CN108341858B - Application of rice gene OsNAR2.1 in drought resistance - Google Patents
Application of rice gene OsNAR2.1 in drought resistance Download PDFInfo
- Publication number
- CN108341858B CN108341858B CN201810175624.5A CN201810175624A CN108341858B CN 108341858 B CN108341858 B CN 108341858B CN 201810175624 A CN201810175624 A CN 201810175624A CN 108341858 B CN108341858 B CN 108341858B
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- drought resistance
- seq
- water
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of a rice gene OsNAR2.1 in drought resistance, and belongs to the field of genetic engineering. The cDNA sequence of the rice gene OsNAR2.1 is SEQ ID NO.1 and the coded amino acid sequence thereof is SEQ ID NO. 2. The gene function of the invention is reported in rice for the first time, the knock-out mutation of the gene can obviously reduce the drought resistance of rice, the over-expression of the gene can obviously improve the water utilization efficiency and the photosynthesis utilization efficiency of rice under the condition of water stress, and the drought resistance of rice is increased.
Description
Technical Field
The invention discloses application of a rice gene OsNAR2.1 in drought resistance, and belongs to the field of genetic engineering.
Background
Rice (Oryza sativa L.) is staple food for more than half of the world's population and requires ever increasing rice yields to meet the increasing food demand brought by future population growth. In many agricultural areas, drought is two major limiting environmental factors for photosynthesis and plant growth (Sharp, r.e., Poroyko, v., Hejlek, l.g., Spollen, w.g., Springer, g.k., Bohnert, h.j., nguyen.h.t.root growth main water details: physiology to functional genetics.j.exp.bot.2004.55, 2343-2351). Biotic stress, particularly drought, is an important limiting factor for plant growth, development and agricultural production. Some studies have shown that drought stress strongly affects growth and nitrogen metabolism (Allahverdiyev, T. (2016) Impact of soil water specific on soil physical genetic parameters of durum and broken wheat genetic types, Agricult forest.62, 131-144).
The conventional cultivated rice is mostly in a flooded environment, and drought is one of the main factors limiting the rice production. The improvement of the utilization rate of the water in the rice is a main concern in the agricultural production system of water-saving irrigation (Linxianxian, Zhouweijun, Zhudeleng, and the like. the influence of the water management mode of the rice on the photosynthetic rate and the water utilization efficiency of the rice. China Rice science, 2004,18(4): 333-. In some plants such as cotton and canola, nitrogen application may promote drought resistance to some extent (Pan, x., Lada, r.r., Caldwell, c.d., Falk, k.c.water-stress and N-nutrition effects on photosyntheses and growth of Brassica carina. photosynthesia.2011.49, 309-315). OsNAR2.1 plays an important role in the way that rice absorbs nitrate, and we find that rice over-expression OsNAR2.1 can obviously improve the photosynthetic efficiency, the water utilization efficiency and the drought resistance of rice under the condition of water stress.
Disclosure of Invention
The invention aims to provide a sequence of a rice gene OsNAR2.1 and application thereof, wherein the gene can be used as a target gene to be over-expressed in rice, and can improve the photosynthetic efficiency, the water utilization efficiency and the drought resistance of the rice under the condition of water stress.
The invention provides a rice gene OsNAR2.1, the nucleotide sequence of which is SEQ ID NO.1 and is 621bp in total. The gene expression product is rice high-affinity nitrate transport protein OsNAR2.1, the amino acid sequence of which is SEQ ID NO.2, and the total number of amino acids is 206. The gene engineering of OsNAR2.1 can be applied to the aspects of improving the photosynthetic efficiency, the water utilization efficiency and the drought resistance of rice under the condition of water stress of the rice.
The nucleotide sequence is the overexpression vector of the rice OsNAR2.1 gene shown in SEQ ID NO. 1.
Application of rice OsNAR2.1 gene with nucleotide sequence shown in SEQ ID NO.1 in improving plant drought resistance.
The application of the rice OsNAR2.1 gene with the nucleotide sequence shown in SEQ ID NO.1 in increasing the water utilization efficiency and the photosynthetic rate of rice under drought stress and increasing the drought resistance of rice.
Has the advantages that:
1. the invention discloses a rice high-affinity nitrate transport protein gene OsNAR2.1 sequence and a protein coded by the same. qRT-PCR expression analysis showed that the OsNAR2.1 gene was strongly expressed by 10% PEG (FIG. 1).
2. The inventor firstly discloses the function of the rice gene OsNAR2.1 in drought resistance, and the rice gene OsNAR2.1RNAi mutant strain has a severe water shortage phenotype when Nipponbare Wild Type (WT), OsNAR2.1RNAi mutant strain (r1, r2) and OsNAR2.1 overexpression strain (Ox1, Ox2) (figure 2) water supply is stopped for 11 days; when the water supply is stopped for 12 days, the wild type of Nipponbare is found to have a phenotype of severe water shortage; then we resumed the water supply, and 7 days later, it was found that the wild type part of Nipponbare recovered, most of the OsNAR2.1RNAi mutant lines could not be recovered, and most of the OsNAR2.1 overexpression lines could be normally grown. Then, we counted the survival rate and found that the survival rate of the wild type of Nipponbare was about 53.6%, that of the OsNAR2.1RNAi mutant strain was about 27.0%, and that of the OsNAR2.1 overexpression strain was about 90.3% (FIG. 3). The survival rate of the OsNAR2.1RNAi mutant strain is obviously lower than that of the Nipponbare wild type, and the survival rate of the OsNAR2.1 overexpression strain is obviously higher than that of the Nipponbare wild type, so that the OsNAR2.1 participates in the drought tolerance of Nipponbare rice, and the OsNAR2.1RNAi mutant strain is expected to be applied to the genetic improvement of the rice.
3. The invention discloses that under the condition of drought stress, the over-expression of OsNAR2.1 can improve the photosynthetic efficiency and the water utilization efficiency of water and can improve more seed yield for the first time. The photosynthetic rate and water utilization efficiency of flag leaves were determined, the photosynthetic rate and water utilization efficiency of the osnarr 2.1 overexpression lines were not significantly different from WT under normal water supply conditions, and the photosynthetic rate and water utilization efficiency of the osnarr 2.1 overexpression lines were increased by 39.2% and 11.8% respectively under water control conditions as compared with WT (fig. 4). In the vegetative growth stage under the water control condition, the OsNAR2.1 overexpression strain has more excellent growth parameters compared with WT, the yield of single-plant grains is increased by 28.2% under the normal water supply condition, and the yield is increased by 70.7% under the drought stress condition (figure 5).
Drawings
FIG. 1: the expression pattern analysis of OsNAR2.1 shows that the OsNAR2.1 gene is mainly expressed in roots and strongly expressed by nitrogen deficiency and 10% PEG. (a) Expression patterns of OsNAR2.1 at different parts of the seedling stage, 4 weeks of seedling age. Root, Root; B.N, rhizome junction; l.s, leaf sheath; L.B I, inverted one leaf, L.B II, inverted three leaves. (b) The response of WT root system OsNAR2.1 to nitrogen deficiency (-N), salt damage (100mM NaCl) and drought (10% PEG) was analyzed by qRT-PCR. After 72 hours of treatment, root samples were collected for qRT-PCR analysis.
FIG. 2: and (4) performing molecular identification on the transgenic strain. Southern blot identifies copy number of transgenic lines (a) osnar2.1rnai line (r1, r 2); (b) OsNAR2.1 overexpression lines (Ov199, Ov 200); (c) identifying the expression of the OsNAR2.1 of the OsNAR2.1RNAi strain (r1, r2) by qRT-PCR; (d) qRT-PCR identified the expression of OsNAR2.1 over-expression strain (Ov199, Ov 200).
FIG. 3: the transgenic plant is sensitive to drought stress in the seedling stage, the survival rate of an OsNAR2.1RNAi mutant strain is obviously lower than that of a Nipponbare wild type, the survival rate of an OsNAR2.1 overexpression strain is obviously higher than that of the Nipponbare wild type, and the OsNAR2.1 participates in the drought tolerance of Nipponbare rice. WT and transgenic line seedlings were grown for two weeks with 8 seedlings of equal size per pot under full watering. The water addition was stopped for 12 days after two weeks, followed by a further week. (a) Phenotype under drought stress. Photographs were taken at the time of irrigation stoppage (day 0), before irrigation stoppage (day 11, day 12) and one week after water supply was resumed (day 7). (b) And (6) survival rate statistics. One week after restoring the water supply, at least one seedling of fully expanded leaves was counted as a surviving seedling, and the percentage of survival was counted.
FIG. 4: growth parameters of OsNAR2.1 overexpression strains (Ox1, Ox2 and Ox3) in flowering phases under the conditions of full watering and drought stress show that the photosynthesis rate and the water utilization efficiency of rice can be remarkably improved by the overexpression OsNAR2.1 under the condition of drought stress. Under sufficient watering and water control conditions, (a) chlorophyll content, (b) relative water content, (c) photosynthetic rate and (d) water use efficiency. WW, fully watering. DR, drought stress.
FIG. 5: comparing the agronomic characters of the OsNAR2.1 overexpression strain system under the conditions of full watering and drought stress shows that the quantitative expression OsNAR2.1 can improve more rice yield under the condition of drought stress. (a) The total tillering number of a single plant, (b) the weight of a single spike, (c) the grain number of each spike, (d) the seed setting rate, (e) the yield of single plant grains and (f) the total dry weight of the single plant. WW, fully watering. DR, drought stress.
Detailed description of the preferred embodiments
Example 1 cloning of Rice Gene OsNAR2.1 sequence
1) Total RNA extraction about 0.1g of rice (Nipponbare) seedling is weighed, fully ground by liquid nitrogen, rapidly added with 1ml of Trizol, fully shaken and oscillated, and the total RNA is extracted.
2) Cloning of OsNAR2.1 Gene full Length
The NAR2.1 gene series OsNAR2.1(AP004023.2) of rice was searched from a gene database of NCBI website (http:// www.ncbi.nlm.nih.gov /). Primers (below) were designed to extract the full-length sequence of OsNAR2.1 from the tissue cDNA library.
P1:5’-CAATGGCGAGGCTAGCCGGCGTT-3’(SEQ ID NO.3)
P2:5’-CGATCTACTTGTCCTTCTTGCGCTTCT-3’(SEQ ID NO.4)
Using the total RNA obtained in step 1) as a template, synthesizing a first cDNA strand by reverse transcription, and performing PCR amplification by using high fidelity enzyme (Prime Star HS DNA polymerase from Takara), wherein the PCR program is as follows: pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, renaturation at 53 deg.C for 30s, extension at 72 deg.C for 30s, 30 cycles, and constant temperature at 72 deg.C for 5min and 4 deg.C. Agarose electrophoresis separation, cutting gel, recovering, cloning to pMD-18 vector (purchased from Takara company), and obtaining the full-length sequence (SEQ ID NO.1) of the rice high-affinity nitrate transport protein gene OsNAR2.1 with complete coding region after correct sequencing. The coded amino acid sequence is SEQ ID NO. 2.
Example 2 knockout of OsNAR2.1 Gene
1) Construction of RNAi expression vectors
1. According to the obtained rice high-affinity nitrate transport protein gene OsNAR2.1cDNA sequence, see the full-length coding sequence of SEQ ID NO.1, the sequence is compared with the cDNA sequence of OsNAR2.2(AK109571) and the whole genome sequence, and a 350bp relative OsNAR2 family specific sequence is selected. And respectively introducing restriction enzyme sites on the upstream primer and the downstream primer, and designing the primers as follows:
| primer name | Primer sequence (5 '-3') | Cleavage site |
| A1F-1F | AATAGGATCCCGTTGGTGCTCGTCTTGC(SEQ ID NO.5) | BamHI |
| A1F-1R | TTTTGGTACCGACCTTGAACTGGCACGC(SEQ ID NO.6) | KpnI |
| A1R-1F | TATTGAGCTCCGTTGGTGCTCGTCTTGC(SEQ ID NO.7) | SacI |
| A1R-1R | CCTGACTAGTGACCTTGAACTGGCACGC(SEQ ID NO.8) | SpeI |
Using the obtained cDNA clone as a template, firstly, carrying out PCR by using a pair of primers of A1R-1F and A1R-1R, wherein the PCR program comprises the following steps: pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, extension at 72 ℃ for 20s, 30 cycles, and detection at 72 ℃ for 7min after running gel. The size of the PCR product is 350bp, the PCR product is separated by agarose electrophoresis and then cut into gel for recovery, the recovered PCR product is subjected to double digestion by SacI and SpeI, and the recovered PCR product is subjected to double digestion by SacI and SpeI while pTCK303 plasmid (Wang Z, Chen CHB, Xu YY, Jiang RX, Han Y, Xu ZHH, Chong K.A positive vector for effective knock down of gene expression in rice. plant Molecular Biology reporter.200422: 409 and 417) is subjected to double digestion, then fragments and vectors are respectively recovered, the fragments and the vectors are connected at 4 ℃ overnight by T4 ligase (promega company), and are transformed into DH5 alpha escherichia coli for overnight culture at 37 ℃, positive clones are selected and sequenced; then, PCR was performed using a pair of primers, A1F-1F and A1F-1R, and the PCR program: pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 20s, 30 cycles, and detection at 72 ℃ for 7min after running gel. The size of the PCR product was 350bp, the PCR product was separated by agarose electrophoresis and recovered as a gel, after recovery, the first-step positive clone was digested with BamHI and KpnI, and simultaneously digested with BamHI and KpnI, after recovery, the clones were ligated overnight at 4 ℃ with T4 ligase (Promega corporation), heat shock-transformed into DH 5. alpha. E.coli, cultured overnight at 37 ℃, and the positive clones were selected and sequenced. Thus, a specific sequence of OsNAR2.1 was cloned into binary expression vector pTCK303(Wang Z, Chen CHB, Xu YY, Jiang RX, Han Y, Xu ZHH, Chong K.A practical vector for expression in plant Biology reporter 200422: 409) via two pairs of corresponding restriction sites, and transformed into EHA105((Xu M, Zhu L, Shou H, Wu P.A PIN1family gene, OsPIN1, immersed in infected-dependent acquired vector and infected in plant physiology 2005. Oct; 46-1674-81) after the sequencing was correct.
4) Obtaining of RNAi transgenic plants
The obtained agrobacterium transformed with the vector infects rice callus, co-cultures for 60 hours, and obtains T through selective culture, differentiation, rooting and seedling hardening0Transgenic plants are generated. The transgenic material is propagated twice to obtain T1 generation and T2 generation materials with stable inheritance.
Example 3 overexpression of OsNAR2.1 Gene
1) Construction of overexpression vectors
According to the cDNA sequence of the rice high-affinity nitrate transport protein gene OsNAR2.1, see the full-length coding sequence of SEQ ID NO.1, restriction enzyme sites BamHI are respectively introduced into upstream and downstream primers, and the design primers are as follows:
overNAR2.1-F：5’-TTAAGGATCCCAATGGCGAGGCTAGCCGGCGTT-3’(BamHI)
overNAR2.1-R：5’-CCCGGATCCCGATCTACTTGTCCTTCTTGCGCT-3’
and (3) taking the cDNA clone obtained in the second step as a template, and carrying out PCR (polymerase chain reaction) as follows: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30s, renaturation at 53 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles, and 5min at 72 ℃ after 5min, wherein the PCR product is 640 bp. After PCR amplification, the full-length coding sequence of OsNAR2.1 was cloned into pMD-18 vector (purchased from Takara Inc.), and after correct sequencing, introduced into binary Expression vector p1390(Chen TL, Lin Y L, Lee YL, Yang NS Chan MT 2004Expression of bioactive human interface-gamma in Transgenic Cell culture delivery gene Research 13: 499-510) via the corresponding cleavage site, and then transformed into EHA105(Xu M, Zhu L, Shou H, Wu P.A. PIN1 plane gene, OsPIN1, immersed in autologous-dependent acquired gene and transformed into plant Cell physiology 9, 46-16781).
2) Obtaining of overexpression transgenic plants
The obtained agrobacterium transformed with the vector infects rice callus, co-cultures for 60 hours, and obtains T through selective culture, differentiation, rooting and seedling hardening0Transgenic plants are generated. The transgenic material is propagated twice to obtain T1 generation and T2 generation materials with stable inheritance.
In view of the above, the present inventors have found that OsNAR2.1 is a very important gene in drought resistance of rice, and plant expression vectors, in which any one of promoters such as cauliflower mosaic virus (CAMV)35S promoter, Ubiquitin promoter or others may be used as a target gene, may be constructed using the OsNAR2.1 gene of the present invention, and may include enhancers, whether transcription enhancers or translation enhancers, as necessary. To simplify the identification of transformed cells, selectable markers including enzymes resistant to antibiotics, enzymes which utilize compounds recognized by a color change (e.g., B-glucuronidase GUS) or luminescence (e.g., luciferase) may be used, and marker-free selection may also be used. As the expression vector, a Ti plasmid, Ri plasmid, plant virus vector or the like can be used. Transformation methods plants can be transformed by Agrobacterium-mediated transformation, particle gun, pollen tube channel or other methods. The over-expression of the gene can improve the water utilization efficiency and the photosynthetic rate of the rice under drought stress and increase the drought resistance of the rice.
Sequence listing
<110> Nanjing university of agriculture
Application of <120> rice gene OsNAR2.1 in drought resistance
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 621
<212> DNA
<213> Rice (Oryza sativa)
<400> 1
atggcgaggc tagccggcgt tgctgctctc tcgttggtgc tcgtcttgct cggcgccggc 60
gtgccccggc cggcggccgc cgccgcggcg aagacgcagg tgttcctctc caagctgccc 120
aaagcgctcg tcgtcggcgt ctcgcccaag cacggtgaag tcgtgcacgc cggcgagaac 180
acggtgacgg tgacgtggtc gctgaacacg tcggagccgg cgggcgccga cgcggcgttc 240
aagagcgtga aggtgaagct gtgctacgcg ccggcgagcc ggacggaccg cgggtggcgc 300
aaggcctccg acgacctgca caaggacaag gcgtgccagt tcaaggtcac cgtgcagccg 360
tacgccgccg gcgccggcag gttcgactac gtggtggcgc gcgacatccc gacggcgtcc 420
tacttcgtgc gcgcctacgc ggtggacgcg tccggcacgg aggtggccta cgggcagagc 480
tcgccggacg ccgccttcga cgtcgccggg atcaccggca tccacgcctc cctcaaggtc 540
gccgccggcg tcttctccac cttctccatc gccgcgctcg ccttcttctt cgtcgtcgag 600
aagcgcaaga aggacaagta g 621
<210> 2
<211> 206
<212> PRT
<213> Rice (Oryza sativa)
<400> 2
Met Ala Arg Leu Ala Gly Val Ala Ala Leu Ser Leu Val Leu Val Leu
1 5 10 15
Leu Gly Ala Gly Val Pro Arg Pro Ala Ala Ala Ala Ala Ala Lys Thr
20 25 30
Gln Val Phe Leu Ser Lys Leu Pro Lys Ala Leu Val Val Gly Val Ser
35 40 45
Pro Lys His Gly Glu Val Val His Ala Gly Glu Asn Thr Val Thr Val
50 55 60
Thr Trp Ser Leu Asn Thr Ser Glu Pro Ala Gly Ala Asp Ala Ala Phe
65 70 75 80
Lys Ser Val Lys Val Lys Leu Cys Tyr Ala Pro Ala Ser Arg Thr Asp
85 90 95
Arg Gly Trp Arg Lys Ala Ser Asp Asp Leu His Lys Asp Lys Ala Cys
100 105 110
Gln Phe Lys Val Thr Val Gln Pro Tyr Ala Ala Gly Ala Gly Arg Phe
115 120 125
Asp Tyr Val Val Ala Arg Asp Ile Pro Thr Ala Ser Tyr Phe Val Arg
130 135 140
Ala Tyr Ala Val Asp Ala Ser Gly Thr Glu Val Ala Tyr Gly Gln Ser
145 150 155 160
Ser Pro Asp Ala Ala Phe Asp Val Ala Gly Ile Thr Gly Ile His Ala
165 170 175
Ser Leu Lys Val Ala Ala Gly Val Phe Ser Thr Phe Ser Ile Ala Ala
180 185 190
Leu Ala Phe Phe Phe Val Val Glu Lys Arg Lys Lys Asp Lys
195 200 205
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
caatggcgag gctagccggc gtt 23
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgatctactt gtccttcttg cgcttct 27
<210> 5
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aataggatcc cgttggtgct cgtcttgc 28
<210> 6
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ttttggtacc gaccttgaac tggcacgc 28
<210> 7
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tattgagctc cgttggtgct cgtcttgc 28
<210> 8
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cctgactagt gaccttgaac tggcacgc 28
Claims (2)
1. Rice with nucleotide sequence shown as SEQ ID NO.1OsNAR2.1The gene is applied to improving the drought resistance of rice.
2. The use according to claim 1, wherein the nucleotide sequence is rice represented by SEQ ID NO.1OsNAR2.1The gene is applied to the aspects of increasing the water utilization efficiency and the photosynthetic rate of rice under drought stress and increasing the drought resistance of the rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810175624.5A CN108341858B (en) | 2018-03-02 | 2018-03-02 | Application of rice gene OsNAR2.1 in drought resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810175624.5A CN108341858B (en) | 2018-03-02 | 2018-03-02 | Application of rice gene OsNAR2.1 in drought resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108341858A CN108341858A (en) | 2018-07-31 |
| CN108341858B true CN108341858B (en) | 2021-02-26 |
Family
ID=62959121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810175624.5A Active CN108341858B (en) | 2018-03-02 | 2018-03-02 | Application of rice gene OsNAR2.1 in drought resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108341858B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111850000B (en) * | 2018-03-02 | 2022-05-27 | 南京农业大学 | Application of recombinant expression vector containing rice gene OsNAR2.1 and promoter thereof |
| CN108977460B (en) * | 2018-08-15 | 2021-11-16 | 中国农业科学院深圳农业基因组研究所 | Recombinant expression vector and application thereof in increasing rice yield and reducing cadmium concentration |
| CN112321695B (en) * | 2020-12-03 | 2021-09-07 | 华中农业大学 | Application of OsSEC3B gene in controlling drought resistance of rice |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101351556A (en) * | 2005-11-07 | 2009-01-21 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and a method for making the same |
| WO2017107983A1 (en) * | 2015-12-24 | 2017-06-29 | Nanjing Agricultural University | Method for increasing nitrogen-use efficiency in plants |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2008252998A1 (en) * | 2007-05-22 | 2008-11-27 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance and/or resistance to environmental stress and increased biomass production-KO |
| CN101397565B (en) * | 2008-11-12 | 2011-01-26 | 南京农业大学 | Rice high affinity nitrate transport protein gene OsNAR2.1 |
| KR20160025822A (en) * | 2014-08-28 | 2016-03-09 | 동아대학교 산학협력단 | OsNRT1 gene from Oryza sativa for improving nitrogen availability of plant and uses thereof |
| CN111850000B (en) * | 2018-03-02 | 2022-05-27 | 南京农业大学 | Application of recombinant expression vector containing rice gene OsNAR2.1 and promoter thereof |
-
2018
- 2018-03-02 CN CN201810175624.5A patent/CN108341858B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101351556A (en) * | 2005-11-07 | 2009-01-21 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and a method for making the same |
| WO2017107983A1 (en) * | 2015-12-24 | 2017-06-29 | Nanjing Agricultural University | Method for increasing nitrogen-use efficiency in plants |
Non-Patent Citations (2)
| Title |
|---|
| pOsNAR2.1:OsNAR2.1 expression enhances nitrogen uptake efficiency and grain yield in transgenic rice plants;Jingguang Chen等;《Plant Biotechnology Journal》;20170329;第15卷(第10期);第1273–1283页 * |
| 硝酸盐高亲和水稻品种的筛选与硝酸盐高亲和基因表达分析;赖灯妮等;《湖南农业大学学报(自然科学版)》;20091231;第35卷(第06期);第593-596页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108341858A (en) | 2018-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2558745T3 (en) | Plants that have enhanced traits related to performance and a production procedure for them | |
| Jha et al. | Cloning and characterization of the Salicornia brachiata Na+/H+ antiporter gene SbNHX1 and its expression by abiotic stress | |
| CN101173002B (en) | Plants stress tolerance correlation transcription factor GmWRKY54, encoding gene and application thereof | |
| CN102766618B (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
| CN111433363B (en) | Plants having increased abiotic stress tolerance and polynucleotides and methods for increasing abiotic stress tolerance in plants | |
| CN108341858B (en) | Application of rice gene OsNAR2.1 in drought resistance | |
| CN102994517A (en) | Rice MYB transcription factor protein gene OsMyb1 and application thereof | |
| Zhao et al. | Downregulation of SL-ZH13 transcription factor gene expression decreases drought tolerance of tomato | |
| CN111295445B (en) | Plants having increased abiotic stress tolerance, polynucleotides and methods for increasing abiotic stress tolerance in plants | |
| CN113337518B (en) | Corn ZmDnajA6 gene related to high-temperature and drought dual stress as well as vector and application thereof | |
| Pan et al. | Genome-wide identification of cold-tolerance genes and functional analysis of IbbHLH116 gene in sweet potato | |
| CN112250745A (en) | MYB21 gene for regulating and controlling bacterial leaf blight resistance of rice and application thereof | |
| CN108341857B (en) | Rice yield related protein and coding gene and application thereof | |
| CN112204144B (en) | Abiotic stress tolerant plants and methods of use | |
| CN103614385B (en) | A gene KT525 is improving the application on plant stress tolerance | |
| CN103266093A (en) | Receptor kinase albuminoid of rice brassinosteroid and coding genes and applications thereof | |
| CN111748560B (en) | Application of rice OsNRT2.1 gene in improving manganese content in rice grains | |
| KR102539626B1 (en) | Use of protein nog1 in controlling plant yield and number of grains per ear | |
| CN105624172A (en) | Genetic engineering application of rice zinc finger protein gene ZFP214 | |
| CN102477089B (en) | Plant low-temperature resistance related protein, its encoded gene and application | |
| CN111808180A (en) | Plant drought-resistant heterosis related protein TaNF-YB3, and coding gene and application thereof | |
| Huynh et al. | Isolation and characterization of a DREB homolog gene from a local drought-tolerant maize cultivar | |
| CN114196679B (en) | Application of copper ion transport protein gene OsCOPT7 in rice breeding | |
| CN114214334B (en) | Application of gene EsH2A.3 from salt mustard in regulation and control of salt tolerance of plants | |
| CN112041448B (en) | Constructs and methods related to agronomic trait altered plants and abiotic stress tolerance genes under nitrogen limiting conditions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |