CN102477089B - Plant low-temperature resistance related protein, its encoded gene and application - Google Patents

Abstract

The invention discloses plant low-temperature resistance related protein, its encoded gene and application. The plant low-temperature resistance related protein provided in the invention is protein of (a) or (b) as the following that: (a) is protein composed of amino acid sequences as shown in sequence 1 of a sequence table; (b) is plant low-temperature resistance related protein that is derived from (a) and is obtained by substitution and/or deletion and/or adding of one or several amino acid residues in amino acid residue sequences as shown in sequence 1 of the sequence table. Experiments prove that, LcWRKY5 has tissue expression specificity, and under low-temperature induced expression, can participate in a response of Leymus chinensis to multiple kinds of adversity stress so as to improve stress resistance of plants. LcWRKY5 and its encoded gene are of great theoretical and practical significance for cultivating low-temperature resistance improved Leymus chinensis and other new plant varieties, and can be used for cultivating and identifying resistant plant varieties needed in agriculture and animal husbandry as well as ecological environment improvement, thus boasting high practical application value.

Description

The albumen relevant with plant frigostabile and encoding gene thereof and application

Technical field

The present invention relates to albumen relevant with plant frigostabile in the biological technical field and encoding gene thereof and application.

Background technology

Low temperature stress is one of Main Barrier Factors that affects plant normal growth, and the plant especially cold resistance power of cash crop directly affects crop yield.The evaluation of at present anti-cold gene focuses mostly in Arabidopis thaliana, paddy rice isotype plant and the important farm crop such as corn and cotton.They mostly are the plant of torrid zone origin, all are impatient at cold environment, and 0 ℃～12 ℃ namely damage.Therefore, need badly from the strong plant of other cold resistance and excavate genes involved.China is one of species diversity is the abundantest in the world country and origin center of staple crop, not only the plant genetic resources kind is many, and many are the wild species that adapt to abominable extreme environment, these species have obvious advantage at aspects such as cold-resistant, drought resisting and Salt And Alkali Tolerances, are current and basis the future of agriculture Sustainable development.Sheep's hay has another name called the alkali grass, is one of important constructive species on Eurasia grassland region east meadow steppe and the arid grassland.Sheep's hay is the Gramineae per nnial herb, has very flourishing ground bottom rail and walks rhizome, and root can reach 1 meter～1.5 meters deeply, mainly is distributed in the soil layer more than 20 centimetres.Cold-resistant, the drought resisting of sheep's hay, Salt And Alkali Tolerance, anti-soil are barren, and subject range is very wide, accounts for the song-Nen plain well-grown of annual half the time at soil freezing.Sheep's hay has certain using value with clone and the functional analysis of anti-cold related gene to the cold resistance aspect that improves farm crop and cash crop.

For a long time, people have carried out a lot of researchs from physiology, biochemistry, metabolism, ecology and heredity, evolution equal angles to the cold mechanism of coercing of plant responding, have accumulated abundant knowledge.In recent years, along with molecular biological development, people have further deepened understanding to cold resistance of plant mechanism in genomic constitution, expression regulation and signal conduction equimolecular level, for the cold resistance that utilizes gene engineering method improvement plant can provide solid basis.Because the complicacy of plant stress-resistance proterties adopts the cold resistance of traditional breeding method raising plant very difficult.The gene engineering method such as transgenosis provide effective way for the cold resistance of plant breeding, but the separation of the cold gene of Effective Anti is the engineered key factor of restriction cold resistance of plant.

The Genes For Plant Tolerance low temperature properties is regulated and control by polygene, make numerous functional gene Coordinated Play effects to plant stress-resistance proterties generation effect, could effectively improve the Genes For Plant Tolerance low temperature properties.Because an anti-cold associated transcription factor can be regulated and control the expression of a plurality of genes, therefore strengthen the effect of a transcription factor, the cold resistance shape of plant is comprehensively improved.

Summary of the invention

An object of the present invention is to provide the albumen relevant with plant frigostabile and encoding gene thereof.

The albumen relevant with plant frigostabile provided by the present invention, name is called LcWRKY5, derives from sheep's hay (Leymus chinensis), is following (a) or protein (b):

(a) protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with resistance protein of being derived by (a).

Sequence 1 is comprised of 328 amino-acid residues in the sequence table.

For the ease of the purifying of LcWRKY5, label as shown in table 1 on N-terminal that can the protein that the amino acid residue sequence of sequence 1 forms in by sequence table or C-terminal connect.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned b) but in the LcWRKY5 synthetic, also can synthesize first its encoding gene, carry out again biological expression and obtain.Above-mentioned b) encoding gene of the LcWRKY5 in can be by the codon that lacks one or several amino-acid residue in the dna sequence dna shown in 5 ' terminal the 1st the-the 984th bit base with sequence in the sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

Described and the encoding gene plant frigostabile associated protein also belongs to protection scope of the present invention.

Described and the encoding gene plant frigostabile associated protein are following 1)-4) in arbitrary described gene:

1) in the sequence table sequence 2 from 5 ' terminal the dna molecular shown in the 1st the-the 984th Nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the gene of encoding said proteins;

4) with 1) or 2) or 3) gene have homology more than 90% and the gene of encoding said proteins.

Above-mentioned stringent condition can be with 6 * SSC, and the solution of 0.5%SDS 65 ℃ of lower hybridization, is then used 2 * SSC, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.

Sequence 2 in the sequence table is by 987 based compositions, and its open reading frame (ORF) is that encoding amino acid sequence is the albumen shown in the sequence 1 in the sequence table from 5 ' terminal the 1st the-the 984th bit base.

The expression cassette, recombinant expression vector, transgenic cell line or the recombinant bacterium that contain the encoding gene of described and plant frigostabile associated protein also belong to protection scope of the present invention.

Described recombinant expression vector is to insert the described recombinant expression vector that obtains with the encoding gene plant frigostabile associated protein between the multiple clone site of p3301-121 carrier;

Described p3301-121 carrier is to obtain by the method that comprises the steps:

(1) with pCAMBIA3301 carrier process HindIII and EcoRI double digestion, reclaims the carrier large fragment;

(2) with pBI121 carrier process HindIII and EcoRI double digestion, reclaim the fragment that comprises gus gene;

(3) the carrier large fragment that reclaims in the step (1) is connected with the fragment that comprises gus gene of recovery in the step (2), obtains recombinant vectors p3301-121.

Described pCAMBIA3301 carrier is available from CAMBIA company; Described pBI121 carrier is available from Clontech company.

Described recombinant bacterium is recombination microzyme.

The encoding gene total length of described and the plant frigostabile associated protein of increasing or the primer of its arbitrary fragment are to also belonging to protection scope of the present invention.

Described primer centering, a primer sequence is shown in sequence in the sequence table 3, and another primer sequence is shown in sequence in the sequence table 4.

Another object of the present invention provides a kind of method of cultivating transgenic plant.

The method of cultivation transgenic plant provided by the present invention is that described encoding gene with the plant frigostabile associated protein is imported in the purpose plant, obtains the transgenic plant that low temperature tolerance ability is higher than the purpose plant.

Described is to import in the purpose plant by described recombinant expression vector with the encoding gene plant frigostabile associated protein.

Described purpose plant is dicotyledons or monocotyledons; Described dicotyledons is Arabidopis thaliana;

Described low temperature is 0 ℃ or 4 ℃.

The invention provides a sheep's hay LcWRKY5 transcription factor and encoding gene thereof.Experiment showed, that LcWRKY5 has tissue expression specificity, expressed by low temperature induction, can participate in sheep's hay to the response of multiple environment stress, improve the resistance of plant.LcWRKY5 and encoding gene thereof have important theoretical and practical significance for sheep's hay and other neies variety of plant of cultivating the lower temperature resistance raising, can be used for cultivation and the evaluation of the required resistance plant kind of husbandry and ecological environment treatment, have higher actual application value.

Description of drawings

Fig. 1 is the agarose gel electrophoresis detected result through the total RNA of chinense seedlings of 4 ℃ of subzero treatment.

Fig. 2 is the agarose gel electrophoresis detected result of pcr amplification LcWRKY5 full length gene cDNA.

Fig. 3 is the abduction delivering result of LcWRKY5 gene under various abiotic stress treatment condition.

Fig. 4 is the abduction delivering result of LcWRKY5 gene under various HORMONE TREATMENT conditions.

Fig. 5 is the tissue specific expression analytical results of LcWRKY5 gene.

Fig. 6 is the assorted checking of yeast list LcWRKY5 gene transcription function result.

Fig. 7 is the growing state that turns LcWRKY5 gene Arabidopis thaliana under the low temperature stress treatment condition.

Fig. 8 is the building process figure of recombinant expression vector p3301-121-LcWRKY5.

Fig. 9 is p3301-121 Vector construction procedure chart.

Figure 10 is the PCR qualification result that turns LcWRKY5 gene Arabidopis thaliana plant.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

Embodiment 1, the albumen relevant with plant frigostabile and acquisition and the functional verification of encoding gene thereof

One, the acquisition of the albumen relevant with plant frigostabile and encoding gene thereof

1, the extraction of vegetable material processing and total RNA

Be material with sheep's hay (lucky give birth to No., available from Jisheng Improved Variety Station of Aneurolepidium Chinense, Jilin Province) seedling, process for 4 ℃ and extract total RNA after 2 hours that carry out 1% agarose gel electrophoresis and detect, the result as shown in Figure 1.The RNA that extracts has two obvious electrophoretic bands, is followed successively by from top to bottom 28S RNA and 18S RNA, shows to have obtained higher, the more completely total RNA of purity.

2, the acquisition of sheep's hay LcWRKY5 full length gene cDNA sequence and PCR detect

Obtain 3 ' terminal sequence of sheep's hay WRKY transcription factor by GS-FLX 454 (being called for short 454) order-checking.Carry out the BLAST comparison with WRKY transcription factor 3 ' the end cDNA sequence that obtains at NCBI, find that its homologous gene is very conservative at 5 ' end, so according to its homologous gene translation initiation Position Design upstream primer LcWRKY5F:5 '-ATGGAAACGGCGCGGTGGT-3 ', according to WRKY transcription factor 3 ' the end cDNA sequences Design downstream primer LcWRKY5R:5 '-CTAATAATCCGGCAGCTTCCGCA-3 ' that obtains, take step 1 extract through total RNA of the chinense seedlings of 4 ℃ of processing as template, adopt takara company's reverse transcription test kit and reference reagent box specification sheets, its first chain cDNA is synthesized in reverse transcription.Reaction system and condition are as follows: 1 μ l RNA, and 1 μ l Oligo dT Primer (50 μ M), Buffer, 0.5 μ l RNase Inhibitor (40U/ μ l), 1 μ l dNTP Mix (10mM), 1 μ l

RTase (200U/ μ l), 11.5 μ l RNase free dH ₂O; 65 ℃ of 2min, 2min on ice, 42 ℃ of 1.5h, 72 ℃ of 7min.

Take the first chain cDNA of obtaining as template, primer LcWRKY5F matches with primer LcWRKY5R and carries out pcr amplification; The PCR reaction system is: 1 μ l50X HIFI Polymerase (Beijing Quanshijin Biotechnology Co., Ltd), 33.5 μ l PCR-Grade Water, 5 μ l 10X HIFI Polymerase Buffer II, 4 μ l dNTP Mix (10mM), 2 μ lLcWRKY5F, 2 μ l primer LcWRKY5R, 2.5 μ lcDNA templates; Reaction conditions is: first 94 ℃ of 30s, 60 ℃ of 30s then, 72 ℃ of 90s, totally 35 circulations; Last 70 ℃ are extended 10min.

After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result as shown in Figure 2.Wherein, swimming lane M is the dna molecular amount standard of DL2000DNA molecular weight standard (Beijing Quanshijin Biotechnology Co., Ltd), and swimming lane 1 is pcr amplification product, the result shows, has obtained the purpose fragment that length is about 990bp through pcr amplification.Reclaim and purified pcr product, be connected on the PMD-18T carrier (available from TaKaRa company), connect product and transform the bacillus coli DH 5 alpha competent cell, screening positive clone carries out bacterium liquid PCR to be identified, the plasmid that extracts positive colony checks order, and sequencing result is carried out the BLAST compare of analysis.The result shows that the length of this fragment is 987bp, and this fragment is identical with 3 ' terminal sequence of the sheep's hay WRKY transcription factor of above-mentioned acquisition at 3 ' end, shows that this fragment may be the encoding gene of sheep's hay WRKY transcription factor.Splicing obtains the full length cDNA sequence of LcWRKY5 gene by Contig software, and its nucleotide sequence is shown in sequence in the sequence table 2.Sequence 2 is its encoding sequence by 987 based compositions from 5 ' the 1st the-the 984th at end in the sequence table, and coding has the protein of the amino acid residue sequence shown in the sequence 1 in the sequence table.Sequence 1 is comprised of 328 amino-acid residues in the sequence table.Be LcWRKY5 with this unnamed gene, with the albumen called after LcWRKY5 of its coding.

Two, the expression pattern analysis of LcWRKY5 gene under different abiotic stress and HORMONE TREATMENT condition

With the normal growth sheep's hay in 9 weeks (lucky giving birth to No. one, available from Jisheng Improved Variety Station of Aneurolepidium Chinense, Jilin Province) seedling carries out respectively following processing: different abiotic stress are processed: processed respectively 3 hours under low temperature (4 ℃), high salt (400mM NaCl), high temperature (42 ℃) and arid (20%PEG) condition, establish simultaneously chinense seedlings without any Stress treatment for contrasting (CK); Hormon is processed: 100 μ M 6-benzyladenines (BAP), 100 μ M ethrels (ETH), 100 μ M Whitfield's ointments (SA), 100 μ M methyl jasmonates (MJ), 100 μ M Plant hormones regulators,gibberellins (GA) and 100 μ M dormins (ABA) were processed respectively 6 hours, and the chinense seedlings of establishing simultaneously without any Stress treatment is contrast (CK).Extract respectively total RNA of above-mentioned processing chinense seedlings, use respectively the LcWRKY5 gene primer:

LcRKY5-1:5 '-ACGCTAACCAGAGTTTCGC-3 ' and

LcWRKY5-2：5′-AGGAGTTGACGGAGATGGA 3′；

Take the Actin gene as confidential reference items, primer sequence is: Actin-1:5 '-TGGACTCTGGTGATGGTGTGAG-3 ' and Actin-2:5 '-GTGCTAAGGGAGGCAAGGATG-3 ', by RT-PCR (94 ℃ of 4min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 25 circulations) expression pattern of methods analyst LcWRKY5 gene under different abiotic stress and HORMONE TREATMENT condition, the result is as shown in Figure 3 and Figure 4.The result shows that the LcWRKY5 gene has certain constitutive expression, but its transcriptional level is induced by low temperature (4 ℃), arid (20%PEG) and ethrel (ETH) obviously.

Three, the tissue specific expression analysis of LcWRKY5 gene

Extract respectively total RNA of root, rhizome, stem, leaf and five kinds of tissues of leaf sheath of the chinense seedlings in 9 weeks of normal growth.Use respectively the LcWRKY5 gene primer:

LcRKY5-1:5 '-ACGCTAACCAGAGTTTCGC-3 ' and

LcRKY5-3：5′-AGGAGTTGACGGAGATGGA-3′；

Take the Actin gene as confidential reference items, primer sequence is Actin-1 and Actin-2, by RT-PCR (94 ℃ of 4min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 25 circulations) carry out semi-quantitative analysis.The result as shown in Figure 5.The result shows that the LcWRKY5 gene more obviously expresses in the root of chinense seedlings and leaf, the expression in rhizome, stem and leaf sheath is not obvious.

Four, the assorted checking of yeast list LcWRKY5 gene transcription function

LcWRKY5 gene design primer with above-mentioned steps one amplification obtains adds Ecor I and SalI restriction enzyme site, and primer sequence is as follows:

Primer 1:5 '-CG GAATTCATGGAAACGGCGCGGTGGTC-3 ' (underscore partly is the EcoRI restriction enzyme site),

Primer 2: 5 '-GC GTCGACCTAATAATCCGGCAGCTTCC-3 ' (underscore partly is the SalI restriction enzyme site),

LcWRKY5 gene shown in the sequence 2 carries out pcr amplification as template in the sequence table of synthetic, and amplified production is cut through EcoRI and BamHI enzyme, reclaims the LcWRKY5 gene fragment after enzyme is cut; Simultaneously, cut Yeast expression carrier pBridge-BD (Clotech company) with EcoRI and SalI enzyme, reclaim the carrier large fragment; The carrier large fragment that reclaims is connected with LcWRKY5 gene fragment after the enzyme of recovery is cut, obtains the purpose plasmid.The purpose plasmid is changed in the intestinal bacteria, resistance screening, the picking positive colony, positive colony is carried out liquid culture, extract the positive colony plasmid and carry out sequence verification, sequencing result shows inserted the LcWRKY5 gene fragment shown in the 1st to 984 of the sequence 2 in the sequence table between the EcoRI of carrier pBridge-BD and SalI restriction enzyme site, proves that plasmid construction is correct, with the recombinant vectors called after pBridge-LcWRKY5 that obtains.With recombinant vectors pBridge-LcMYB13355 import to contain His3 and LacZ reporter yeast AH109 strain (available from U.S. Clontech company, cat. no K1612-1) in, simultaneously Yeast expression carrier pBridge-BD is changed over to yeast AH109 strain as turning empty carrier contrast (CK-), change pGAL4 (available from U.S. Clontech company) over to yeast AH109 strain as positive control (CK+).

Recombinant yeast is cultivated at the SD substratum (SD/-His-Trp) that does not contain Histidine (His) and tryptophane (Trp), then afterwards with aobvious blue analysis of betagalactosidase activity filter paper.The result as shown in Figure 6.Among Fig. 6 a represent to turn the LcWRKY5 gene yeast strain (WRKY5), positive control yeast strain (CK+) and turn empty carrier contrast yeast strain (CK-) and lacking the selection substratum upgrowth situation of Histidine and tryptophane; B is the yeast of a among Fig. 6 situation after with the Z-buffer colour developing that contains X-gal among Fig. 6, (betagalactosidase activity filter paper analysis).The position of each yeast strain among c indication a and the b among Fig. 6.The result shows, turn empty carrier contrast yeast strain (CK-) and do not containing on the SD substratum of His and Trp and can not grow, can be in the SD substratum growth that does not contain His and Trp and aobvious blueness and turn the yeast strain (CK+) of the yeast strain (WRKY5) of LcWRKY5 gene and positive control.The result shows that the LcWRKY5 gene has transcriptional activation activity.

Embodiment 2, turn the lower temperature resistance analysis of LcWRKY5 gene Arabidopis thaliana plant

One, obtains to turn LcWRKY5 gene Arabidopis thaliana plant

The LcWRKY5 gene design primer that 1 amplification obtains according to above-described embodiment adds BamHI and SmaI restriction enzyme site, and primer sequence is as follows:

Primer 3:CG GGATCCATGGAAACGGCGCGGTGGTCG (underscore is the BamHI site) (sequence 3 in the sequence table),

Primer 4:TCC CCCGGGATAATCCGGCAGCTTCCGCAGG (underscore is the SmaI site) (sequence 4 in the sequence table),

LcWRKY5 gene shown in the sequence 2 carries out pcr amplification as template in the sequence table of synthetic, and the PCR product cloning that amplification is obtained enters pMD19-T Simple (TaKaRa company) carrier, called after pMD19-LcWRKY5.Utilize BamHI and SmaI to carry out double digestion pMD19-LcWRKY5, reclaim the fragment of about 1kb, use simultaneously BamHI and SmaI double digestion p3301-121 carrier recovery large fragment, the carrier large fragment that reclaims is connected with the LcWRKY5 gene fragment of about 1kb of recovery, obtain the purpose plasmid.The purpose plasmid is changed in the intestinal bacteria, resistance screening, the picking positive colony, positive colony is carried out liquid culture, extract the positive colony plasmid and carry out sequence verification, sequencing result shows inserted the LcWRKY5 gene fragment shown in the 1st to 984 of the sequence 2 in the sequence table between the BamHI of carrier p3301-121 and SmaI restriction enzyme site, the proof plasmid construction is correct, with the plant binary expression vector that contains LcWRKY5 gene complete reading frame that obtains, called after p3301-121-LcWRKY5, building process are as shown in Figure 8.The plant expression vector p3301-121-LcWRKY5 that builds changes Agrobacterium EHA105 (available from Beijing Baeyer enlightening Bioisystech Co., Ltd) over to by freeze-thaw method, carry out the Herbicid resistant screening, the picking positive colony, positive colony is carried out liquid culture, contaminate the Arabidopis thaliana inflorescence with positive colony bacterium liquid and carry out transformation of Arabidopsis thaliana, the dark cultivation 2 days after transforming carried out the second time and contaminated, then the normal results seed of cultivating.The seed of results carries out resistance screening containing the flat board of weedicide (1/2MS+10mg/L Glufosinate ammonium), screen positive seedling, results seed (T1), the seed of results is planted at the flat board that contains weedicide, screening the offspring separate than the strain that is 3: 1, gather in the crops its seed (T2), (T3) does degeneration-resistant experiment with its seedling.According to the method that obtains to turn LcWRKY5 gene Arabidopis thaliana, with empty carrier p3301-121 arabidopsis thaliana transformation plant, obtain turning empty carrier contrast Arabidopis thaliana plant.The transgenic arabidopsis seedling that is used for doing degeneration-resistant experiment all detects through PCR, and take transgenic arabidopsis seedling and the genomic dna that turns empty carrier contrast Arabidopis thaliana plant as template, the primer that PCR detects usefulness is above-mentioned primer 3 and primer 4 respectively.

The PCR detected result is as shown in figure 10 (among Figure 10, swimming lane 1-5 is different transgenic line, 6 for turning empty carrier contrast Arabidopis thaliana plant, M is trans plus 2000Marker), as can be seen from Fig. 10, different transgenic lines all increases and has obtained length and be about the fragment of 984bp, and turns empty carrier contrast Arabidopis thaliana plant this fragment that do not increase.With same primer wild-type Arabidopis thaliana plant is carried out PCR and detect, do not obtain above-mentioned amplified fragments.This result shows that transgenic line is all positive.

Described p3301-121 carrier is to obtain by the method that comprises the steps:

(1) with pCAMBIA3301 carrier (available from CAMBIA company) process HindIII and EcoRI double digestion, reclaims the carrier large fragment of 11246bp;

(2) (contain 35S promoter, gus reporter gene Tnos) also passes through HindIII and EcoRI double digestion, reclaims the fragment of the 2942bp that comprises gus gene with pBI121 carrier (available from Clontech company);

(3) the carrier large fragment that reclaims in the step (1) is connected through the T4DNA enzyme with the middle fragment that comprises gus gene that reclaims of step (2), obtains recombinant vectors p3301-121 (Fig. 9).

Two, turn the cold resistance analysis of LcWRKY5 gene Arabidopis thaliana plant

The seed that turns LcWRKY5 gene Arabidopis thaliana plant with above-mentioned steps one acquisition, the seed and the wild-type Arabidopis thaliana seed that turn empty carrier contrast Arabidopis thaliana plant are planted respectively in containing on the weedicide substratum (1/2MS+10mg/L Glufosinate ammonium), (growth conditions is: temperature is 22-24 ℃ to germination and growth, illumination-8 in the 16 hours hour dark photoperiod, atmospheric moisture is 60%-80%) after the week, be transplanted in the soil, (condition that culturing room cultivates: temperature is 22-24 ℃ in culturing room's cultivation, illumination-8 in the 16 hours hour dark photoperiod, atmospheric moisture is 50-60%) after the week, carry out low temperature stress at 0 ℃ and process.Stress treatment begins to observe phenotype after 4 hours, observed Stress treatment the 7th day.From Stress treatment begins time meter the 7th day the time, wild-type Arabidopis thaliana plant has 95% plant blade dehydration wilting symptom to occur, the dimmed yellow-green colour of leaf color, and shrinkage (A among Fig. 7); Have 90% plant strain growth normal and turn LcWRKY5 gene Arabidopis thaliana seedling plant, blade dehydration wilting symptom (B among Fig. 7) do not occur, it is consistent with the phenotype of wild-type Arabidopis thaliana plant to turn empty carrier contrast Arabidopis thaliana plant.Turn LcWRKY5 gene Arabidopis thaliana plant after low temperature stress processed, put into and recover growth 14 days under the normal growth condition, observe the plant phenotype, 95% plant all grows normally; And after will turning empty carrier adjoining tree and the processing of wild-type plant low temperature stress, put into and recover growth 14 days under the normal growth condition, all can not restore normal growth.3 repetitions are established in experiment, and the result is all with above-mentioned consistent.This experimental result shows that turning LcWRKY5 gene Arabidopis thaliana compares with the wild-type Arabidopis thaliana with turning empty carrier contrast Arabidopis thaliana, has stronger low temperature tolerance ability.

Claims (12)

1. albumen, the protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 1.

2. the encoding gene of the described albumen of claim 1.

3. encoding gene according to claim 2, it is characterized in that: the encoding gene of described albumen is following 1)-2) in arbitrary described gene:

1) in the sequence table sequence 2 from 5 ' terminal the dna molecular shown in the 1st to the 984th Nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table.

4. the expression cassette that contains claim 2 or 3 described encoding genes.

5. the recombinant expression vector that contains claim 2 or 3 described encoding genes.

6. recombinant expression vector according to claim 5 is characterized in that: described recombinant expression vector is to insert the recombinant expression vector that described encoding gene obtains between the multiple clone site of p3301-121 carrier;

Described p3301-121 carrier is to obtain by the method that comprises the steps:

(1) with pCAMBIA3301 carrier process HindIII and EcoRI double digestion, reclaims the carrier large fragment;

(2) with pBI121 carrier process HindIII and EcoRI double digestion, reclaim the fragment that comprises gus gene;

(3) the carrier large fragment that reclaims in the step (1) is connected with the fragment that comprises gus gene of recovery in the step (2), obtains recombinant vectors p3301-121.

7. the recombinant bacterium that contains claim 2 or 3 described encoding genes.

8. recombinant bacterium according to claim 7, it is characterized in that: described recombinant bacterium is recombination microzyme.

9. the primer of amplification claim 2 or 3 described encoding gene total lengths or its arbitrary fragment pair, described primer centering, a primer sequence is shown in sequence in the sequence table 3, and another primer sequence is shown in sequence in the sequence table 4.

10. a method of cultivating transgenic plant is that claim 2 or 3 described encoding genes are imported in the purpose plant, obtains the transgenic plant that low temperature tolerance ability is higher than described purpose plant; Described purpose plant is Arabidopis thaliana.

11. method according to claim 10 is characterized in that: claim 2 or 3 described encoding genes are to import in the purpose plant by claim 6 or 7 described recombinant expression vectors.

12. according to claim 10 or the method described in 11, it is characterized in that: described low temperature is 0 ℃ or 4 ℃.

Images