CN104611338A - GhGL3 gene promoter, vector and application thereof - Google Patents

Abstract

The invention discloses a GhGL3 gene promoter, which comprises a nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2, or is obtained by virtue of substitution, deletion or addition of one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 and has the same activity as the activity of the nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2. The invention relates to a vector of the promoter, host cells and an application of the promoter or vector in cultivation of new varieties of plants. The promoter disclosed by the invention can drive specific expression of target genes in cotton fibers and epidermal hair and has significance for cultivating novel varieties of fiber plants, particularly cultivating novel varieties of cotton.

Description

GhGL3 gene promoter, carrier and application thereof

Technical field

The invention belongs to field of plant genetic, more specifically, relate to a kind of GhGL3 gene promoter, carrier and application thereof.

Background technology

China is one of country that output of cotton and consumption are the highest.Cotton originates in subtropics, is the seed hair of Malvaceae cotton platymiscium.Cotton fiber cell is by the unicellular growth of cotton seed coat, experiences the synthesis of initial, primary wall, secondary wall synthesis and four periods of ripening stage.Ripe cotton fiber white is yellow to white middle band, and be about 2 to 4 centimetres, cellulose is about 87-90%.Cotton is divided into short stapled cotton, long stapled cotton and medium staple cotton three kinds.The medium staple cotton of China accounts for 98% of output of cotton, and cultivation the most widely upland cotton belongs to thin velveteen.Therefore, the epidermal hair fibrocyte, particularly upland cotton of cotton seeds are not only the good research material of the growth of research plant monocyte and fibrin deposition, and have extremely important using value.

It is well-conserved that molecular genetics proves that the trichome development of different plant has.Arabidopis thaliana epidermal hair is a kind of unicellular epidermal structure of specialization, is distributed widely on blade, stem, lotus throne leaf, petal and root.Cotton fibre is as the unicellular epidermal hair on a kind of ovary ovule outer integument, and its growth Initiated Mechanism is similar to the Forming Mechanism of Arabidopis thaliana epidermal hair.

Verified at present, the complex body MYB-bHLH-WD40 that the startup of Arabidopis thaliana epidermal hair and Gen Mao is at least made up of three genes (GL1 (or WER)-GL3 (or EGL3)-TTG1) product promotes that the expression of GL2 and R3 class myb transcription factor (comprising TRIPTYCHON, TRY and CPC) controls.GL2 transcription factor can promote downstream gene expression to reach to promote epidermal hair initial development, suppresses the initial development of root hair.But the startup of each single-gene to epidermal hair that this model is not got rid of in them yet has promoter action.Wherein, GL1 coding R2R3 class myb transcription factor, structure and function is equivalent to WER.GhMYB109 be in cotton first be cloned into obtain R2R3 class transcription factor, express in initial sum elongating stage of cotton fiber, control the growth of cotton fiber.TTG1 mediating protein and protein interaction are the regulatory factor of forward.BHLH class transcription factor wherein in AtGL3 (NM148067) and AtEGL3 (NM202351) encoding Arabidopsis transcription complex.The two assorted experiment of yeast proves that GL3/EGL3 plays bridging effect in transcription complex, has interaction with WER, TRY, CPC and TTG.

The mrna length 2513bp of GhGL3 (GhDEL65AF336280), ORF length 1863bp, one 620 amino acid whose albumen (AAK19613.1) of encoding, have the feature of typical bHLH class transcription factor.Carry out homology analysis to the bHLH class transcription factor gene of Arabidopis thaliana and cotton, the ORF homology of GhGL3 and AtEGL3 gene is 52.1%, and amino acid sequence homology is 79.15%; The gene ORF sequence homology of GhGL3 and AtGL3 is 61%, and amino acid sequence homology is 49.38%.

According to the analysis of cotton gene group data, GL3 is on the contig1241 of the cotton Gossypiumraimondii rice chromosome of DD genome Lei Mengdeshi, and mrna length is 2513bp, comprises 8 introns; On Gossypium arboreum No. 3 chromosomal contig1205 of AA genome Asiatic cotton, mrna length is 2519bp, also comprises 8 introns.Through DNAMAN software analysis, the sequence identity of GrGL3 and GaGL3 gene reaches 97.61%.Southern blot result also shows GL3 to be existed with two copy form in AADD genome upland cotton Gossypium hirsutum.

The ORF sequence homology of GhGL3 and GaGL3 is 98%.Two genes are all encoded 620 amino acid, and wherein have 20 amino acid whose differences, Amino acid sequence identity reaches 96.45%.Can the trichome development phenotype of complement Arabidopsis mutant gl3-1 with the expression of AtGL3 promoters driven GaGL3 (GaDEL65 JN997400); Hybridization in situ experiment and qRT-PCR experimental result display GaGL3 mainly express in the fiber of cotton.Yeast two-hybrid and co-immunoprecipitation experiment prompting GaGL3 and GaMYB23 and GaTTG1 form the Fibre Development of transcription complex regulation and control Asiatic cotton.RT-PCR and qRT-PCR analyzes and finds that GhGL3 only expresses before the florescence, in florescence and the ovule that comes into bloom, and do not express in pollen and leaf, Tissue in situ hybridization finds that this gene was expressed in origin of fibers phase and elongating stage too, infer that GhGL3 is specifically expressing, the gene relevant to cotton fiber development function in ovule thus, its promotor to the initial of cotton fiber and may extend important regulating and controlling effect.

Promotor is the expression regulation element of gene, determines the activity of gene and produces any protein.Cotton fiber specifically-expressed promotor GaRDL1 promotor (Chen Xiao Asia 2006) known at present, fdh gene promoter (Zhu Yu virtuous 2011) and fifl promotor (Chen et al 2009) etc. obtain clone.But for controlling the transcription factor complex MYB-bHLH-WD40 of trichome development, the promotor of the R2R3 class transcription factor GhMYB109 of first known at present clone obtains clone, and has applied for patent, and the promotor of bHLH genoid have not been reported.

The promotor of clone GhGL3 gene can not only enrich cotton fiber specific/advantage promotor resource, and contribute to the growth studying cotton fiber and epidermal hair, also can meet the needs of the functional verification of cotton fiber development genes involved and fibrous quality transgenic breeding.

Summary of the invention

In view of this, one of main purpose of the present invention is to provide a kind of GhGL3 gene promoter, carrier and application thereof, to obtain the specific expression promoter of the plant such as cotton, Arabidopis thaliana bud fiber and epidermal hair, thus can carry out preferably the cultivation of the plant such as cotton, Arabidopis thaliana and control.

To achieve these goals, as one aspect of the present invention, the invention provides a kind of GhGL3 gene promoter, it has the nucleotide sequence as shown in SEQ ID No.1 or SEQ ID No.2, or the such as nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 is had the activity identical with the nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 through the replacement of one or more Nucleotide, disappearance or interpolation.

Wherein, the nucleotide sequence of described GhGL3 gene promoter and the nucleotide sequence shown in described SEQ ID No.1 have the homology of more than 75%, or have the homology of more than 80% with the nucleotide sequence shown in described SEQ ID No.2.

Wherein, described GhGL3 gene promoter is the promotor in arbitrary fragment of described promotor with the primer pair of amplification, and

Distance between described upstream primer and downstream primer in the 1st base of described GhGL3 gene promoter between the 4320th base, preferably between the 2313rd base to the 4320th base, the length of each primer in described primer pair is 15 to 30 bases.

And, containing, for example the carrier of the GhGL3 gene promoter described in upper any one.

Wherein, described carrier is pBI101.2-GhGL3 pro::GUS.

Wherein, after described GhGL3 gene promoter transcription is initial, add encoding sequence or the enhanser of other gene.

Wherein, in described carrier, add plant alternative mark or there is the antibiotic marker thing of resistance.

Wherein, described carrier imports vegetable cell by using particle gun, Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection or conductance technology method.

And, containing, for example the host cell of the carrier described in upper any one.

And, containing, for example the transformed plant cells of the GhGL3 gene promoter described in upper any one.

Wherein, the plant be converted described in is monocotyledons or dicotyledons.

Wherein, the plant be converted described in is cotton or Arabidopis thaliana.

As another aspect of the present invention, the GhGL3 gene promoter as above described in any one is cultivating the application in textile plant new variety.

Wherein, described plant is cotton or Arabidopis thaliana.

And, the application of the GhGL3 gene promoter expression pattern in plant tissue as above described in any one.

Wherein, described plant tissue is bud fiber and epidermal hair.

And, the application of the GhGL3 gene promoter as above described in any one on the specifically expressing of cotton fiber and epidermal hair.

Known based on technique scheme, GhGL3 gene promoter of the present invention has following effective effect: (1) promotor of the present invention can guide foreign gene to express in the plants such as cotton, will obtain transgenic cell line and transfer-gen plant that certain goal gene is expressed in cotton fiber; (2) when being building up in plant expression vector, encoding sequence or any one enhanser of any one gene can be added after its transcription initiation; (3) for the ease of identifying transgenic plant cells or plant and screening, can use carrier be processed, mark as added plant alternative or there is the antibiotic marker thing of resistance; (4) expression vector carrying promotor of the present invention imports vegetable cell by using the standard biologic technological methods such as Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, the plant host be converted both can be monocotyledons, also can be dicotyledons; (5) when promotor of the present invention be used to goal gene in cotton fibre specifically expressing or change cotton fiber quantity, qualitative character time, can following methods be adopted: be 1. cloned in plant conversion carrier by promotor of the present invention, connect thereafter the encoding sequence of goal gene; 2. constructed plant conversion carrier is transformed renewable cotton tissue (or organ) and promotor of the present invention is expressed in the tissue transformed; 3. the tissue be converted (or organ) is trained the cotton plants of needs, thus GhGL3 gene promoter of the present invention can drive goal gene specifically expressing in cotton fibre and epidermal hair, and to cultivation textile plant new variety, particularly cultivate new cotton variety significant.

Accompanying drawing explanation

Fig. 1 is that the fusion expression vector collection of illustrative plates of GhGL3 promotor of the present invention and gus gene and transfer-gen plant are identified;

Fig. 2 is GhGL3 promotor of the present invention:: gus gene is at the phenotype photo of cotton fibre initial phase to elongating stage (-1DPA-5DPA);

Fig. 3 is GhGL3 promotor of the present invention:: the phenotype photo of gus gene on cotton leaf;

Fig. 4 is GhGL3 promotor of the present invention:: the phenotype photo of gus gene on cotton plants floral organ;

Fig. 5 is the sequence alignment analysis collection of illustrative plates of GhGL3 promoter sequence of the present invention (SEQ ID No.2) and GaGL3 promotor;

Fig. 6 is the sequence alignment analysis collection of illustrative plates of GhGL3 promoter sequence of the present invention (SEQ ID No.2) and GrGL3 promotor.

Embodiment

For making the object, technical solutions and advantages of the present invention clearly understand, below in conjunction with specific embodiment, and with reference to accompanying drawing, the present invention is described in further detail.

The invention discloses a kind of GhGL3 gene promoter, they have the nucleotide sequence as shown in SEQ ID No.1 or SEQ ID No.2.Meanwhile, the invention also discloses a kind of carrier of promotor, such as pBI101.2-GhGL3pro::GUS carrier, its nucleotide sequence is as shown in SEQ ID No.2.

The present invention is to provide GhGL3 gene promoter, there is the nucleotide sequence as shown in SEQ ID No.1 or SEQ IDNo.2, or the nucleotide sequence of SEQ ID No.1 is had a promotor derivative by SEQ ID No.1 with the identical activity of nucleotide sequence of SEQ ID No.1 through the replacement of one or more Nucleotide, disappearance or interpolation.One of following nucleotide sequences:

(1) nucleotide sequence of SEQ ID No.1;

(2) with the nucleotide sequence shown in SEQ ID No.1, there is more than 75% homology.

Nucleotide sequence shown in SEQ ID No.1 is by 4320 based compositions, in amplification GhGL3 promotor, the primer pair of arbitrary fragment is also within protection scope of the present invention, wherein, distance between upstream primer and downstream primer in the 1st base of GhGL3 gene promoter between the 4320th base, preferably between the 2313rd base to the 4320th base; The length of each primer in this primer pair is 15 to 30 bases.

Promotor provided by the present invention can guide foreign gene to express in the plants such as cotton, will obtain transgenic cell line and transfer-gen plant that certain goal gene is expressed in cotton fiber.

Promotor of the present invention, when being building up in plant expression vector, can add encoding sequence or any one enhanser of any one gene after its transcription initiation.

For the ease of identifying transgenic plant cells or plant and screening, can use carrier be processed, mark as added plant alternative or there is the antibiotic marker thing of resistance.

The expression vector carrying promotor of the present invention imports vegetable cell by using the standard biologic technological methods such as particle gun, Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, the plant host be converted both can be monocotyledons, also can be dicotyledons.

When promotor of the present invention be used to goal gene in cotton fibre specifically expressing or change cotton fiber quantity, qualitative character time, can following methods be adopted: 1, be cloned in plant conversion carrier by promotor of the present invention, connect thereafter the encoding sequence of goal gene; 2, constructed plant conversion carrier is transformed renewable cotton tissue (or organ) and promotor of the present invention is expressed in the tissue transformed; 3, the tissue be converted (or organ) is trained plant.

Below by embodiment, the present invention is described further.

Vegetable material used in embodiment meets the following conditions:

At the cotton florescence, to list observation flowering time, gather blade, petal, bud, flower and young bell to equal to bring back in laboratory in ice bath, gather rapidly with the utensil of sterilizing the ovule spent front 1-3 days, bloom the same day (0 day) and spent rear 1-5 days respectively, be divided into two portions.A part is for observation of dyeing, and part quick-frozen in liquid nitrogen ,-80 DEG C save backup.

The clone of embodiment 1 Specific promoter in cotton fiber

The clone of Specific promoter in cotton fiber adopts Clontech company test kit (GenomeWalker ^tMuniversal Kit, article No. #638904) described in method.

The extraction of cotton genomic dna is undertaken by the method for Paterson et al. (1993).Get 2.5 μ g genomic dnas, use EcoR V, Dra I, Hpa I, Pvu II, Sac I, Sma I and Stu I (Takara product) enzyme to cut through night (16 ~ 18 hours) respectively.Whether get 5 μ l digestion products cuts complete through 0.6% agarose ethidium bromide (EB) detected through gel electrophoresis enzyme.If enzyme cuts entirely, add the saturated phenol of isopyknic Tris and chloroform carries out extracting, and precipitate with precooling on ice 95% ethanol (containing 3M sodium-acetate and 20 μ g glycogens), precipitation is washed with precooling on ice 80% ethanol, finally precipitation is dissolved in 25 μ l TE (10mM Tris/0.1mM EDTA, pH7.5).Get the purity of 1 μ l digestion products through 0.6% agarose ethidium bromide (EB) detected through gel electrophoresis digestion products.

Seven of purifying kinds of enzymes are cut DNA and respectively gets 4 μ l, add 1.9 μ l GenomicWalker Adaptor genomic walking joint sequence (25 μMs) more respectively, 1.6 μ l 10 × ligation buffer connect damping fluid, 0.5 μ l T4 DNA ligase ligase enzyme (6U/ μ l, purchased from Clontech), 16 DEG C of connections are spent the night; 70 DEG C of heating, 5 minutes termination reactions; In each pipe, add 72 μ l TE (10mMTris/1mM EDTA, pH7.5), be seven enzymes and cut DNA library: EcoR V, Dra I, Hpa I, Pvu II, Sac I, Sma I and Stu I.

Genome Walker Adaptor is:

5’-GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT-3′

3’-H ₂N-CCCGACCA-PO ₄-5’

This programme designs gene specific primer (GSP) according to 5 ' the end UTR of GhGL3.The amplification of GhGL3 promoter sequence obtains through the amplification of three-wheel.Wherein third round comprises two schemes, through splicing the promoter sequence that all can obtain final 4320bp.Obtain GhGL3 (AF336280) gene order through ncbi database search, comprise the ORF sequence of 5 ' end UTR and 1884bp of 544bp size, GSP1 and GSP2 is positioned at 5 ' the end UTR of this section.Splice according to the first round amplification sequences Design GSP3 obtained, take turns amplification according to second and splice the sequences Design GSP4 and GSP5 that obtain.The gene specific primer sequence used is as follows:

GSP1 5’CTATGAAGGTTGAAAGGAAGAGGAAA3’

GSP2 5’GAAAGGAGATACTGTTTATGAAGAT3’

GSP3 5’TCACTAGACTTATAAATTGAGGGTA3’

GSP4 5’AACGCATTTGAACTCATATCTTCCTAC3’

GSP5 5’AGAGTCCAACAATCATAGTCAACAAAG3’

The amplification of three-wheel except gene specific primer different, represent with GSPx and GSPy, remaining operation is all identical, and operation steps is summarized as follows:

Seven enzymes being cut DNA, respectively to get 1 μ l be template, respectively add 40 μ l deionized water (deioniaed H ₂o), 5 μ l 10 × Advantage 2 PCR buffer, 1 μ l dNTPs (10mMeach), 1 μ l AP1 (10 μMs), 1 μ l GSPx (10 μMs), 1 μ l Advantage 2 Polymerase (5U/ μ l, purchased from Clontech), carry out first time (Primary) polymerase chain reaction (Polymerase Chain Reaction, PCR).PE9600 or 9700 or MJ PCR instrument increase: 94 DEG C of 25s, 72 DEG C of 3min, amount to 7 circulations; 94 DEG C of 25s, 67 DEG C of 3min, amount to 32 circulations; 67 DEG C of 7min.By the PCR primer obtained, make 1.5% agarose EB detected through gel electrophoresis.The primer is:

Adaptor Primer 1(AP1；22-mer)：

5’-GTAATACGACTCACTATAGGGC-3’

GSPx: see above-mentioned primer form (5 ' end design according to GhGL3)

By seven kinds first time PCR primer dilute 50 times, respectively getting 1 μ l is template, respectively adds 40 μ l deionized water (deioniaed H ₂o), 5 μ l 10 × Advantage 2 PCR buffer, 1 μ ldNTPs (10mM each), 1 μ l AP2 (10 μMs), 1 μ l GSPy (10 μMs), 1 μ lAdvantage 2 Polymerase (5U/ μ l, purchased from Clontech), carries out second time PCR.PE9600 or 9700 or MJ PCR instrument increase: 94 DEG C of 25s, 72 DEG C of 3min, amount to 5 circulations; 94 DEG C of 25s, 67 DEG C of 3min, amount to 20 circulations; 67 DEG C of 7min.By the PCR primer obtained, make 1.5% agarose EB detected through gel electrophoresis.The primer is:

Nested Adaptor Primer 2(AP2；19-mer)：

5’-ACTATAGGGCACGCGTGGT-3’

GSPy: see primer form (5 ' the end design according to GhGL3)

Cut the fragment increased in the library corresponding to list, reclaim test kit (article No. #A9282) purifying object fragment with Promega company glue.Then be cloned on pGEM-T Easy carrier, be transformed in E.coli DH5 α competent cell.Screen in vain through indigo plant, select positive colony with the primer T7 on carrier and Sp6 amplified fragments, extract plasmid, check order through ABI 3730xl DNA analysis instrument.Splicing gained sequence is the promoter sequence of GhGL3.This programme can obtain through three-wheel amplification the promoter sequence (SEQ ID No.1) that length is 4320bp size.

Embodiment 2 transformation assay

In order to more effectively build cloning vector and converting cotton, the present embodiment gets the nucleotide sequence between the 2313bp to 4320bp of sequence table 1 (SEQ ID No.1), and length is that 2008bp (being labeled as SEQ ID No.2) carries out follow-up research and analysis.Holding design respectively to contain the primer of Sal I and BamH I restriction enzyme site at the 5 ' end and 3 ' of the promotor (SEQ ID No.2) of GhGL3, take genomic dna as template 20ng, 5 μ l 10 × LA PCR buffer (Mg ²⁺plus), 4 μ l dNTPs (2.5mM each), 1 μ l GhGL3p-SalI-F (10 μMs), 1 μ lGhGL3p-BamH I-R (10 μMs), 0.5 μ l LA Taq (5U/ μ l, purchased from Takara), adds aseptic deionization ultrapure water H ₂o supplies 50 μ l reaction systems.94 DEG C of 30s, annealing temperature 50 ~ 62 DEG C of 30s, elongating temperature 72 DEG C of 2min, amount to 35 circulations and carry out pcr amplification.Wherein, the preferable temperature of annealing temperature is 51.5 DEG C.

Upstream primer GhGL3p-Sal I-F: underscore display restriction enzyme site is protection base before restriction enzyme site

5′ATAACGC GTCGACGCC TCC AAT AGA ACT AGA GAC AGA C3′

Downstream primer GhGL3p-BamH I-R: underscore display restriction enzyme site is protection base before restriction enzyme site

5′ATACGC GGATCCCTC TTG ATG TTG AAC TCC AGT AGACAT3′

Amplification obtains the promoter sequence of the GhGL3 of 2008bp through Sal I and BamH I double digestion, reclaim and be connected on the pBI101.2 carrier of Sal I and BamH I double digestion, obtaining the expression vector pBI101.2-GhGL3pro::GUS (Figure 1A) that this promotor and gus gene merge.Afterwards by the vector that obtains in E.coli DH5 α competent cell, by Kan resistance screening positive colony and qualification of checking order.Again the double base expression plasmid electric shock of structure is proceeded in agrobacterium tumefaciens AGL1 after qualification connection is correct, and pass through the method converting cotton hypocotyl of During Agrobacterium, obtain transgene cotton.

The identification and analysis of embodiment 3 transgenic cotton plant

From the blade of transgenic cotton plant, extract DNA, be diluted to 20ng and get 1 μ l as template.First use the primer amplification determination template of His3 gene intact.Then 1 μ l genome gDNA is got as template, 5 μ l 10 × LA PCR buffer (Mg ²⁺plus), 4 μ l dNTPs (2.5 μMs of each), 1 μ l GUS-2553F (10 μMs), 1 μ l GUS-4361R (10 μMs), 0.5 μ l LA Taq (5U/ μ l, purchased from Takara), adds aseptic deionization ultrapure water H ₂o supplies 50 μ l reaction systems.94 DEG C of 30s, annealing temperature 57 DEG C of 30s, elongating temperature 72 DEG C of 2min, amount to 35 circulations and carry out pcr amplification.

Upstream primer His3F:5 '-GCCAAGCGTGTCACAATTATGC-3 '

Downstream primer His3R:5 '-ACATCACATTGAACCTACCACTACC-3 '

Upstream primer GUS-2553F:5 '-ATGTTACGTCCTGTAGAAACCCCA-3 '

Downstream primer GUS-4361R:5 '-TCATTGTTTGCCTCCCTGCTGCGGT-3 '

Through 0.8% agarose EB detected through gel electrophoresis after having increased.If amplification obtains 1809bps product, illustrate that this plant contains from gus reporter gene sequence on pBI101.2 carrier, be the transgenic cotton plant of the positive, experimental result as shown in Figure 1B.

Get transgene cotton blade, bract, petal and spend first 1 day and the florescence, the ovule of spending rear 2-5 days, carry out GUS Activity determination, method is with reference to Weigel and Galzebrook (2002).GUS activity test method is: in 37 DEG C of incubators, incubation 1 is little of spending the night, and bromo-for substrate 5-4-chloro-3-indoles-β-D glucoside acid esters (X-Gluc) can be hydrolyzed into blue material by beta-glucan glycosides enzyme (GUS); The experiment material contaminated is proceeded in 70% or 95% ethanol decolour 2-3 time (removing chlorophyll), to negative control material is white.The activity of gus gene in histoorgan can be observed directly by this reaction.This programme material of resin embedding sections observation dyeing process.As in Figure 2-4, resin slicer is observed under the difference visual field, and GUS not only expresses in cotton fibre, and expresses in the epidermal hair of blade, also expresses in the epidermal hair in the bract and petal of floral organ.This shows, the promotor of GhGL3 is the promotor of regulation and control cotton fiber and trichome development.

Embodiment 4GhGL3 promoter sequence homology analysis

NCBI muca gene group database NCBI/BLAST/blastn suite, the GhGL3 promoter sequence (SEQ ID No.2) of input FASTA form, the code 3633 (Gossypium) of input Gossypium, carry out cotton full-length genome air gun sequencing sequence contig (wgs) search, obtain and the Asiatic cotton of GhGL3 promoter sequence homology and the cotton GL3 promoter sequence of Lei Mengdeshi.Again with DNAMAN software comparison GhGL3/GaGL3 promoter sequence and GhGL3/GrGL3 promoter sequence respectively, result as shown in Figure 5 and Figure 6.

Be further described below in conjunction with the characteristic of accompanying drawing to GhGL3 promotor of the present invention.

Fig. 1 is that the fusion expression vector collection of illustrative plates of GhGL3 promotor and gus gene and transfer-gen plant are identified, wherein A is the fusion expression vector (pBI101.2-GhGL3pro::GUS) of GhGL3 promotor and gus gene; B is the fusion vector transgenic cotton plant of round pcr qualification GhGL3 promotor and gus gene, and His3 (Histone3) is reference gene, and GUS is reporter gene.

Fig. 2 is GhGL3 promotor:: gus gene is at the phenotype photo of cotton fibre initial phase to elongating stage (-1DPA-5DPA), and wherein A is GhGL3 promotor:: GUS expresses (light blue) in the cotton fibre of-1DPA (blooming the day before yesterday); B is GhGL3 promotor:: GUS expresses (blueness) in the cotton fibre of 0DPA (blooming the same day); C is GhGL3 promotor:: GUS expresses (blueness) in the cotton fibre of 4DPA (Post flowering four days); D is GhGL3 promotor:: GUS expresses (blueness) in the cotton fibre of 5DPA (Post flowering five days); E, wild type control, material is 4DPA (Post flowering four days).A-E scale is 50mm.F is GhGL3 promotor:: GUS expresses not obvious in the cotton ovule section of-1DPA (blooming the day before yesterday); G is GhGL3 promotor:: the fibrocyte of GUS in the cotton ovule section of 0DPA (blooming the same day) expresses (blueness); H is GhGL3 promotor:: the fibrocyte of GUS in the cotton ovule section of 4DPA (Post flowering four days) expresses (blueness); I is GhGL3 promotor:: the fibrocyte of GUS in the cotton ovule section of 5DPA (Post flowering five days) expresses (blueness); J is wild type cotton ovule section contrast, and material is 4DPA (Post flowering four days).F-J is that 10X microscopic examination is taken a picture.K is GhGL3 promotor:: GUS expresses not obvious in the cotton ovule section of-1DPA (blooming the day before yesterday); L is GhGL3 promotor:: the fibrocyte of GUS in the cotton ovule section of 0DPA (blooming the same day) expresses (blueness); M is GhGL3 promotor:: the fibrocyte of GUS in the cotton ovule section of 4DPA (Post flowering four days) expresses (blueness); N is GhGL3 promotor:: the fibrocyte of GUS in the cotton ovule section of 5DPA (Post flowering five days) expresses (blueness); O is wild type cotton ovule section contrast, and material is 4DPA (Post flowering four days).K-O is that 20X microscopic examination is taken a picture.Slice thickness is 2 μm, and scale is 50 μm.

Fig. 3 is GhGL3 promotor:: the phenotype photo of GUS in cotton leaf, wherein A is GhGL3 promotor:: the expression photo (blueness) of GUS on transgene cotton blade; B is the photo of wild type cotton blade contrast; C is the GUS staining examine photo (blueness) in vein; D is the GUS staining examine photo (blueness) in leaf epidermal hair; E is the vein of wild-type and the contrast photo of epidermal hair.A, B scale 50mm, 50 μm, C, D and E scale.

Fig. 4 is GhGL3 promotor:: GUS is at the phenotype photo of cotton plants floral organ, and wherein A is GhGL3 promotor:: the phenotype photo (blueness) of GUS in transgene cotton bract; B is wild type cotton bract contrast photo; C is the GUS staining examine photo (blueness) in bract epidermal hair; D is the GUS staining examine photo (blueness) of epidermal hair near vein; E is vein and the epidermal hair contrast photo of wild-type bract; F is GhGL3 promotor:: the phenotype photo (blueness) of GUS in transgene cotton petal; G is wild type cotton petal contrast photo; H is the GUS staining examine photo (blueness) in petal epidermal hair; I is the GUS staining examine photo (blueness) of petal base portion epidermal hair; J is wild-type petal epidermal hair contrast photo.A, B, F and G scale 50mm, 50 μm, C, D, E, H, I and J scale.

Fig. 5 is the sequence alignment analysis spectrogram of GhGL3 promoter sequence (SEQ ID No.2) and GaGL3 promotor, known by DNAMAN software analysis, be 97.52% from the GhGL3 promoter sequence of land cotton seed (Gossypiumhirsutum L.) and the sequence identity from the genomic GaGL3 promotor of Asiatic cotton (Gossypium arboreum L.) A.

Fig. 6 is the sequence alignment analysis spectrogram of GhGL3 promoter sequence (SEQ ID No.2) and GrGL3 promotor, known by DNAMAN software analysis, be 80.83% from the GhGL3 promoter sequence of land cotton seed (Gossypiumhirsutum L.) and the sequence identity from the genomic GrGL3 promotor of Lei Mengdeshi cotton (Gossypium raimondiiL.) D.

Above-described specific embodiment; object of the present invention, technical scheme and beneficial effect are further described; be understood that; the foregoing is only specific embodiments of the invention; be not limited to the present invention; within the spirit and principles in the present invention all, any amendment made, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.

Claims (10)

1. a GhGL3 gene promoter, it is characterized in that, it has the nucleotide sequence as shown in SEQ ID No.1 or SEQ ID No.2, or the such as nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 is had the activity identical with the nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 through the replacement of one or more Nucleotide, disappearance or interpolation.

2. GhGL3 gene promoter as claimed in claim 1, the nucleotide sequence of wherein said GhGL3 gene promoter and the nucleotide sequence shown in described SEQ ID No.1 have the homology of more than 75%, or have the homology of more than 80% with the nucleotide sequence shown in described SEQ ID No.2.

3. GhGL3 gene promoter as claimed in claim 1, wherein said GhGL3 gene promoter is the promotor in arbitrary fragment of described promotor with the primer pair of amplification, and distance between described upstream primer and downstream primer in the 1st base of described GhGL3 gene promoter between the 4320th base, preferably between the 2313rd base to the 4320th base, the length of each primer in described primer pair is 15 to 30 bases.

4. containing, for example the carrier of the GhGL3 gene promoter described in claims 1 to 3 any one.

5. carrier as claimed in claim 4, wherein said carrier is pBI101.2-GhGL3pro::GUS.

6. carrier as claimed in claim 4, wherein adds encoding sequence or the enhanser of other gene after described GhGL3 gene promoter transcription is initial.

7. carrier as claimed in claim 4, wherein adds plant alternative and marks or have the antibiotic marker thing of resistance in described carrier.

8. carrier as claimed in claim 4, described carrier imports vegetable cell by using Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection or conductance technology method.

9. containing, for example the host cell of the carrier described in claim 4 to 8 any one.

10. containing, for example the transformed plant cells of the GhGL3 gene promoter described in claims 1 to 3 any one.