CN102477089A - Plant low-temperature resistance related protein, its encoded gene and application - Google Patents

Abstract

The invention discloses plant low-temperature resistance related protein, its encoded gene and application. The plant low-temperature resistance related protein provided in the invention is protein of (a) or (b) as the following that: (a) is protein composed of amino acid sequences as shown in sequence 1 of a sequence table; (b) is plant low-temperature resistance related protein that is derived from (a) and is obtained by substitution and/or deletion and/or adding of one or several amino acid residues in amino acid residue sequences as shown in sequence 1 of the sequence table. Experiments prove that, LcWRKY5 has tissue expression specificity, and under low-temperature induced expression, can participate in a response of Leymus chinensis to multiple kinds of adversity stress so as to improve stress resistance of plants. LcWRKY5 and its encoded gene are of great theoretical and practical significance for cultivating low-temperature resistance improved Leymus chinensis and other new plant varieties, and can be used for cultivating and identifying resistant plant varieties needed in agriculture and animal husbandry as well as ecological environment improvement, thus boasting high practical application value.

Description

Albumen relevant and encoding sox thereof and application with plant frigostabile property

Technical field

The present invention relates to albumen relevant in the biological technical field and encoding sox thereof and application with plant frigostabile property.

Background technology

Low temperature stress is one of major obstacle factor that influences plant normal growth, and the plant especially cold resistance power of cash crop directly influences crop yield.The evaluation of at present anti-cold gene focuses mostly in Arabidopis thaliana, paddy rice isotype plant and important farm crop such as corn and cotton.Mostly they are the plant of torrid zone origin, all are impatient at cold environment, and 0 ℃～12 ℃ promptly damage.Therefore, need badly from the strong plant of other cold resistance and excavate genes involved.China is one of species diversity is the abundantest in the world country and origin center of staple crop; Not only the plant genetic resources kind is many; And many are the wild species that adapt to abominable extreme environment; These species have remarkable advantages at aspects such as cold-resistant, drought resisting and salt tolerant alkali, are current and basis the future of agriculture Sustainable development.Sheep's hay has another name called the alkali grass, is one of important edificato on Eurasia grassland region east meadow steppe and the arid grassland.Sheep's hay is the Gramineae per nnial herb, has the very flourishing underground horizontal rhizome of walking, and root can reach 1 meter～1.5 meters deeply, mainly is distributed in the soil layer more than 20 centimetres.Cold-resistant, the drought resisting of sheep's hay, salt tolerant alkali, anti-soil are barren, and accommodation is very wide, accounts for the song-Nen plain well-grown of annual half the time at soil freezing.Sheep's hay has certain application value with the clone and the functional analysis of anti-cold related gene to the cold resistance aspect that improves farm crop and cash crop.

For a long time, people have carried out a lot of researchs from physiology, biochemistry, metabolism, ecology and heredity, evolution equal angles to the cold mechanism of coercing of plant responding, have accumulated rich knowledge.In recent years; Along with development of molecular biology; People have further deepened the understanding to cold resistance of plant mechanism on genomic constitution, expression regulation and signal conduction equimolecular level, for the cold resistance that utilizes gene engineering method improvement plant can provide solid basis.Because the complicacy of plant stress-resistance proterties adopts traditional breeding method to improve the cold resistance ten minutes difficulty of plant.Gene engineering method such as transgenic provide effective way for the cold resistance of plant breeding, but efficiently the separation of anti-cold gene is the engineered key factor of restriction cold resistance of plant.

The plant cold resistance is regulated and control by polygene, make numerous functional genes to plant stress-resistance proterties generation effect coordinate to play a role, and could effectively improve the plant cold resistance.Because an anti-cold associated transcription factor can be regulated and control a plurality of expression of gene, therefore strengthens the effect of a transcription factor, and the cold resistance shape of plant is comprehensively improved.

Summary of the invention

An object of the present invention is to provide albumen relevant and encoding sox thereof with plant frigostabile property.

The albumen relevant provided by the present invention with plant frigostabile property, name is called LcWRKY5, derives from sheep's hay (Leymus chinensis), is (a) or protein (b) as follows:

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with resistance by (a) deutero-protein.

Sequence 1 is made up of 328 amino-acid residues in the sequence table.

For the ease of the purifying of LcWRKY5, label as shown in table 1 on proteinic N-terminal that can the amino acid residue sequence of sequence 1 is formed in by sequence table or C-terminal connect.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag?II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned b) but in the LcWRKY5 synthetic, also can synthesize its encoding sox earlier, carry out biology again and express and to obtain.Above-mentioned b) encoding sox of the LcWRKY5 in can be through the codon that in the dna sequence dna shown in 5 ' terminal the 1st the-the 984th bit base, lacks one or several amino-acid residue with sequence in the sequence table 2; And/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

Said and encoding sox plant frigostabile property GAP-associated protein GAP also belongs to protection scope of the present invention.

Said and encoding sox plant frigostabile property GAP-associated protein GAP are following 1)-4) in arbitrary described gene:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 1st the-the 984th Nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the gene of encoding said proteins;

4) with 1) or 2) or 3) gene have homology and the gene of encoding said proteins more than 90%.

Above-mentioned stringent condition can be with 6 * SSC, and the solution of 0.5%SDS 65 ℃ of hybridization down, is used 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.

Sequence 2 in the sequence table is by 987 based compositions, and its open reading frame (ORF) is that encoding amino acid sequence is the albumen shown in the sequence 1 in the sequence table from 5 ' terminal the 1st the-the 984th bit base.

The expression cassette, recombinant expression vector, transgenic cell line or the reorganization bacterium that contain the encoding sox of said and plant frigostabile property GAP-associated protein GAP also belong to protection scope of the present invention.

Said recombinant expression vector is between the MCS of p3301-121 carrier, to insert the said recombinant expression vector that obtains with encoding sox plant frigostabile property GAP-associated protein GAP;

Said p3301-121 carrier is to obtain through the method that comprises the steps:

(1) with pCAMBIA3301 carrier process HindIII and EcoRI double digestion, reclaims the big fragment of carrier;

(2) with pBI121 carrier process HindIII and EcoRI double digestion, reclaim the fragment that comprises gus gene;

(3) the big fragment of carrier that reclaims in the step (1) is connected with the fragment that comprises gus gene of recovery in the step (2), obtains recombinant vectors p3301-121.

Said pCAMBIA3301 carrier is available from CAMBIA company; Said pBI121 carrier is available from Clontech company.

Said reorganization bacterium is a recombination microzyme.

Increase encoding sox total length or its arbitrary segmental primer of said and plant frigostabile property GAP-associated protein GAP to also belonging to protection scope of the present invention.

Said primer centering, a primer sequence is shown in sequence in the sequence table 3, and another primer sequence is shown in sequence in the sequence table 4.

Another object of the present invention provides a kind of method of cultivating transgenic plant.

The method of cultivation transgenic plant provided by the present invention is that said encoding sox with plant frigostabile property GAP-associated protein GAP is imported in the purpose plant, obtains the transgenic plant that low temperature tolerance ability is higher than the purpose plant.

Said is to import in the purpose plant through said recombinant expression vector with encoding sox plant frigostabile property GAP-associated protein GAP.

Said purpose plant is dicotyledons or monocotyledons; Said dicotyledons is an Arabidopis thaliana;

Said low temperature is 0 ℃ or 4 ℃.

The invention provides a sheep's hay LcWRKY5 transcription factor and encoding sox thereof.Experiment showed, that LcWRKY5 has tissue expression specificity, expressed by low temperature induction, can participate in the response of sheep's hay, improve the resistance of plant multiple environment stress.LcWRKY5 and encoding sox thereof have important theory and practical significance for sheep's hay and other neies variety of plant of cultivating the lower temperature resistance raising; Can be used for the cultivation and the evaluation of the required resistance plant kind of husbandry and ecological environment treatment, have higher actual application value.

Description of drawings

Fig. 1 is the agarose gel electrophoresis detected result through the total RNA of chinense seedlings of 4 ℃ of subzero treatment.

Fig. 2 is the agarose gel electrophoresis detected result of pcr amplification LcWRKY5 full length gene cDNA.

Fig. 3 is the abduction delivering result of LcWRKY5 gene under various abiotic stress treatment condition.

Fig. 4 is the abduction delivering result of LcWRKY5 gene under various HORMONE TREATMENT conditions.

Fig. 5 is the tissue specific expression analytical results of LcWRKY5 gene.

Fig. 6 is the assorted checking of yeast list LcWRKY5 gene transcription mobilizing function result.

Fig. 7 is the growing state that changes LcWRKY5 gene Arabidopis thaliana under the low temperature stress treatment condition.

Fig. 8 is the building process figure of recombinant expression vector p3301-121-LcWRKY5.

Fig. 9 is the building process figure of p3301-121 carrier.

Figure 10 is for changeing the PCR qualification result of LcWRKY5 gene Arabidopis thaliana plant.

Embodiment

Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.

Used material, reagent etc. like no specified otherwise, all can obtain from commercial sources among the following embodiment.

Embodiment 1, the albumen relevant and the acquisition and the functional verification of encoding sox thereof with plant frigostabile property

One, the albumen relevant and the acquisition of encoding sox thereof with plant frigostabile property

1, the extraction of vegetable material processing and total RNA

With sheep's hay (lucky giving birth to No. one is available from Jisheng Improved Variety Station of Aneurolepidium Chinense, Jilin Province) seedling is material, handles for 4 ℃ and extracts total RNA after 2 hours, carries out 1% agarose gel electrophoresis and detects, and the result is as shown in Figure 1.The RNA that is extracted has two tangible electrophoretic bands, is followed successively by 28S RNA and 18S RNA from top to bottom, shows to have obtained higher, the more complete total RNA of purity.

2, the acquisition of sheep's hay LcWRKY5 full length gene cDNA sequence and PCR detect

Obtain 3 ' terminal sequence of sheep's hay WRKY transcription factor by GS-FLX 454 (being called for short 454) order-checking.On NCBI, carry out the BLAST comparison with the WRKY transcription factor that obtains 3 ' end cDNA sequence; Find that its homologous gene is very conservative at 5 ' end; So according to its homologous gene translation initiation Position Design upstream primer LcWRKY5F:5 '-ATGGAAACGGCGCGGTGGT-3 '; According to the WRKY transcription factor that obtains 3 ' end cDNA sequences Design downstream primer LcWRKY5R:5 '-CTAATAATCCGGCAGCTTCCGCA-3 '; Total RNA of the chinense seedlings of 4 ℃ of processing of warp of extracting with step 1 is a template, adopts takara company's reverse transcription test kit and reference reagent box specification sheets, and its first chain cDNA is synthesized in reverse transcription.Reaction system and condition are following: 1 μ l RNA, and 1 μ l Oligo dT Primer (50 μ M),

Buffer, 0.5 μ l RNase Inhibitor (40U/ μ l), 1 μ l dNTP Mix (10mM), 1 μ l RTase (200U/ μ l), 11.5 μ l RNase free dH ₂O; 65 ℃ of 2min, 2min on ice, 42 ℃ of 1.5h, 72 ℃ of 7min.

The first chain cDNA to obtain is a template, primer LcWRKY5F and primer LcWRKY5R pairing carrying out pcr amplification; The PCR reaction system is: 1 μ l50X HIFI Polymerase (Beijing Quanshijin Biotechnology Co., Ltd); 33.5 μ l PCR-Grade Water; 5 μ l 10X HIFI Polymerase Buffer II, 4 μ l dNTP Mix (10mM), 2 μ lLcWRKY5F; 2 μ l primer LcWRKY5R, 2.5 μ lcDNA templates; Reaction conditions is: first 94 ℃ of 30s, 60 ℃ of 30s then, 72 ℃ of 90s, totally 35 circulations; Last 70 ℃ are extended 10min.

After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result is as shown in Figure 2.Wherein, swimming lane M is the dna molecular amount standard of DL2000DNA molecular weight standard (Beijing Quanshijin Biotechnology Co., Ltd), and swimming lane 1 is a pcr amplification product, the result shows, has obtained the purpose fragment that length is about 990bp through pcr amplification.Reclaim and purified pcr product; Be connected on the PMD-18T carrier (available from TaKaRa company), connect product transformed into escherichia coli DH5 α competent cell, screening positive clone carries out bacterium liquid PCR to be identified; The plasmid that extracts positive colony checks order, and sequencing result is carried out the BLAST compare of analysis.The result shows that this segmental length is 987bp, and this fragment is identical with 3 ' terminal sequence of the sheep's hay WRKY transcription factor of above-mentioned acquisition at 3 ' end, shows that this fragment possibly be the encoding sox of sheep's hay WRKY transcription factor.Splicing obtains the full length cDNA sequence of LcWRKY5 gene by Contig software, and its nucleotide sequence is shown in sequence in the sequence table 2.Sequence 2 is its encoding sequence by 987 based compositions from 5 ' the 1st the-the 984th at end in the sequence table, and coding has the protein of the amino acid residue sequence shown in the sequence 1 in the sequence table.Sequence 1 is made up of 328 amino-acid residues in the sequence table.With this unnamed gene is LcWRKY5, with its encoded protein called after LcWRKY5.

Two, the expression pattern analysis of LcWRKY5 gene under different abiotic stress and HORMONE TREATMENT condition

With the normal growth sheep's hay in 9 weeks (lucky giving birth to No. one; Available from Jisheng Improved Variety Station of Aneurolepidium Chinense, Jilin Province) seedling carries out following processing respectively: different abiotic stress are handled: handled respectively 3 hours under low temperature (4 ℃), high salt (400mM NaCl), high temperature (42 ℃) and arid (20%PEG) condition, establish simultaneously without any chinense seedlings of coercing processing to contrasting (CK); Different HORMONE TREATMENT: 100 μ M 6-benzyladenines (BAP), 100 μ M ethrels (ETH), 100 μ M Whitfield's ointments (SA), 100 μ M methyl jasmonates (MJ), 100 μ M Plant hormones regulators,gibberellins (GA) and 100 μ M dormins (ABA) were handled respectively 6 hours, established simultaneously without any chinense seedlings of coercing processing to be contrast (CK).Extract total RNA of above-mentioned processing chinense seedlings respectively, use the LcWRKY5 gene primer respectively:

LcRKY5-1:5 '-ACGCTAACCAGAGTTTCGC-3 ' with

LcWRKY5-2：5′-AGGAGTTGACGGAGATGGA?3′；

With the Actin gene is confidential reference items, and primer sequence is: Actin-1:5 '-TGGACTCTGGTGATGGTGTGAG-3 ' and Actin-2:5 '-GTGCTAAGGGAGGCAAGGATG-3 ', through RT-PCR (94 ℃ of 4min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 25 circulations) expression pattern of methods analyst LcWRKY5 gene under different abiotic stress and HORMONE TREATMENT condition, result such as Fig. 3 and shown in Figure 4.The result shows that the LcWRKY5 gene has certain constitutive expression, but its transcriptional level is induced by low temperature (4 ℃), arid (20%PEG) and ethrel (ETH) obviously.

Three, the tissue specific expression analysis of LcWRKY5 gene

Extract total RNA of root, rhizome, stem, leaf and five kinds of tissues of leaf sheath of the chinense seedlings in normal growth 9 week respectively.Use the LcWRKY5 gene primer respectively:

LcRKY5-1:5 '-ACGCTAACCAGAGTTTCGC-3 ' with

LcRKY5-3：5′-AGGAGTTGACGGAGATGGA-3′；

With the Actin gene is confidential reference items, and primer sequence is Actin-1 and Actin-2, through RT-PCR (94 ℃ of 4min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 25 circulations) carry out semi-quantitative analysis.The result is as shown in Figure 5.The result shows that the LcWRKY5 gene more obviously expresses in the root of chinense seedlings and leaf, the expression in rhizome, stem and leaf sheath is not obvious.

Four, the assorted checking of yeast list LcWRKY5 gene transcription mobilizing function

LcWRKY5 gene design primer with above-mentioned steps one amplification obtains adds Ecor I and SalI restriction enzyme site, and primer sequence is following:

Primer 1:5 '-CG GAATTCATGGAAACGGCGCGGTGGTC-3 ' (underscore partly is the EcoRI restriction enzyme site),

Primer 2: 5 '-GC GTCGACCTAATAATCCGGCAGCTTCC-3 ' (underscore partly is the SalI restriction enzyme site),

With the LcWRKY5 gene shown in the sequence 2 in the sequence table of synthetic is template, carries out pcr amplification, and amplified production is cut through EcoRI and BamHI enzyme, reclaims the LcWRKY5 gene fragment after enzyme is cut; Simultaneously, cut Yeast expression carrier pBridge-BD (Clotech company), reclaim the big fragment of carrier with EcoRI and SalI enzyme; The big fragment of carrier that reclaims is connected with LcWRKY5 gene fragment after the enzyme of recovery is cut, obtains the purpose plasmid.The purpose plasmid is changed in the intestinal bacteria; Resistance screening, the picking positive colony carries out liquid culture with positive colony; Extract the positive colony plasmid and carry out sequence verification; Sequencing result is illustrated in and has inserted the LcWRKY5 gene fragment shown in the 1st to 984 of the sequence 2 in the sequence table between EcoRI and the SalI restriction enzyme site of carrier pBridge-BD, proves that plasmid construction is correct, with the recombinant vectors called after pBridge-LcWRKY5 that obtains.It is (available from U.S. Clontech company that recombinant vectors pBridge-LcMYB13355 is imported to the yeast AH109 strain that contains His3 and LacZ reporter; Cat. no K1612-1) in; Change Yeast expression carrier pBridge-BD over to yeast AH109 strain system as changeing empty carrier contrast (CK-) simultaneously, change pGAL4 (available from U.S. Clontech company) over to yeast AH109 strain system as over against shining (CK+).

The transgenic yeast bacterium is cultivated on the SD substratum (SD/-His-Trp) that does not contain Histidine (His) and tryptophane (Trp), and the back shows blue analysis with betagalactosidase activity filter paper then.The result is as shown in Figure 6.Among Fig. 6 a represent to change the yeast strain (WRKY5) of LcWRKY5 gene, over against the yeast strain (CK+) of photograph and change empty carrier contrast yeast strain (CK-) and lacking the selection substratum upgrowth situation of Histidine and tryptophane; B uses the situation after the Z-buffer that contains X-gal develops the color, (betagalactosidase activity filter paper analysis) for the yeast of a among Fig. 6 among Fig. 6.The position of each yeast strain among c indication a and the b among Fig. 6.The result shows; Change empty carrier contrast yeast strain (CK-) and do not containing on the SD substratum of His and Trp and can not grow, and change the yeast strain (WRKY5) of LcWRKY5 gene and can not contain growth and apparent blueness on the SD substratum of His and Trp over against the yeast strain (CK+) of photograph.The result shows that the LcWRKY5 gene has transcriptional activation activity.

The lower temperature resistance analysis of embodiment 2, commentaries on classics LcWRKY5 gene Arabidopis thaliana plant

One, obtains to change LcWRKY5 gene Arabidopis thaliana plant

The LcWRKY5 gene design primer that 1 amplification obtains according to the foregoing description adds BamHI and SmaI restriction enzyme site, and primer sequence is following:

Primer 3:CG GGATCCATGGAAACGGCGCGGTGGTCG (underscore is the BamHI site) (sequence 3 in the sequence table),

Primer 4:TCC CCCGGGATAATCCGGCAGCTTCCGCAGG (underscore is the SmaI site) (sequence 4 in the sequence table),

With the LcWRKY5 gene shown in the sequence 2 in the sequence table of synthetic is template, carries out pcr amplification, and the PCR product cloning that amplification obtains is gone into pMD19-T Simple (TaKaRa company) carrier, called after pMD19-LcWRKY5.Utilize BamHI and SmaI to carry out double digestion pMD19-LcWRKY5; Reclaim the fragment of about 1kb; Use BamHI and the big fragment of SmaI double digestion p3301-121 carrier recovery simultaneously, the big fragment of carrier that reclaims is connected with the LcWRKY5 gene fragment of about 1kb of recovery, obtain the purpose plasmid.The purpose plasmid is changed in the intestinal bacteria; Resistance screening, the picking positive colony carries out liquid culture with positive colony; Extract the positive colony plasmid and carry out sequence verification; Sequencing result is illustrated in and has inserted the LcWRKY5 gene fragment shown in the 1st to 984 of the sequence 2 in the sequence table between BamHI and the SmaI restriction enzyme site of carrier p3301-121, proves that plasmid construction is correct, with the plant binary expression vector that the LcWRKY5 gene complete is read frame that contains that obtains; Called after p3301-121-LcWRKY5, building process is as shown in Figure 8.The plant expression vector p3301-121-LcWRKY5 that builds changes Agrobacterium EHA105 (available from Beijing Baeyer enlightening Bioisystech Co., Ltd) over to through freeze-thaw method; Carry out the Herbicid resistant screening, the picking positive colony carries out liquid culture with positive colony; Contaminate the Arabidopis thaliana inflorescence with positive colony bacterium liquid and carry out the Arabidopis thaliana conversion; Transform the dark cultivation in back 2 days, carry out the second time and contaminate, normal cultured is to the results seed then.The seed of results carries out resistance screening containing on the flat board of weedicide (1/2MS+10mg/L Glufosinate ammonium); Screen positive seedling; Results seed (T1), the seed of results is planted containing on the flat board of weedicide, and the screening offspring separates than the strain system that is 3: 1; Gather in the crops its seed (T2), (T3) does degeneration-resistant experiment with its seedling.According to the method that obtains to change LcWRKY5 gene Arabidopis thaliana,, obtain changeing empty carrier contrast Arabidopis thaliana plant with empty carrier p3301-121 arabidopsis thaliana transformation plant.The transgenic arabidopsis seedling that is used for doing degeneration-resistant experiment is template with the transgenic arabidopsis seedling with the genomic dna that changes empty carrier contrast Arabidopis thaliana plant respectively all through the PCR detection, and the primer that PCR detects use is above-mentioned primer 3 and primer 4.

The PCR detected result is shown in figure 10 (among Figure 10; Swimming lane 1-5 is different transgenic line; 6 for changeing empty carrier contrast Arabidopis thaliana plant, and M is trans plus 2000Marker), visible from Figure 10; Different transgenic lines all increases and to have obtained the fragment that length is about 984bp, and changes empty carrier contrast Arabidopis thaliana plant this fragment that do not increase.With same primer wild-type Arabidopis thaliana plant is carried out PCR and detect, do not obtain above-mentioned amplified fragments.This result shows that transgenic line is all positive.

Said p3301-121 carrier is to obtain through the method that comprises the steps:

(1), reclaims the big fragment of carrier of 11246bp with pCAMBIA3301 carrier (available from CAMBIA company) process HindIII and EcoRI double digestion;

(2) (contain 35S promoter, gus reporter gene Tnos) also passes through HindIII and EcoRI double digestion, reclaims the fragment of the 2942bp that comprises gus gene with pBI121 carrier (available from Clontech company);

(3) the middle fragment that comprises gus gene that reclaims of big fragment of carrier that reclaims in the step (1) and step (2) is connected through the T4DNA enzyme, obtains recombinant vectors p3301-121 (Fig. 9).

Two, change the cold resistance analysis of LcWRKY5 gene Arabidopis thaliana plant

The seed of the commentaries on classics LcWRKY5 gene Arabidopis thaliana plant that above-mentioned steps one is obtained, the seed and the wild-type Arabidopis thaliana seed that change empty carrier contrast Arabidopis thaliana plant are planted respectively in containing on the weedicide substratum (1/2MS+10mg/L Glufosinate ammonium); (growth conditions is: temperature is 22-24 ℃ to germination and growth; Illumination-8 in the 16 hours hour dark photoperiod, atmospheric moisture is 60%-80%) after the week, be transplanted in the soil; (culturing room's culture condition: temperature is 22-24 ℃ in culturing room's cultivation; Illumination-8 in the 16 hours hour dark photoperiod, atmospheric moisture is 50-60%) after the week, carry out low temperature stress at 0 ℃ and handle.Coerce processing and begin to observe phenotype after 4 hours, observe to coerce and handled the 7th day.Meter is in the time of the 7th day when handling beginning from coercing, and wild-type Arabidopis thaliana plant has 95% plant blade dehydration wilting symptom to occur, leaf color deepening yellow-green colour, and shrinkage (A among Fig. 7); Have 90% plant strain growth normal and change LcWRKY5 gene Arabidopis thaliana seedling plant, blade dehydration wilting symptom (B among Fig. 7) do not occur, it is consistent with the phenotype of wild-type Arabidopis thaliana plant to change empty carrier contrast Arabidopis thaliana plant.With the commentaries on classics LcWRKY5 gene Arabidopis thaliana plant after the low temperature stress processing, put into and recover growth 14 days under the normal growth condition, observe the plant phenotype, 95% plant all grows normally; And after will changeing empty carrier adjoining tree and the processing of wild-type plant low temperature stress, put into and recover growth 14 days under the normal growth condition, all can not restore normal growth.3 repetitions are established in experiment, and the result is all with above-mentioned consistent.This experimental result shows that changeing LcWRKY5 gene Arabidopis thaliana compares with the wild-type Arabidopis thaliana with changeing empty carrier contrast Arabidopis thaliana, has stronger low temperature tolerance ability.

Claims (10)

1. albumen is (a) or protein (b) as follows:

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with plant frigostabile property by (a) deutero-protein.

2. the said proteic encoding sox of claim 1.

3. encoding sox according to claim 2 is characterized in that: said proteic encoding sox is following 1)-4) in arbitrary described gene:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 1st to the 984th Nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the gene of encoding said proteins;

4) with 1) or 2) or 3) gene have homology and the gene of encoding said proteins more than 90%.

4. the expression cassette, recombinant expression vector, transgenic cell line or the reorganization bacterium that contain claim 2 or 3 said encoding soxs.

5. recombinant expression vector according to claim 4 is characterized in that: said recombinant expression vector is between the MCS of p3301-121 carrier, to insert the recombinant expression vector that said encoding sox obtains;

Said p3301-121 carrier is to obtain through the method that comprises the steps:

(1) with pCAMBIA3301 carrier process HindIII and EcoRI double digestion, reclaims the big fragment of carrier;

(2) with pBI121 carrier process HindIII and EcoRI double digestion, reclaim the fragment that comprises gus gene;

(3) the big fragment of carrier that reclaims in the step (1) is connected with the fragment that comprises gus gene of recovery in the step (2), obtains recombinant vectors p3301-121.

6. reorganization bacterium according to claim 4 is characterized in that: said reorganization bacterium is a recombination microzyme.

7. amplification claim 2 or 3 said encoding sox total lengths or its arbitrary segmental primer are right, said primer centering, and a primer sequence is shown in sequence in the sequence table 3, and another primer sequence is shown in sequence in the sequence table 4.

8. a method of cultivating transgenic plant is that claim 2 or 3 described encoding soxs are imported in the purpose plant, obtains the transgenic plant that low temperature tolerance ability is higher than said purpose plant.

9. method according to claim 8 is characterized in that: claim 2 or 3 described encoding soxs are to import in the purpose plant through claim 4 or 5 described recombinant expression vectors.

10. it is characterized in that according to Claim 8 or the method described in 9:

Said purpose plant is dicotyledons or monocotyledons; Said dicotyledons is an Arabidopis thaliana;

Said low temperature is 0 ℃ or 4 ℃.

Images