoding gene of 2 imports vegetable cell, can obtain the transgenic cell line and transfer-gen plant that strengthen salt stress and drought stress tolerance power.The plant tissue of conversion by using Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, conventional biology methods transformed plant cells or the tissue such as agriculture bacillus mediated, and is cultivated into plant by the expression vector carrying encoding gene.
Described plant can be monocotyledons, also can be dicotyledons, as: Arabidopis thaliana, soybean, paddy rice, Mains Zumi, corn, cucumber, tomato, willow, turfgrass, lucerne place etc.
Above-mentioned arbitrary described albumen or above-mentioned arbitrary described encoding gene also belong to protection scope of the present invention cultivating the application in resistance of reverse plant, and in above-mentioned application, described resistance of reverse specifically can be salt tolerant, drought-enduring.
Experiment proves, albumen of the present invention and encoding gene thereof have the function improving stress resistance of plant, proceed to the resistance of the plant (antisense expression) of gene of the present invention apparently higher than the plant not proceeding to gene of the present invention, as transgenic arabidopsis, the plant height of adult plants is apparently higher than Wild type control plants; After Ficus caricaL and Osmotic treatment (salt stress and drought stress), the growth conditions of transfer-gen plant significantly better than non-transgenic arabidopsis, and survival rate and biomass comparatively control group be significantly increased.Therefore, albumen of the present invention and encoding gene thereof will have broad application prospects in the fields such as cultivation resistance plant, crop breeding.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Mains Zumi tissue cultured seedling is preserved by China Agricultural University's fruit tree stress physiology and Molecular Biology Lab; Plant binary expression vector pCB302-3 is purchased from Clonetech company; The seed of wild-type Columbia ecotype Arabidopis thaliana (Col-0) is preserved by China Agricultural University's fruit tree stress physiology and Molecular Biology Lab.
The discovery of embodiment 1, gene
Constructed the cDNA library of Mains Zumi under environment stress in this experiment previous work, therefrom screening obtains the MzPIP2 of up-regulated expression; 1 gene.Extract the total serum IgE of Mains Zumi seedling, RNA reversed transcriptive enzyme is synthesized cDNA, as template amplification cDNA total length.Total length primer is: PIP2; 1L:TCCCAAACTCTGTGAAGC (sequence 3), PIP2; 1R:CACAAAGCATAAGTTAAGCAC (sequence 4).PCR program is as follows: 94 DEG C of 3min; 94 DEG C of 30s, 52 DEG C of 30s, 72 DEG C of 50s, 30 circulations; 72 DEG C of 10min.
The cDNA obtained with reverse transcription is template, carries out pcr amplification, carries out 1.0% agarose gel electrophoresis detection, obtain the band that molecular weight is about 1kb, conform to expected results PCR primer.Reclaim test kit (TIANGEN) with sepharose and reclaim this fragment.This recovery fragment is connected with pMD20-T, with reference to the method for Cohen etc., product conversion bacillus coli DH 5 alpha competent cell being connected, according to the acillin resistance marker screening positive clone on pMD20-T carrier, obtaining the recombinant plasmid containing reclaiming fragment.With the M13Primers on this recombinant plasmid vector, for primer pair, it carries out nucleotide sequencing, and sequencing result shows the MzPIP2 obtained that increases; The nucleotide sequence of 1 gene is as shown in sequence in sequence table 1, be made up of 1094 deoxyribonucleotides, its open reading frame (ORF) is sequence in sequence table 1 from 5 ＇ end the 1 to 1091 deoxyribonucleotide, and encoding amino acid sequence is that the protein of sequence 2 in sequence table (is denoted as albumen MzPIP2; 1).By the MzPIP2 of the deoxyribonucleotide containing sequence 1 in ordered list; The recombinant vectors called after pMD20-T-MzPIP2 of 1 gene; 1.
MzPIP2 under embodiment 2, Stress treatment; The expression characteristic of 1 gene
Mains Zumi tissue cultured seedling is transferred to root media (1/2MS+1.0mg/L IBA) grow into stem lignifying on growth medium (MS+0.5mg/L BA+0.5mg/L IBA) after, transfer in half nutritive medium after the long 3 ~ 4cm of root, after 2 weeks, move into complete nutrition liquid.Fluorescent lamp constant light source, light intensity 1500lx, illumination 12h/d, temperature 24 ~ 28 DEG C.Carry out Stress treatment with 150mM NaCl during height of seedling 5 ~ 6cm, after Ficus caricaL 0h, 4h, 8h, 12h, 24h, 3d, 5d, collect root and leaf respectively.The Mains Zumi seedling consistent to growing way carries out drought stress process, the N.F,USP MANNITOL adding 300mM in complete nutrition liquid carries out process 0h, 4h, 8h, 12h, 24h, collect root and leaf respectively after 3d, 5d, it is for subsequent use that the material of collection is all placed on-80 DEG C of Refrigerator stores through liquid nitrogen flash freezer.
Collect above-mentioned blade 1g to grind in liquid nitrogen, adopt CTAB method to extract plant RNA, digest through DNase I and remove DNA.Get 0.5 μ L RNA, the agarose gel electrophoresis by 1% detects RNA integrity.With sequence 3 and sequence 4 for probe, carry out RT-PCR analysis.
Result shows, MzPIP2; The expression of 1 gene is by salt and drought-induced.
Embodiment 3, use MzPIP2; 1 gene cultivates plant with adverse resistance
1) MzPIP2; 1 antisense expression vector pCB302-3-MzPIP2; The structure of 1
The cDNA obtained with the total serum IgE reverse transcription growing to the blade of the Mains Zumi in tri-leaf period, for template, uses full length gene primer, carries out pcr amplification; By amplified production restriction enzyme BamHI and XbaI double digestion, reclaim digestion products, use restriction enzyme BamHI and XbaI double digestion plant binary expression vector pCB302-3 again, reclaim carrier large fragment, the product cut twice enzyme connects, and obtains recombinant expression vector pCB302-3-MzPIP2; 1; Recombinant vectors is carried out cloning and sequencing, and result shows that the structure of recombinant vectors is correct, and the sequence of the gene inserted in carrier is correct, gene M zPIP2; 1 oppositely inserts between BamHI after the CaMV 35S promoter of plant binary expression vector pCB302-3 and XbaI enzyme cutting site.
Total length primer sequence is as follows:
5 '-TCCCAAACTCTGTGAAGC-3 ' (sequence 3)
5 '-CACAAAGCATAAGTTAAGCAC-3 ' (sequence 4)
2) MzPIP2 is turned; The acquisition of 1 gene plant and qualification
Adopt freeze-thaw method by recombinant plasmid transformed Agrobacterium GV3101 competence.Colored method transformed wild type Arabidopis thaliana Col-0 is dipped in employing.
By the vernalization 3 days under 4 DEG C of conditions of Arabidopis thaliana Col-0 seed.With 1/3 × B
5nutritive medium soaks the planting pot that vermiculite (vermiculite) and Nutrition Soil (vermiculite: Nutrition Soil=1:1) are housed, after planting in 25 DEG C of cultivations.Plant to be planted Post flowering, cuts off its major branch top, promotes side shoot development.In 4-6 days after beta pruning, prepare to carry out Agrobacterium-mediated Transformation.By recombinational agrobacterium pCB302-3-MzPIP2; 1 is inoculated in 5ml YEP+50 μ g/ml Rifampin+50 μ g/ml kantlex+5 μ g/ml tetracycline broth, shakes bacterium and spends the night.Within second day, rolling bottle is in 200mLYEP liquid nutrient medium, and 28 DEG C are cultured to OD
600about=0.6-0.8.Collected by centrifugation thalline, with the abundant suspension Agrobacterium of appropriate osmotic medium (sucrose 5%, SilwetL-770.02%) to OD
600for 0.6-0.8.Inflorescence part more than the plant lotus throne leaf of 4-6 after beta pruning days is invaded 10-12s in suspension completely.Take out planting pot, lucifuge is sidelong 24h.Then planting pot is upright, cultivate plant to solid, results mature seed (T
0generation).
After dry two weeks, the vernalization T of 3 days
0for seed uniform broadcasting in Nutrition Soil, 25 DEG C of cultivations.Basta (10mg/mL) is sprayed, screening resistant transformants plant after growing two panels true leaf.The Arabidopis thaliana transfer that will grow after 7 ~ 10 days is cultivated.After maturation, a point individual plant collects seed (T
1generation).
When resistant plant grows to 5 ~ 6 leaves, every strain clip leaf extracts DNA in a small amount.Using DNA as template, with MzPIP2; 1 full length gene primer carries out PCR qualification, with recombinant plasmid pCB302-3-MzPIP2; 1 is positive control, and the DNA of not genetically modified plant is negative control, identifies transfer-gen plant further.
Result shows, turns MzPIP2 in 13 strains; The T of 1 gene
0for in plant, 10 strains are had to detect MzPIP2; The expression of 1 gene, and the adjoining tree of 5 strain wild-types does not all detect the expression of goal gene.
Get T
1for seed uniform broadcasting in Nutrition Soil, after growing two panels true leaf, spray Basta (10mg/mL) screen, be the green transplantation of seedlings of the strain of 3:1 by segregation ratio, individual plant collects T
2for seed.T
2for still using 10mg/mL Basta to screen after planting seed, wherein transfer-gen plant homozygote is no longer separated, the T that these plant are born
3the homozygous line of transfer-gen plant is for seed.The transfer-gen plant occurring to be separated can screen further, obtains homozygous line.So repeat the transgenic line of acquisition 4 genetic stabilities.
Extract do not carry out any conversion WT lines, turn MzPIP2; The total serum IgE of the pure and mild single copy plant of 1 gene carries out RT-PCR identification and analysis, and primer is as follows:
5 '-TCCCAAACTCTGTGAAGC-3 ' (sequence 3)
5 '-CACAAAGCATAAGTTAAGCAC-3 ' (sequence 4)
3) MzPIP2 is turned; 1 gene plant Salt-Tolerance Identification
Individual plant number for the adjoining tree of testing and transgenic line 1-10,1-14 is 20 strains.
The seed of transgenic line 1-10,1-14 is cultivated respectively with the seed of Wild type control plants under identical normal growing conditions, cultivates about 45 days, observe the phenotype of adult plants.Result turns MzPIP2; 1 gene grows up the phenotype of strain phase compared with Wild type control plants, and plant height is apparently higher than wild-type.
Transgenic line and wildtype Arabidopsis thaliana are broadcast in 1/2MS substratum and are vertically cultivated after sterilization, the seedling being about 1cm by size of taking root after 7 days grows under moving to the MS culture medium condition containing 150mMNaCl, after two weeks, observe and add up root length and the change of fresh weight isophenous, in contrast with the WT lines through same treatment simultaneously.The growth conditions such as the long situation of root of transfer-gen plant and fresh weight are all better than WT lines, and the salt resistance ability that transfer-gen plant is described comparatively WT lines increases.
4) MzPIP2 is turned; 1 gene plant drought tolerance qualification
Choose MzPIP2; The homozygous lines that 1 gene expression amount is higher and wildtype Arabidopsis thaliana seed are after sterilizing, sowing vertically placed cultivation after 7 days on MS substratum, transfer to containing 300mM N.F,USP MANNITOL and not containing on the MS substratum of other material (in contrast), vertical placement is cultivated, and observes their growing state respectively.After 10 days, there is drought-enduring phenotype.To overexpression MzPIP2; The fresh weight of 1 transgenic arabidopsis is added up, and found that the transfer-gen plant fresh weight on MS substratum slightly overweights wild-type, and each strain fresh weight is about 1.1 ~ 1.2 times of adjoining tree; Containing on the MS of 300mM N.F,USP MANNITOL, the fresh weight of each transgenic line is also all greater than wild-type and difference is larger, and about 1.2 times to 2.1 times are not etc.
Turn MzPIP2; The percentage of water loss of 1 gene plant blade measures.Individual plant number for the adjoining tree of testing and transgenic line 1-10,1-14 is 20 strains.
The seed of the seed of transgenic line 1-10,1-14 and Wild type control plants is sowed in Nutrition Soil respectively, cultivates under identical normal growing conditions.Cultivate after about 45 days, get each 20 of the fresh and healthy blade of wild-type and 2 transgenic line plant respectively at random, take initial fresh weight, then blade is placed in the plate of paving filter paper, place 4 hours under room temperature condition, took the fresh weight of blade every 1 hour and record.Each process repetition 3 times.As a result, the rate-of-loss of coolant of rotaring gene plant blade, obviously faster than WT lines blade, illustrates antisense expression MzPIP2; 1 gene may change the controllability that vegetable cell passes in and out moisture, and water loss speed is accelerated, therefore, the rate of water absorption of transfer-gen plant also most probably comparatively WT lines raise to some extent.
Analytical results shows, and transgenic line 1-10,1-14 are under normal growing conditions, and the average plant height of adult plants is 28.43cm, 27.15cm respectively, higher than the 23.62cm of Wild type control plants; Under Ficus caricaL and drought stress conditions, growth conditions is also significantly better than Wild type control plants.These results show, MzPIP2; The salt tolerant of 1 transfer-gen plant (antisense expression) and drought-enduring proterties obtain and significantly improve, MzPIP2; 1 is relevant to resistance of reverse.In addition, the rate-of-loss of coolant of rotaring gene plant blade, obviously faster than the blade of Wild type control plants, shows antisense expression MzPIP2; 1 gene may change the controllability that vegetable cell passes in and out moisture.
The gene of vegetable-protein provided by the present invention and coding thereof for the resistance of reverse Be very effective improving transgenic plant, and responds multiple environment stress, is worth research further, has broad application prospects.The method of cultivation resistance of reverse plant provided by the present invention is clear and easy to understand, simple to operate and the cycle is short, and concrete to implement required conditional request few, is suitable for applying.
Claims (10)
1. an albumen is following albumen shown in (a) or (b):
A protein that () is made up of the aminoacid sequence shown in sequence in sequence table 2;
(b) by the aminoacid sequence of sequence in sequence table 2, through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation, obtain and by (a) the derivative protein relevant to plant stress tolerance.
2. albumen as claimed in claim 1, is characterized in that: the replacement of one or several amino-acid residue described and/or disappearance and/or interpolation refer to be carried out replacing and/or lacking and/or add outside the NPA structural domain of sequence 2, plasma membrane aquaporin family's characteristic sequence and cross-film district; Described NPA structural domain is N-terminal 84-86 bit amino residue from sequence 2 and 205-207 bit amino residue, characteristic sequence is from sequence N-terminal 133-142 bit amino residue and 202-217 bit amino residue, cross-film district has 6, be respectively from sequence N-terminal 21-43 amino acids residue be TM1; 58-80 amino acids residue is TM2; 100-122 amino acids residue is TM3; 143-164 amino acids residue is TM4, and 177-199 amino acids residue is TM5; 225-247 amino acids residue is TM6.
3. the encoding gene of albumen described in claim 1 or 2.
4. encoding gene as claimed in claim 3, is characterized in that: described encoding gene specifically can be following 1) or 2) or 3) shown in gene:
1) DNA molecular shown in sequence 1 in sequence table;
2) under strict conditions with 1) DNA molecule hybridize that limits and the DNA molecular of described plant stress tolerance correlative protein of encoding;
3) with 1) DNA sequence dna that limits at least has 70% homology and the DNA molecular of described plant stress tolerance correlative protein of encoding.
5. the recombinant vectors containing encoding gene described in claim 3 or 4, recombinant bacterium, transgenic cell line or expression cassette.
6. increase the total length of encoding gene or the primer pair of its any fragment described in claim 3 or 4.
7. primer pair as claimed in claim 6, is characterized in that: described primer pair specifically can be following 1) shown in:
1) sequence of a primer is as shown in sequence in sequence table 3, and the sequence of another primer is as shown in sequence in sequence table 4.
8. cultivating a method for resistance of reverse plant, is the encoding gene imported in plant described in claim 3 or 4, after cultivating, obtain resistance of reverse plant.
9. method as claimed in claim 8, is characterized in that: described resistance of reverse is salt tolerant and drought-enduring.
10. method as claimed in claim 8 or 9, is characterized in that: described plant is monocotyledons or dicotyledons.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510063598.3A CN104650202A (en) | 2015-02-06 | 2015-02-06 | Malus zumi water channel protein MzPIP2;1 as well as encoding gene and application of Malus zumi water channel protein MzPIP2;1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510063598.3A CN104650202A (en) | 2015-02-06 | 2015-02-06 | Malus zumi water channel protein MzPIP2;1 as well as encoding gene and application of Malus zumi water channel protein MzPIP2;1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104650202A true CN104650202A (en) | 2015-05-27 |
Family
ID=53241885
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510063598.3A Pending CN104650202A (en) | 2015-02-06 | 2015-02-06 | Malus zumi water channel protein MzPIP2;1 as well as encoding gene and application of Malus zumi water channel protein MzPIP2;1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104650202A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112321690A (en) * | 2020-10-30 | 2021-02-05 | 浙江大学 | Wild soybean aquaporin GsPIP1-4 and coding gene and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009083958A2 (en) * | 2007-12-27 | 2009-07-09 | Evogene Ltd. | Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants |
| CN101880674B (en) * | 2010-07-27 | 2011-11-30 | 山西省农业生物技术研究中心 | Date tree aquaporin gene and application in improvement on plant drought resistance and salt resistance |
-
2015
- 2015-02-06 CN CN201510063598.3A patent/CN104650202A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009083958A2 (en) * | 2007-12-27 | 2009-07-09 | Evogene Ltd. | Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants |
| CN101880674B (en) * | 2010-07-27 | 2011-11-30 | 山西省农业生物技术研究中心 | Date tree aquaporin gene and application in improvement on plant drought resistance and salt resistance |
Non-Patent Citations (1)
| Title |
|---|
| MALUS DOMESTICA (APPLE): "ACCESSION NO.XM_008369458.1,PREDICTED: Malus x domestica probable aquaporin PIP2-5 (LOC103431283), mRNA", 《GENBANK DATABASE》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112321690A (en) * | 2020-10-30 | 2021-02-05 | 浙江大学 | Wild soybean aquaporin GsPIP1-4 and coding gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101503467B (en) | Plant stress tolerance related transcription factor GmNAC20, coding gene and use thereof | |
| CN101747419B (en) | Protein related to salt tolerance, coding gene thereof and application thereof | |
| CN102234323B (en) | Plant stress-tolerance-associated protein TaDREB3A and coding gene and application thereof | |
| CN101812124B (en) | Plant stress-resistance-associated protein TaSnRK2.8, coding genes and application thereof | |
| AU2020100982A4 (en) | Wheat salt tolerance gene taaap3 and its application | |
| CN112342222A (en) | Wheat salt-tolerant gene TaAAP3 and application thereof | |
| CN1876813B (en) | Method for improving cold resistance of zoysia | |
| CN102399268B (en) | Plant stress tolerance-related transcription factor GmNAC11, coding gene and application thereof | |
| CN102584965B (en) | Stress-resistant protein PpLEA 3 PpLEA3-20 and encoding gene thereof and application | |
| CN101659699B (en) | Plant stress resistance-related protein GmSIK2 and coding gene and application thereof | |
| CN102041248A (en) | Plant stress resistance related protein GmSIK1, coding gene thereof and application thereof | |
| CN101701035A (en) | Protein GaTPSP relevant to drought resistance of plants, coding gene and application thereof | |
| CN103497940B (en) | A kind of plant drought associated protein TaSnRK2.6 and encoding gene thereof and application | |
| CN101831436A (en) | Method for breeding adverse-resistant plant | |
| CN103951740A (en) | Bermuda grass CCAAT transcription factor CdtNF-YC1 as well as coding gene and application thereof | |
| CN103421104A (en) | Application of OsLEA3-2 in improvement of stress resistance of crop | |
| CN104651331A (en) | Key enzyme protein MzASMT9 for synthesizing Malus zumi melatonin as well as encoding gene and application of key enzyme protein MzASMT9 | |
| CN103602644A (en) | Vacuole proton pyrophosphatase as well as encoding gene and application thereof | |
| CN101987867B (en) | Ethylene receptor NTHK1 interactive protein relevant to plant stress tolerance as well as coding gene and application thereof | |
| CN104650202A (en) | Malus zumi water channel protein MzPIP2;1 as well as encoding gene and application of Malus zumi water channel protein MzPIP2;1 | |
| CN107987139A (en) | A kind of Dof transcription factors and its application in terms of plant salt tolerance is improved | |
| CN101619096B (en) | Protein related to plant stress-tolerance, coding gene and application thereof | |
| CN101824080B (en) | Picea wilsonii transcription factor PwHAP5 and coding gene and application thereof | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof | |
| CN102477089B (en) | Plant low-temperature resistance related protein, its encoded gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150527 |
|
| WD01 | Invention patent application deemed withdrawn after publication |