CN103789314A - Brassica napus promoter P17673 and preparation method and application thereof - Google Patents

Abstract

The invention discloses a Brassica napus promoter P17673 and a preparation method and application thereof. The method comprises the steps: (1) designing a pair of primers according to an upstream 2.2kb sequence of a gene Bn17673 which is obtained through sequencing all genomes of napus, and carrying out PCR (Polymerase Chain Reaction) amplification, so as to obtain a 5' upstream promoter sequence of the napus Bn17673; (2) preparing the napus promoter P17673: extracting genomic DNA (Deoxyribonucleic Acid) of napus leaves, carrying out PCR amplification with the primers, purifying and recovering with a gel recovery kit, then, connecting to a pMD18-T vector, picking positive clones, carrying out PCR positive detection and enzyme digestion verification, and then, sequencing, thereby obtaining an upstream 2.2kb flanking sequence of a target gene, wherein shown by bioinformatics analysis, the upstream flanking sequence is P17673. Shown by fluorescent quantitative PCR and GUS (glucuronidase) staining results, P17673 is efficiently expressed in the anthers and pollen of napus and is not expressed in tissues, such as roots, stems, leaves, fruits, seeds and the like. The promoter has good application potential to the safety of transgenic napus edible oil and the aspects of improving crop quality, artificially creating germplasm resources and the like.

Description

Swede type rape P17673 promotor and preparation method and application

Technical field

The present invention relates to plant genetic engineering and biological technical field, be specifically related to a kind of swede type rape Bn17673 gene promoter (called after P17673, below identical ), also relate to a kind of preparation method of swede type rape P17673 promotor simultaneously.The invention still further relates to the carrier that contains this promotor or its essence homologous nucleotide sequence and utilize the application of this promotor in rape and Arabidopis thaliana with relating to.

Background technology

Plant gene promoter is the section of DNA sequence that is positioned at structure gene 5 ' end upstream, contains cis-acting elements, is determining specificity, direction and efficiency that downstream gene is transcribed, is the factor of most critical in gene transcription regulation mechanism and expression pattern.In addition, it is the key of plant genetic engineering research that foreign gene is expressed in vegetable cell, and first the expression of foreign gene depends on the startup that it is transcribed, and to a certain extent, promotor has determined sequence of time and space and the expression intensity of genetic expression.Therefore, excavate and study Novel promoter and there is very important scientific meaning for gene expression regulation Mechanism Study and transgenic research.

Find by the analysis to various plants gene promoter area, the promotor of most functional protein genes all has common structural pattern, is generally made up of core promoter element and upstream element.The TATA box that is positioned at transcription initiation site upstream-20--30 bp place is core promoter element, it is the conserved sequence district of being rich in AT, relevant with unwinding of DNA double chain, and determine the selection of transcripting start point, be that most plant promoter corrections are necessary.The conserved sequence of TATA box upstream is called promotor upstream element, comprise upstream-75bp place CAAT box and-general upstream promoter element and other special upstream elements such as near GC box 80--110bp, as element (Zhang Chunxiao etc., Review on Plant Gene Promoters such as jasmonate response element (JRE), ethylene response elements (ERE).Acta Genetica Sinica, 2004,31(12): 1455-1464; Wait quietly on road, Plant Promoter and applied research progress thereof.Natural science progress, 2004,14(8): 856-862).CAAT box is the sequence of relatively guarding, and with the identification of RNA polymerase with in conjunction with relevant, genetic transcription is had to stronger activation.But some gene is without this frame, as replaced by CATC frame without CAAT box in the storage protein gene of cereal crop.The conserved sequence of GC box is 5 ' GGGCGG3 ', can have multiple copies, and can exist and do not affect its function (road is quiet, Zhao Huayan, He Yikun, Song Yanru, Plant Promoter and applied research thereof progress with any direction.Natural science progress, 2004,14(8): 856-862; The summer east of a river, Chen Quan, Wu Yusheng, Ji Pengzhang, Plant Promoter function and structure progress.Yunnan Prov Agriculture University's journal, 2006,21(1): 7-14).As long as there are these conservative structural frames, so just can there is the function of corresponding startup downstream gene expression.

Can be divided into constitutive promoter, organizing specific type promotor and inducible promoter according to the transcriptional profile of plant promoter.The foreign gene that constitutive promoter drives is stably express in all developmental stages of transfer-gen plant and tissue.To the conversion of many dicotyledonss, conventionally all use from the 35S promoter of cauliflower mosaic virus (CaMV) or from the plasmid vector of the nopaline synthetic enzyme no promotor of bacterium, and the most frequently used in monocotyledons transforms be to contain rice actin Act promotor, plasmid vector (Guan Liying etc., the effective expression of foreign gene and the safety evaluation thereof in transgenic plant of corn ubiquitin Ubi promotor and 35S promotor.Capital Normal University's journal, 2002,23(2): 52-56).But many times the lasting high efficient expression of foreign gene in recipient plant not only causes the waste of the energy in organism, and the expression in a organized way likely plant itself is had to toxic action, even cause Transgene-safty problem (Jia S-R. Environment and food biosafty assessment of transgenic plants. Advanced of Bioengineer. 1997,17:37-42; Morris S H, Adley C. C. Irish public perceptions and attitudes to modern biotechnology:an overview with a focus on GM foods. Trends in Biotechnology. 2001,19:43-48).Therefore, the research of inducible promoter and tissue-specific promoter and application are subject to breeder's attention day by day.The inducible promoter of identifying in transgenic plant mainly comprises abiotic stress inducible promoter, (Nie Lina etc., the clone of plant gene promoter and the Research progress on Function thereof such as biological stress induced promoter and hormone induction type promotor.Plant genetic resources journal, 2008,9 (3): 385-391).But the application of inducible promoter also has certain limitation, the external condition processing that recipient plant is carried out, as heat shock, HORMONE TREATMENT etc. may cause a series of biochemical reactions in organism and be unfavorable for the normal growth of plant.In addition, in chemical regulation system, be used as the Methylprednisone acetate (dex of inductor, dexamethasone), estradiol (estradiol) and tsiklomitsin (tetracycline) be all harmful to ecotope, should not be for the production of practice.Use the tissue-specific promoter of itself in plant materials just can avoid this problem, obviously, the tissue specific expression of foreign gene will effectively improve the biological safety of genetically modified crops.(Song Yang etc., the research of plant tissue specificity promoter.Biotechnology circular, 2007, (4): 21-24).

In the last few years, make significant headway about tissue-specific promoter's research, these tissue-specific promoters mainly comprise the reproductive organ specific expression promoters such as the organ specific expression promoters such as blade, phloem, vascular bundle and root and pollen, floral organ, fruit, seed (Song Yang etc., the research of plant tissue specificity promoter.Biotechnology circular, 2007, (4): 21-24).As Ariizumi etc. has separated LTP12, the promotor of XTH3 and PGA4 arabidopsis thaliana transformation, GUS dyeing shows that these 3 promotors are anther specific expression promoter, and express and there are differences (Ariizumi et al in different periods, Comparative study of promoter activity of three anther-specific genes encoding lipid transfer protein, xyloglucan endotransglucosylase/hydrolase and polygalacturonase in transgenic Arabidopsis thaliana. Plant Cell Report. 2002, 21:90 – 96).In sesame, clone obtains the promotor of microsome oleic acid dehydrogenase gene (FAD2), and forecast analysis shows that the E-box in this promotor is relevant with the biosynthesizing of triacylglycerol with G-box element.Express by detecting gus gene after arabidopsis thaliana transformation, result shows this promotor specifically expressing (Mi Jung Kim etal. Seed-specific expression of sesame microsomal oleic acid desaturase is controlled by combinatorial properties between negative cis-regulatory elements in the SeFAD2 promoter and enhancers in the 5'-UTR intron. Molecular Genetics and Genomics. 2006 in seed, 276:351-368).The strange grade of Geng An separated 4 promotors transformation of tobacco from turnip type rape, swede type rape, tender flower stalk, wild cabbage, it is promotor (the Geng et al. Expression analysis of four flower-specific promoters of Brassica spp. in the heterogeneous host tobacco.African Journal of Biotechnology. 2009,8 (20): 5193-5200) of floral organ specifically expressing for GUS staining analysis.In addition, tobacco anther tapetum specific expression gene promotor TA29 and nuclease gene Barnase, RnaseT1 are merged rear conversion of plant by Mariani etc., nuclease gene is specifically expressing in flower pesticide, and destroy tapetum, obtain male sterile tobacco and rape (Mariani C. etal. Induction of male sterility in plants by a chimaeric ribonuclease gene. Nature, 1990,347:737-741).At present TA29 promotor apply and has been succeeded that (Song Yang etc., plant tissue specificity promoter is studied on the plants such as tobacco, corn, rape, Arabidopis thaliana, paddy rice.Biotechnology circular, 2007, (4): 21-24).As can be seen here, even exist and make mutually difference between the internal milieu difference between different plants and gene, even the plant larger with Arabidopis thaliana nature difference, start region and corresponding conservative controlling element as long as there is conservative core, just can in other different plants, bring into play the biological function that starts downstream gene expression.

In recent years, to the functional study of promotor, the method that lot of documents report adopts is normally first with after information biology tentative prediction and analysis promoter sequence, again promoter fragment and reporter gene are constructed to expression vector, Cells In Vitro or the plant materials of transformation mode plant Arabidopis thaliana, tobacco, paddy rice etc., then the expression in transgenosis individuality is analyzed the function of promotor and is used by examining report gene.Have been reported and show that the promotor of other plant is transformed into and in above-mentioned plant, all can exercise normally its biological function, as: the promotor of the microsome oleic acid dehydrogenase gene (FAD2) of cloning in sesame, the E-box in this promotor is relevant with the biosynthesizing of triacylglycerol with G-box element.In transgenic arabidopsis and other transgenic plant, also demonstrate expression (the Mi Jung Kim of seed-specific, Heeja Kim, Mi Chung Suh. Seed-specific expression of sesame microsomal oleic acid desaturase is controlled by combinatorial properties between negative cis-regulatory elements in the SeFAD2 promoter and enhancers in the 5 '-UTR intron. Molecular Genetics and Genomics. 2006, 276 (4): 351-368).The ZmGLU1 gene promoter of cloning from corn, after connecting gus reporter gene, be converted in tobacco, detect analytical results corn ZmGLU1 promoters driven gus gene efficiently express (Riliang Gu at tobacco root, Li Zhao, Guoying Wang. Isolation of a maize beta-glucosidase gene promoter and characterization of its activity in transgenic tobacco. Plant Cell Reports. 2006,25 (11): 1157-1165).From potato, separate one with the promotor of closely similar TDF511 (tran-script derived fragment) the gene Stgan of ethanol dehydrogenase.Build Stgan promotor-GUS fusion expression vector transformation of tobacco, GUS histochemical stain shows that this promoters driven gene is at tobacco stem tubercle place specifically expressing, may participate in stem tuber forming process (Trindade L M, et al. Isolation and functional characterization of a stolon specific promoter from potato (Solanum tuberosum L.). Gene, 2003,303:77-84.).These reports are all to utilize transgenic technology between different plants, to carry out the example of promoter function analysis above, these examples show to utilize model plant Arabidopis thaliana, tobacco etc. as carrier, and the function that confirms the promotor that comes from other plant by the expression analysis of transfer-gen plant is by extensively recognition and acceptance.

Rape, as the main oil crops of China, is extensively planted in the Yangtze valley, and national economy is had to material impact.Along with the maturation of transgenic technology, transgene rape will inevitably face the public opinion of Transgene-safty risk.Being used in the expression that the promotor of not expressing completely in Semen Brassicae campestris starts goal gene is the feasible method addressing this problem, and has both reached and has both improved rape each side quality, does not cause again the object of edible oil security risk.

The present patent application people has participated in being responsible for by the Chinese Academy of Agricultural Sciences vegetables, BGI-Shenzhen and Korea Spro, English, add, Australia, Chinese cabbage genome sequencing and analytical work that the Mei Dengguo correlative study scientific research personnel of mechanism has cooperated, by oil plant institute of the Chinese Academy of Agricultural Sciences (being responsible for), vegetables institute of the Chinese Academy of Agricultural Sciences, BGI-Shenzhen, Hua Zhong Agriculture University, Hunan University, Agricultural University Of Southwest, Jiangsu academy of agricultural sciences, Sichuan academy of agricultural sciences, Qinghai University, and absorb English, Australia, beautiful, the Fa Dengguo correlative study scientific research personnel of mechanism has cooperated genome sequencing and the analysis of wild cabbage and rape, Chinese cabbage genome paper is delivered (The Brassica rapa Genome Sequencing Project Consortium. The genome of the mesopolyploid crop species Brassica rapa. Nature Genetics, 2011, 43:1035 – 1039), and wild cabbage and swede type rape sequencing data of whole genome are also unexposed.Chinese cabbage, wild cabbage and swede type rape genome sequencing information have been set up can be for database http://www.ocri-genomicls.org/bolbase (the Cheng F of applicant's inquiry; Liu S; Wu J, Fang L, Sun S; Liu B; Li P, Hua W, Wang X:BRAD. the genetics and genomics database for brassica plants. BMC Plant Biol; 2011,11:136; Jingyin Yu, Meixia Zhao, Xiaowu Wang, Chaobo Tong, Shunmou Huang, Sadia Tehrim, Yumei Liu, Wei Hua and Shengyi Liu. Bolbase:a comprehensive genomics database for Brassica oleracea[J]. BMC Genomics, 2013,14:664).These sequencing data of whole genome for applicant utilizes high-throughout swede type rape tissue transcribe group order-checking, the gene of analyses and prediction a large amount specifically expressing in each tissue, and the promoter sequence that obtains thus these genes is laid a good foundation.

Therefore, the present invention organizes on order-checking basis with transcribing at swede type rape genome sequencing, has developed a swede type rape endogenesis promoter.Fluorescence quantitative PCR detection shows that this gene do not express in the root of swede type rape, stem, leaf, angle fruit, and only in stamen, a large amount is expressed.The native gene that proves promoters driven by the expression characteristic of examining report gene GUS is not expressed in root, stem, blade, angle fruit, and in stamen and flower pesticide, a large amount is expressed.Our result is indicating that the promotor of this gene has a good application prospect in transgenic plant.

Summary of the invention

The object of the invention is to be to provide a kind of swede type rape P17673 promotor, can fast prediction go out the candidate gene that a large amount is expressed in rape stamen, method by fluorescent quantitation is verified, it is a kind of new organizing specific expression promotor of acquisition of high efficient and reliable, can accurately locate regulated and controled gene, drive goal gene to express in particular organization or the period of transgene rape, improved the expression efficiency of foreign gene in transgenic plant, limit its expressive site.Therefore, this promotor can be applicable to genetically engineered research and the safe transgenic research of seed rape of plant.

A further object of the invention is the preparation method who has been to provide a kind of swede type rape P17673 promotor.The method take to swede type rape genomic dna as template, carry out pcr amplification, obtain swede type rape P17673 sequence, simple to operate, result is reliable and stable.

The 3rd object of the present invention is to be to provide a kind of recombinant vectors that contains plant efficient expression promotor, and it contains described promotor nucleotide sequence.This carrier size is applicable to, in plant easily with transform, institute with marker gene GUS expression intensity high, easily detection.Can obtain the Arabidopis thaliana transfer-gen plant of gus gene high efficient expression in plant by this carrier arabidopsis thaliana transformation.

The 4th object of the present invention is to be to provide the application of a kind of swede type rape P17673 promotor in rape and Arabidopis thaliana flower pesticide, pollen granule.Under the driving of this promotor, mainly meticulous expression in the flower pesticide of plant of goal gene, does not express at other position.This promotor with tissue specific expression creates in the genetically engineered such as sterile line, manual creation germ plasm resource and Transgene-safty (edible, pollen drift) and has good using value plant.

in order to complete above-mentioned purpose, the present invention adopts following technical scheme:

In order to obtain the present invention, contriver utilizes and transcribes swede type rape root, stem, leaf, bud, ovule, angle fruit, angle pericarp, stamen, gynoecium, sepal, petal totally 11 the Gene Expression Profiles data that group order-checking obtains, in conjunction with sequencing data of whole genome, by prediction and quantitative fluorescent PCR checking, obtain a new promotor.The native gene of this promoters driven is efficient specifically expressing in the flower pesticide of plant.

According to an aspect of the present invention, above-mentioned purpose can be by providing a kind of promotor to realize, described promotor can specificity drives downstream gene high efficient expression in plant, described promotor contain SEQ ID No.1 nucleotide sequence or with the SEQ ID No.1 nucleotide sequence of homology in fact.

According to another aspect of the present invention, above-mentioned purpose can realize by the recombinant vectors that the nucleotide sequence that contains described promotor is provided.

According to another aspect of the present invention, above-mentioned purpose can realize with the microorganism that described recombinant vectors transforms by providing.

According to another aspect of the present invention, above-mentioned purpose can realize with the transgenic plant of described microbial transformation by providing.

A preparation method of swede type rape promotor P17673, the steps include:

A, flower pesticide specific expression gene Bn17673 and promotor P17673 prediction:

The present invention's rape used is two No. 11 (Brassica napus L., below identical) in swede type rape.Be seeded in land for growing field crops for examination material, normal field management.The rapeseed plants of growing from grown in field condition is got root, stem, leaf, bud, ovule, angle fruit, angle pericarp, stamen, gynoecium, sepal, petal totally 11 tissues.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen flash freezer-80 ℃ of preservations.That utilizes that Trirol extracts test kit (purchased from TaKaRa company, below identical) carries out the extraction of RNA according to the requirement of test kit.The RNA extracting be sent to BGI-Shenzhen carry out reverse transcription, build storehouse and and utilize solexa sequencing technologies (Illumina Solexa sequencing technologies, biomedical engineering and clinical, 2011,15(2): 149, below identical) carry out and transcribe group examining order.Each organizes sequencing data amount is 10G(base number, below all with).After order-checking, with RPKM value (Reads Per Kilobases per Million reads, below the identical) gene expression abundance of icp gene in different tissues.RPKM calculation formula is as follows: RPKM=(109 × C) ÷ (N × L) wherein C is the reads number of comparison to certain gene; N is total reads number that sample is compared all genes; L is mrna length.RPKM value is higher shows that the expression level of this gene is higher.By comparing the RPKM value of all genes of rape in above-mentioned 11 tissues, find that Bn17673 RPKM value in bud is 212.56, in stamen, RPKM is 1338.78, and RPKM value in all the other 9 tissues is that 0. explanation Bn17673 may be the gene of an a large amount specifically expressing in stamen, is a new stamen specific expression promoter and drive the P17673 of this gene.

The expression pattern of the native gene that B, P17673 drive:

In the rape of growing from grown in field condition, two No. 11 (as previously mentioned) plant are got root, stem, leaf, bud, angle fruit, gynoecium, stamen, petal.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen flash freezer-80 ℃ of preservations.That utilizes Trirol extraction test kit (as previously mentioned) carries out the extraction of RNA according to the requirement of test kit.(purchased from Takara company, below identical) carried out in the explanation of reverse transcription reference reagent box.

Quantitative real time PCR Instrument is IQ5(Bio Rad Laboratories), adopt rape Actin as internal standard gene (accession number AF111812), Actin gene primer is 5 ' CTGGAATTGCTGACCGTATGAG3 ' and 5 ' ATCTGTTGGAAAGTGCTGAGGG 3 '.The native gene Bn17673 primer that P17673 drives is 5'ACAAATACTTGGTCCCACGAGA 3' and 5'ACCCGTTTGAGGAAGTGTGTTA 3'.

Quantitative fluorescent PCR reacts every group of experiment and all completes three biology repetitions, and each biology repeats at least to do three technology and repeats.Detect respectively the expression of native gene in Oil Rape Tissue (root, stem, leaf, flower, angle fruit, gynoecium, stamen, petal) that P17673 drives.

With the relative expression quantity that compares Ct method (DDCt) calculating gene.By 2 ^-DDCtrelative expression quantity and systematic error (Kenneth J Livak. Thomas D Schmittgen. 2001, the Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 of estimation goal gene ^{-△ △ C}t Method. METHODS 25,402 – 408).Obtain the expression values (Fig. 1) of relative Actin gene.

C, homologous sequence method clone P17673 sequence:

1, the primer sequence of rape promotor P17673:

The Bn17673 upstream region of gene 2.2kb sequences Design 1 obtaining according to rape genome sequencing is carried out pcr amplification to primer, the primer of employing be P17673S:5 '-AGAAGACGATGGCGTCAATGT-3' and P17673A:5 '-AATCACACGACCGATCAATATAAAA-3 '.

2, the preparation of rape promotor P17673:

Utilize SDS cracking process (J. Pehanorm Brooker. D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) extraction rape leaf genomic dna, carry out pcr amplification as template, step is: extract genomic dna 25 μ l, increase as template, reaction system is 50 μ l, add respectively 10 × Ex Taq buffer, 5 μ l, dNTP 4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq 0.5 μ l, the about 100ng of DNA masterplate 1 μ l, ddH ₂o 37.5 μ l.The Bn17673 upstream region of gene 2.2kb sequences Design PCR the primer obtaining according to rape genome sequencing is that P17673S and P17673A carry out pcr amplification, amplified production size is 2113 bp(Fig. 2), PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is through 1.0%(sepharose/TE solution quality volume ratio, identical below) agarose gel electrophoresis detection, gel reclaims test kit (purchased from root biochemical technology Beijing, sky company limited, identical below) purifying reclaim after, be connected to pMD18-T carrier (purchased from Dalian precious biotechnology company limited, identical below), heat shock method (J. Pehanorm Brooker. D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) competent cell that transforms gold bacterial strain is (purchased from Dalian precious biotechnology company limited, identical below), coat and contain penbritin 50 μ g/mL(mass volume ratios, identical below) LB solid medium (fill a prescription as follows: take respectively 10 grams of Tryptoness, 5 grams of yeast extracts and 10 grams of sodium-chlor, 8 grams of agar are dissolved in distilled water successively, constant volume is in 1000 milliliters.Be sub-packed in 500 milliliters of triangular flasks, 121 ℃, autoclave sterilization 20 minutes under 6.859 × 104 Pa.Point install in culture dish, 4 ℃ of refrigerations are for subsequent use, below identical) on flat board, 37 ℃ of overnight incubation, select 6 of hickies, employing M13 primer: 5 ' TGTAAAACGACGGCCAGT3 ' and 5 ' CAGGAAACAGCTATGACC3 ', do bacterium colony PCR detection.Bacterium colony PCR concrete grammar (following identical) is to do masterplate by a small amount of bacterial plaque of toothpick picking of sterilizing, and reaction system is that 10 μ L include: 10 × Taq buffer(is containing MgCl ₂) 1 μ l, 1.5mmol/L dNTP (10 mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, (5 U/ μ are 0.5 μ l l), ddH for Taq ₂o 6.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 33 circulations, 72 ℃ 10 minutes, amplification size is 1960 bp, already described before 1.0%() after agarose gel electrophoresis detected magnitude is correct.Bacterial plaque correct PCR detected magnitude is inoculated into containing the liquid LB substratum of penbritin 50 μ g/mL and (is filled a prescription as follows: take respectively 10 grams of Tryptoness, 5 grams of yeast extracts and 10 grams of sodium-chlor, be dissolved in distilled water, constant volume is in 1000 milliliters, 121 ℃, autoclave sterilization 20 minutes under 6.859 × 104 Pa, identical below), at 37 ℃, 200 r/min shaking culture are spent the night, a small amount of alkaline process (J. Pehanorm Brooker. D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) extraction plasmid, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (being 1960 bp), (2 kinds of enzymes are purchased from TaKaRa company to adopt Kpn I/Xba I enzyme, identical below) cut plasmid is carried out to double digestion (following identical), it is 10 μ l that enzyme is cut system (following identical), comprise plasmid DNA 5 μ l, Kpn I 0.5 μ l, Xba I 0.5 μ l, ddH ₂o 4 μ l, 37 ℃ are spent the night, already described before 1.0%() agarose gel electrophoresis detects.The correct positive recombinant clone called after pMD18-P17673(of detection is connected into pMD18-T vector construction by object fragment P17673 to be formed, identical below), pMD18-P17673 is served to Hai Yingjun company and check order, analytical results, obtain P17673 full length sequence, name P17673.

D, promoter sequence bioinformatic analysis:

By core promoter element and Upstream cis acting promoter prediction software http://www.fruitfly.org/seq_tools/promoter.html and PLACE (Higo et al. for cloned P17673 sequence, Plant cis-acting regulatory DNA elements (PLACE) database (J). Nucleic Acids Research.1999,27:297～300. http://www.dna.affrc.go.jp/PLACE) predict.Result shows that cloned promoter sequence contains TATA box core promoter sequence, the upstream promoter elements such as CAAT and flower specifically expressing element are as POLLEN1LELAT52 and GTGANTG10(Bate N, Twell D. Functional architecture of a late pollen promoter:pollen-specific transcription is developmentally regulated by multiple stage-specific and codependent activator elements. Plant Molecular Biology. 1998, 37, 859 – 869.) and GTGANTG10 (Rogers HJ et al. Functional analysis of cis-regulatory elements within the promoter of the tobacco late pollen gene g10. Plant Molecular Biology. 2001, 45, 577 – 585.) (Fig. 3).

The application of swede type rape promotor P17673 in transgenic arabidopsis plant flower pesticide, the steps include:

The structure of A, P17673 plant expression vector and agrobacterium tumefaciens bacterial strain EHA105(are purchased from Hu Shang bio tech ltd, Shanghai, below identical) conversion:

The recombinant vectors building is that the 35S promoter on plasmid pBI121 (purchased from TaKaRa company, below identical) is obtained to the replacement of P17673 fragment with clone in technical scheme 1.For completing this object, first, utilize the primer with useful Xba I and Kpn I restriction enzyme site redesigning: P17673S/e:5-' CAGggtaccAGAAGACGATGGCGTCAATGT-3' and P17673A/e 5-GACAtctagaAATCACACGACCGATCAATATAAAA-3' increase P17673 sequence from pMD18-P17673 plasmid.PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is already described before 1.0%() agarose gel electrophoresis detection, gel reclaims after the recovery of test kit (already described above) purifying, with Xba I/ Kpn I (already described above) double digestion purify reclaim PCR product, cut pBI121(Chen with Xba I/Kpn I enzyme simultaneously, P.Y., Wang, C.K., Soong, S.C. To, K.Y.Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. Mol. Breed. 11, 287-293) plasmid.It is that 10 μ l endonuclease reactions carry out in 37 degree incubators that enzyme is cut system (already described) above, after about 4-6 hour, detects with 1.0% (already described above) agarose gel electrophoresis.PCR product enzyme is cut to large fragment (about 1900bp) DNA gel that rear fragment (size is 2100 bp, and already described before pBI121() enzyme cuts to be reclaimed test kit (already described) above and reclaims.In already described before PCR product endonuclease bamhi and pBI121() large fragment that cuts of enzyme is according to ratio (molar concentration rate) biased sample of (150ngPCR product endonuclease bamhi: 50ng large fragment)=3:1, adds T ₄dNA ligase 1 μ l, 10 × reaction buffer, 1 μ l, aseptic ddH ₂o supplements volume to 10 μ L, and 16 ℃ of connections are spent the night.Heat shock method (already described above) transforms after the competent cell (stating above) of gold bacterial strain, screening on solid LB substratum (the stating above) flat board that contains kantlex (50 μ g/mL), picking white bacterial plaque is before bacterium colony PCR(and is stated), extract plasmid (already described) above, cut the recombinant plasmid called after pBI-P17673 of checking size correct (2100bp) through enzyme.

Utilize freeze-thaw method (J. Pehanorm Brooker. D.W. Russell work, Huang Peitang etc. translate, molecular cloning test guide (third edition) Science Press, below identical) transform before Agrobacterium EHA105(already described): step is as follows:

1: get 0.2ml competence Agrobacterium, in ice, slowly melt.

2: add approximately 2 μ g recombinant plasmid dnas, mix gently, after ice bath 30min, drop into liquid nitrogen flash freezer 1min, then 37 ℃ of water-bath 5min, melt cell.

3: add 800 μ l not containing microbiotic LB liquid nutrient medium (already described) above, 28 ℃ of jogs are cultivated 4-5h.

4:12000rpm, 30s, removes supernatant, and cell is resuspended in 0.2ml LB liquid nutrient medium (already described) substratum above.

5: culture is uniformly coated on containing Rif(50mg/L), Str(50mg/L) on LB solid medium (already described above) agar plate and Kan(50mg/L), cultivate 2 days for 28 ℃, treat to occur on flat board bacterium colony, picking bacterial plaque, with bacterium colony PCR detection validation (already described above).

The functional analysis of B, P17673:

1, genetic transformation and the transfer-gen plant screening of P17673 plant expression vector pBI-P17673 in Arabidopis thaliana:

Adopt inflorescence infestation method (Zhang X.R. et al. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nature, 2006,1:1-6, below identical) carry out transformation of Arabidopsis thaliana.Already described before the agrobacterium tumefaciens EHA105(that preparation contains recombinant vectors pBI-P17673) bacterium liquid, proceed in the LB liquid nutrient medium (already described) that contains kantlex 50 μ g/ml, Rifampin 50 μ g/ml 28 ℃ of incubated overnight the day before yesterday above in conversion.Second day, under 276nm nano wave length, detect the light absorption value of bacterium liquid with ultraviolet spectrophotometer (SPEKOL 1300), in the time that reaching between 1.6-2.0, takes out the light absorption value of bacterium liquid.Room temperature (20-25 ℃, below identical), with the centrifugal 10min of 4000g, is abandoned supernatant, and precipitation is suspended in isopyknic 5% sucrose solution (mass volume ratio of sucrose and distilled water, below identical).Muddy sucrose solution is poured in a large culture dish, and before conversion, adding final concentration is 0.02%(volume ratio) Silwet l-77(purchased from the Five continents, Beijing unit industry science and trade center, below identical).Mix afterwards whole Arabidopis thaliana to be transformed inflorescence being immersed in sucrose gently, silent several 15 seconds, take out plant.Plant after conversion is wrapped with a black plastic bag, is placed on growth case and cultivates.Plastics bag was opened in second day, cultivate in the place that is placed on light intensity.Conversion tried again every one week.Cultivate and gather in the crops seed in about one month, seed is dry 3-5 days under incubator or daylight.The T0 that will transform results is for seed 70%(volume ratio) alcohol and 0.1%(mass ratio) mercuric chloride distinguish surface sterilization 3 minutes and 10 minutes, then with distilled water wash (5～7 times) for several times, then blow and beat to containing MS solid screening culture medium (MS macroelement mother liquor 100 ml that concentration is 50mg/L kantlex equably; MS trace element mother liquor 10 ml; Organic mother liquor 10 ml of MS; MS molysite 10 ml; Inositol 10 ml; Sucrose 30g; Adjust PH to 5.8 with 1M NaOH, 12g agar powder, is settled to 1L, and high pressure 121 is spent after sterilizing for subsequent use.Add 8g agar powder to can be configured to solid medium.Various mother liquor formulas are in table 1) surface.4 ℃ of vernalization 4-6 days, put into constant incubator (photoperiod 16(daytime)/8(dark) hour, temperature: 22 ℃ of daytimes, 20 ℃ of dark cycles) to cultivate, the transformed plant that screening obtains, claims T1 for transformed plant (following identical).According to distinctive kalamycin resistance screening positive plant on expression vector.When blade grows to enough size (3-4 leaf phase), get a little green seedling leaf, extract DNA, carry out the PCR positive detection (following identical) of converting material.Primer is NPT II F:5 ' GATGGATTGCACGCAGGT3 ' and NPT II R:5 ' TCAGAAGAACTCGTCAAG3 ', and reaction system is that 10 μ l include: template DNA template 1 μ L (about 100ng), 10 × Taq buffer(is containing MgCl ₂) 1 μ l, 1.5mmol/L dNTP (10 mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, (5 U/ μ are 0.5 μ l l), ddH for Taq ₂o 5.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute, 32 circulations, 72 ℃ 10 minutes, amplification size be 800 bp.Result has shown to obtain transgenic positive plant (plant that contains testing goal fragment claims positive plant, below identical).

Table 1 MS substratum mother liquor formula

2, P17673 functional analysis:

Replace before pBI121(already described with P17673) 35S promoter sequence on plasmid, form pBI-P17673 recombinant plant expression vector, gus gene is wherein subject to the regulation and control of P17673.Utilize before agrobacterium tumefaciens EHA105(already described) inflorescence infestation method (already described above) arabidopsis thaliana transformation of mediation.Results T0 for seed after, obtain T1 through kalamycin resistance screening and detect to screen for transformed plant (already described above) and PCR and obtain positive plant (already described) above.

By PCR checking be positive T1 for transfer-gen plant seed contain before the MS(that concentration is 50mg/L kantlex already described) substratum upper seeding wheel, after 4 ℃ of vernalization, in growth case, sprout, sprouting condition: light application time 16 h, temperature: 22 ± 2oC, starts sampling dyeing after emerging 5 days.Dyeing course is as follows: sample is immersed in to GUS dye liquor (X-gluc 0.5mg/mL, phosphoric acid buffer 50mmol/L, the each 0.5mmol/L of the Tripotassium iron hexacyanide and yellow prussiate of potash, EDTA 10mmol/L, Triton-x-100 0.001%(volume ratio), methyl alcohol 20%(volume ratio) in, vacuum suction 5 minutes, 37 ℃ are spent the night.Within second day, decolour with alcohol-acetic acid (volume ratio is 1:1), until blade bleaches, use afterwards distilled water rinsing (5～7 times) for several times, Stereo microscope (OLYMPUS SZX16) is taken pictures.Get respectively seedling stage 5 days, 10 days, the whole plant of 15 days; Reproductive stage, blade is got tender leaf and mature leaf; Flower rounds the flower that inflorescence contained out and the bud of not opening; Angle fruit after fertilization 5 days, 10 days, the angle of 15 days and 20 days really.It is exactly the position that gus gene is expressed that plant is dyed to blue position.Explore the spatial and temporal expression pattern of P17673 by detecting the expressive site of gus gene under different space-time and expression intensity.

Result shows gus gene high efficient expression in the flower pesticide of Arabidopis thaliana of this promoters driven, but in seed, blade and root and stem, does not express (Fig. 6).Therefore, this promotor has the downstream gene of driving high efficient expression in plant anther, and does not express at seed and other positions.This promotor with tissue specific expression has good using value in plant genetic engineering and Transgene-safty (eating).As contained this promoters driven and cause by structure the carrier of the gene of Anther Abortion, transformation receptor plant, the artificial male sterile material of creating, be applied in the production of cross-breeding, or control transgenic plant by the elegant genetically modified escape causing of pollen, or some improves the gene of pollens nutrition composition by promoters driven, improve pollens nutrition etc.The gene simultaneously driving due to P17673 is not expressed in seed, therefore in seed, there will not be the protein product of external source quiding gene, has important using value in transgenosis food safety field.

The description of a kind of rape P17673 promotor full length sequence SEQ ID NO:1 functional expression in model plant Arabidopis thaliana different tissues.Utilize homologous sequence method clone to obtain 5 ' upstream sequence of swede type rape Bn17673 gene, through core promoter element and Upstream cis acting promoter prediction software http://www.fruitfly.org/seq_tools/promoter.html and PLACE (Higo et al., Plant cis-acting regulatory DNA elements (PLACE) database (J). Nucleic Acids Research.1999, 27:297～300) http://www.dna.affrc.go.jp/PLACE/ predicts, result shows that cloned promoter sequence contains TATA box core promoter sequence, the upstream promoter elements such as CAAT and flower specifically expressing element are as POLLEN1LELAT52 and GTGANTG10 (Fig. 3).In addition, fluorescent quantitation and GUS coloration result show P17673 drive native gene in stamen and flower pesticide, express, in other tissue, do not express (Fig. 1, Fig. 6).The native gene that this explanation P17673 drives is the gene of an efficient specifically expressing in rape flower pesticide, proves that P17673 is the promotor of efficient specifically expressing in a rape flower pesticide.

The application of swede type rape P17673 promotor in flower pesticide and the pollen granule of model plant Arabidopis thaliana, its process is: utilize homologous sequence method clone to obtain 5 ' upstream promoter sequence of rape Bn17673 gene.Build by already described before the plant expression vector pBI-P17673(of the reporter gene GUS of this promoter regulation).Adopt agriculture bacillus mediated florescence infestation method (already described) arabidopsis thaliana transformation above, T1 generation be added with before the MS(of kantlex already described) preliminary screening transfer-gen plant on substratum, when Arabidopis thaliana grows after two true leaves, be transplanted on vermiculite and continue to plant, when plant occurs after inflorescence, carry out PCR detection, utilize Molecular tools to identify positive strain.T2 is for selecting 10 transgenic lines to carry out GUS dyeing.GUS histochemical method dyeing shows, the gus gene of this promoters driven is expressed in the flower pesticide of Arabidopis thaliana and pollen granule.As can be seen here, the gus gene of this promoters driven has certain spatial and temporal expression specificity, has the downstream gene of driving and expresses in flower pesticide and pollen granule, does not express the function of (Fig. 6) in seed completely.This promotor with tissue specific expression has using value in manual creation germ plasm resource, rape and arabidopsis gene engineering and Transgene-safty (eating), as utilize this promotor to drive and the goal gene of pollen granule related to development, first build the over-express vector that P17673 drives goal gene, transform rape and Arabidopis thaliana acceptor plant, goal gene is under the driving of P17673 promotor, can improve the expression amount of goal gene in above-mentioned tissue, in seed, do not express completely, can not cause food-safety problem.

Described rape is any all can.

The present invention compared with prior art, has the following advantages and effect:

1, the root, stem, leaf, bud, ovule, angle fruit, angle pericarp, stamen, gynoecium, sepal, petal that the utilizes swede type rape high-throughput of totally 11 tissues transcribed group sequencing technologies, in conjunction with sequencing data of whole genome, by analysis, fast prediction goes out the candidate gene of a large amount specifically expressing in rape stamen, verifying by the method for fluorescent quantitation subsequently, is a kind of new organizing specific expression promotor method of acquisition of high efficient and reliable.

2, the promotor that the promotor cloning process providing is cloned into can be passed through regulation and control and histochemical analysis to gus gene, obtains the rape promotor with tissue specific expression function.

3, P17673 is in the security of rape edible oil with utilize genetically modified crops quality, and the aspects such as manual creation germ plasm resource have good application potential.Transgenic experiments proves, P17673 is high efficient expression in rape flower pesticide, pollen granule, in the tissues such as root, stem, leaf, fruit and seed, does not express.Can replace CaMV35S strong promoter to drive the gene relevant with pollen development by this promotor according to the characteristic applies people of this promoter expression, make pollen development genes involved overexpression in pollen, artificial sterile line, the restorer created, enriches germ plasm resource; Or the diffusion of inhibition foreign gene, prevent that gene from drifting about, and improves the biological safety of transgenic plant.Therefore, this promotor, in the security of rape transgenosis edible oil, improves the aspects such as crop quality aspect and manual creation germ plasm resource, has good application potential.

Accompanying drawing explanation:

Fig. 1 is a kind of expression pattern analysis chart of native gene of P17673 driving

Fig. 2 is a kind of homologous clone method amplification P17673 fragment electrophorogram.

Swimming lane 1 does not represent that genomic dna is template pcr amplification result; Swimming lane M represents the nucleic acid Marker of DL2000.

Fig. 3 is the analysis of P17673 promoter sequence

Shaded boxes represents primary element, and underscore represents the element that anther-specific expression is relevant

Fig. 4 is a kind of pBI-P17673 carrier schematic diagram of structure.

Fig. 5 is the part transfer-gen plant PCR evaluation figure of a kind of conversion carrier pBI-P17673

Swimming lane M represents the nucleic acid Marker of DL2000; Swimming lane 1 represents the pcr amplification result of pBI-P17673 positive plasmid; The pcr amplification result of the positive strain of swimming lane 2-18: the pcr amplification result of swimming lane 19 wild-type Arabidopis thalianas.

Fig. 6 is a kind of histochemical stain result of gus gene of P17673 driving.

A:15 day seedling (colourless); B: blade (colourless); C: stem (colourless)); D: angle fruit (colourless); E: bud (the blue look of flower pesticide); F: flower pesticide (the blue look of pollen granule).

Embodiment

According to following examples, can better understand the present invention, but described embodiment is in order better to explain the present invention rather than limitation of the present invention.

embodiment1:

Flower pesticide specific expression gene Bn17673 and promotor P17673 prediction:

The present invention's rape used is two No. 11 (already described above) in swede type rape.Be seeded in land for growing field crops for examination material, normal field management.The rapeseed plants of growing from grown in field condition is got root, stem, leaf, bud, ovule, angle fruit, angle pericarp, stamen, gynoecium, sepal, petal totally 11 tissues.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen flash freezer-80 ℃ of preservations.That utilizes Trirol extraction test kit (already described) above carries out the extraction of RNA according to the requirement of test kit.The RNA extracting is sent to BGI-Shenzhen and carries out reverse transcription, build storehouse and and utilize solexa sequencing technologies (already described) to carry out above and transcribe group examining order.Each organizes sequencing data amount is already described before 10G().After order-checking, with the gene expression abundance of RPKM value (already described above) icp gene in different tissues.RPKM calculation formula is as follows: RPKM=(109 × C) ÷ (N × L) wherein C is the reads number of comparison to certain gene; N is total reads number that sample is compared all genes; L is mrna length.RPKM value is higher shows that the expression level of this gene is higher.By the RPKM value of all genes of rape in above-mentioned 11 tissues relatively, discovery Bn17673 RPKM value in bud is 212.56, and in stamen, RPKM is 1338.78, and RPKM value in all the other 9 tissues is 0.Illustrating that Bn17673 may be the gene of an a large amount specifically expressing in stamen, is a new stamen specific expression promoter and drive the P17673 of this gene.

embodiment2:

The expression pattern analysis of the native gene that rape P17673 drives:

Be seeded in land for growing field crops for examination material, normal field management.In the rape of growing from grown in field condition, two No. 11 (as previously mentioned) plant are got root, stem, leaf, bud, angle fruit, gynoecium, stamen, petal.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen-80 ℃ of preservations.Already described before extraction RNA(method).Quantitative real time PCR Instrument is IQ5(Bole company), adopt rape Actin(accession number AF111812) as internal standard gene, Actin gene primer be forward primer 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and oppositely draw 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.The native gene Bn17673 primer that P17673 drives is 5'ACAAATACTTGGTCCCACGAGA 3' and 5'ACCCGTTTGAGGAAGTGTGTTA 3'.Quantitative fluorescent PCR reaction system is 20 μ L: contain SYBR Mix 10 μ L, and the each 0.8 μ L of forward and reverse primer (10 μ mol/L), template 2 μ L, the sterilized water that DEPC processed complements to 20 μ L.Amplification condition is: 94 ℃, and 5 min:94 ℃, 15 s, 60 ℃, 20 s, 72 ℃, 30 s, 40 circulations; Eachly be circulated in 72 ℃ of renaturation ends and carry out fluoroscopic examination.Reaction finishes to be first heated to 95 ℃ afterwards, is then down to 72 ℃, is more slowly warming up to 95 ℃, records the variation of fluorescent signal, draws the melting curve of amplified production.Every group of experiment all completes three biology and repeats, and each biology repeats at least to do three technology and repeats.Detect respectively the expression of native gene in Oil Rape Tissue (root, stem, leaf, bud, angle fruit, gynoecium, stamen, petal) that P17673 drives.

With the relative expression quantity that compares Ct method (DDCt) calculating gene.Utilize software that instrument is with, first optimize internal standard gene and goal gene amplification condition, measure respectively the Ct value of Actin and goal gene, choosing three results (systematic error of Ct value is less than 0.3) that approach the most in nine measured value of experiment averages, then by internal standard gene, goal gene is proofreaied and correct and obtained DDCt, finally by 2 ^-DDCtrelative expression quantity and the systematic error (already described above) of estimation goal gene.Calculating when relative expression quantity, take the expression level of reference gene Actin as reference, convert 1 to by its value, other sample again with its relatively, obtain relative expression's value.

Result shows: the native gene that P17673 drives a large amount in bud and stamen is expressed (Fig. 1), in other tissue, does not express.The native gene that this explanation P17673 drives is the gene of a high efficient expression in stamen, proves that P17673 is a stamen high efficient expression starter.

embodiment 3:

A preparation method for swede type rape promotor P17673 promotor, the steps include:

1, the primer sequence of rape promotor P17673:

The Bn17673 upstream region of gene 2.2kb sequences Design 1 obtaining according to rape genome sequencing is carried out pcr amplification to primer, the primer of employing be P17673S:5 '-AGAAGACGATGGCGTCAATGT-3' and P17673A:5 '-AATCACACGACCGATCAATATAAAA-3 '.

2, the preparation of rape promotor P17673:

Utilize SDS cracking process (already described) to extract rape leaf genomic dna above, carry out pcr amplification as template, step is: extract genomic dna 25 μ l, increase as template, reaction system is 50 μ l, add respectively 10 × Ex Taq buffer, 5 μ l, dNTP 4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq 0.5 μ l, the about 100ng of DNA masterplate 1 μ l, ddH ₂o 37.5 μ l.The Bn17673 upstream region of gene 2.2kb sequences Design PCR the primer obtaining according to rape genome sequencing be P17673S:5 '-AGAAGACGATGGCGTCAATGT-3' and P17673A:5 '-AATCACACGACCGATCAATATAAAA-3 '.Amplified production size is 2113 bp, PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is already described before 1.0%() agarose gel electrophoresis detection, gel reclaims after the recovery of test kit (already described above) purifying, be connected to pMD18-T carrier (already described) above, heat shock method (already described above) transforms the competent cell (already described) of gold bacterial strain above, coat contain before penbritin 50 μ g/mL(already described) LB solid medium (already described above) flat board on, 37 ℃ of overnight incubation, select 6 of hickies, adopt M13 primer: 5 ' TGTAAAACGACGGCCAGT3 ' and 5 ' CAGGAAACAGCTATGACC3 ', be bacterium colony PCR and detect (already described) above, already described before 1.0%() after agarose gel electrophoresis detected magnitude is correct.Bacterial plaque correct PCR detected magnitude is inoculated into the liquid LB substratum (already described) containing penbritin 50 μ g/mL above, at 37 ℃, 200 r/min shaking culture are spent the night, alkaline process (already described above) extracts plasmid in a small amount, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (being 1960 bp), adopt Kpn I/Xba I enzyme (already described) to cut above plasmid is carried out to double digestion (already described) above, it is 10 μ l that enzyme is cut system (already described) above, 37 ℃ are spent the night, already described before 1.0%() agarose gel electrophoresis detects.Detect correct positive recombinant clone, already described before called after pMD18-P17673(), pMD18-P17673 is served to Hai Yingjun company and check order, pMD18-P17673 is served to Hai Yingjun company sequencing, analytical results, obtains P17673 full length sequence, name P17673.A promotor for separation, its series be the nucleotide sequence shown in SEQ ID No.1 or with the SEQ ID No.1 nucleotide sequence of homology in fact.

3, the structure of rape P17673 recombinant expression vector and agrobacterium tumefaciens transform:

Utilize the primer with useful Xba I and Kpn I restriction enzyme site redesigning: P17673S/e:5-' CAGggtaccAGAAGACGATGGCGTCAATGT-3' and P17673A/e 5-GACAtctagaAATCACACGACCGATCAATATAAAA-3' increase P17673 sequence from pMD18-P17673 plasmid.PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is already described before 1.0%() agarose gel electrophoresis detects, after gel reclaims test kit (already described) purifying above and reclaims, purify with Xba I/ Kpn I (already described) double digestion the PCR product reclaiming above, cut before pBI121(already described with Xba I/Kpn I enzyme simultaneously) plasmid.Gel reclaims before the P17673 fragment that scales off of enzyme and pBI121(already described) fragment, connect, heat shock method (already described above) transforms intestinal bacteria, is built into before plant expression vector pBI-P17673(already described) (Fig. 4).Finally use freeze-thaw method (already described) that this carrier is imported before agrobacterium tumefaciens EHA105(already described above), select positive colony containing (already described) on kantlex (50mg/L) and the dual anti-property of Rifampin (50mg/L) LB flat board above, with already described before bacterium colony PCR() whether checking contain target fragment.

embodiment4:

The transformation of Arabidopsis thaliana of pBI-P17673 and PCR detect:

Adopt inflorescence infestation method (already described) arabidopsis thaliana transformation above, according to the peculiar kalamycin resistance of transfer-gen plant, contain before the MS(that concentration is 50mg/L kantlex already described) grow on substratum, the green seedling of acquisition is tentatively thought transformed plant.Plant to be transformed grows after two true leaves, is transplanted in vermiculite, and plant to be planted occurs after inflorescence, gets a slice true leaf SDS method and extracts genomic dna (already described) above, is PCR and identifies.Primer sequence is already described before NPT II F and NPT II R(), PCR reaction system is as follows: template DNA 1 μ L (about 100ng), 10 × Taq buffer(are containing MgCl ₂) 1 μ l, 1.5mmol/L dNTP (10 mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, (5 U/ μ are 0.5 μ l l), ddH for Taq ₂o 5.5 μ l.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 2min 32 circulate, and 72 ℃ are extended 5min.By 1% sepharose (already described above) electrophoresis detection PCR reaction product, size is 800bp.Result shows that P17673 expression vector pBI-P17673 has successfully proceeded to Arabidopis thaliana (Fig. 5), obtains altogether the positive seedling of 20 strains.

embodiment5:

The functional analysis of swede type rape P17673 promotor:

The present invention clones the sequence that obtains P17673 first, and it has been carried out to functional analysis.From embodiment 4, detect (above already described) by model plant transformation of Arabidopsis thaliana (already described) and PCR above and screen the positive seedling T1 generation obtaining, selfing results seed (being T2 generation).At different times, the different tissues of getting T2 generation 10 strain transformed plants carries out GUS dyeing.

It is as follows that in T2 generation, is got dyeing course: sample is immersed in to GUS dye liquor (X-gluc 0.5mg/mL, phosphoric acid buffer 50mmol/L, the each 0.5mmol/L of the Tripotassium iron hexacyanide and yellow prussiate of potash, EDTA 10mmol/L, Triton-x-100 0.001%, methyl alcohol 20%(volume ratio) vacuum suction 5 minutes, 37 ℃ are spent the night.Within second day, decolour with alcohol-acetic acid (volume ratio is 1:1), until blade bleaches, use afterwards distilled water rinsing 3-5 time, Stereo microscope (OLYMPUS SZX16) is taken pictures.Get the whole plant of different time sections seedling stage; Reproductive stage, blade is got tender leaf and mature leaf; The flower that flower took away; Angle fruit is got the angle fruit of different times; Seed takes away the seed of spending latter about 10 days.It is exactly the position that gus gene is expressed that plant is dyed to blue position.

Coloration result is found (asking for an interview table 2, Fig. 6), does not all occur bluely in seedling, root, stem, blade and angle fruit, only has in the flower pesticide of open bud and pollen granule and occurs significantly blue reaction.As can be seen here, the gus gene of this promoters driven is mainly expressed in flower pesticide and pollen granule thereof, in other tissue, does not express.

Experimental result shows, rape P17673 has following biological function: the gus gene of this promoters driven is expressed in the flower pesticide of Arabidopis thaliana and pollen granule, in other tissue, does not express.Gus gene under P17673 regulation and control has certain spatial and temporal expression characteristic, and this explanation P17673 has the function that drives downstream reporter gene GUS to express in recipient plant.Under the regulation and control of this promotor, GUS gene can be mainly meticulous expression in the flower pesticide of transfer-gen plant and pollen granule thereof, and in other tissue, do not express (asking for an interview table 2, Fig. 6) completely.

Table 2 P17673 transgenic arabidopsis T2 is for the GUS dyeing cartogram of strain

Strain number

Positive

Root

Stem

Blade

Flower pesticide

Angle fruit

Pollen granule

Ovule

Wild-type (CK)

NO

NO

NO

NO

NO

NO

NO

NO

P17673- 1

YES

NO

NO

NO

YES

NO

YES

NO

P17673-2

YES

NO

NO

NO

YES

NO

YES

NO

P17673-3

YES

NO

NO

NO

YES

NO

YES

NO

P17673-4

YES

NO

NO

NO

YES

NO

YES

NO

P17673-5

YES

NO

NO

NO

YES

NO

YES

NO

P17673-6

YES

NO

NO

NO

YES

NO

YES

NO

P17673-7

YES

NO

NO

NO

YES

NO

YES

NO

P17673-8

YES

NO

NO

NO

YES

NO

YES

NO

P17673-9

YES

NO

NO

NO

YES

NO

YES

NO

P17673 - 10

YES

NO

NO

NO

YES

NO

YES

NO

This promotor with tissue specific expression has using value in rape and arabidopsis gene engineering and Transgene-safty (eating).

The application of a kind of swede type rape P17673 promotor in flower pesticide and the pollen granule of rape and Arabidopis thaliana.Utilize homologous sequence method clone to obtain 5 ' upstream promoter sequence of rape Bn17673 gene.There is core parts and the upstream element of promoter expression through bioinformatic analysis this promoter sequence, build by already described before the plant expression vector pBI-P17673(of the reporter gene GUS of this promoter regulation).Adopt agriculture bacillus mediated florescence infestation method arabidopsis thaliana transformation, T1 generation be added with before the MS(of kantlex already described) preliminary screening transfer-gen plant on substratum, when Arabidopis thaliana grows after two true leaves, be transplanted on vermiculite and continue to plant, when plant occurs after inflorescence, carry out PCR detection, utilize Molecular tools to identify positive strain.T2 is for selecting 10 transgenic lines to carry out GUS dyeing.GUS histochemical method dyeing shows, the gus gene of this promoters driven is expressed in the flower pesticide of Arabidopis thaliana and pollen granule thereof.As can be seen here, the gus gene of this promoters driven has certain spatial and temporal expression specificity, has the downstream gene of driving and expresses in flower pesticide and pollen granule thereof, does not express the function of (Fig. 6) in other tissue completely.This promotor with tissue specific expression has good using value in plant genetic engineering and Transgene-safty (eating), as utilize this promoters driven pollen fertility or the goal gene relevant with oleaginousness, first build the over-express vector that P17673 drives goal gene, transformation receptor plant, goal gene is under the driving of P17673 promotor, in flower pesticide and pollen granule thereof, express, can improve the expression amount of goal gene in above-mentioned tissue, in seed, do not express completely, can not cause food-safety problem.

SEQ ID No．1

<110> Inst. of Oil Crops, Chinese Academy of Agriculture

<120> swede type rape P17673 promotor and preparation method and its application

<130> swede type rape P17673 promotor and preparation method and its application

<160> 1

<170> PatentIn version 3.1

<210> 1

<211> 2113

<212> DNA

<213> swede type rape P17673 promotor and preparation method and its application

<400> 1

aagacgatgg cgtcaatgtc tctctccttt tcttcttcgc tatgctcatc tcgactcccc 60

gaatcaaaac gcagattcca ccagagagaa ccaaccttcg cgcgatgcgt tctcgccgct 120

tcgaaatcct ctccgggagg aggaggcgcc tccgccacga caaagaagag actctggaaa 180

gaaggagagt tccccggaat cacggagcat gctaacactc gaagagctcc gatgaagaac 240

gtgaagaaga agctcgacag gaggagcaaa gccaacgggt gggcttgcac cgtcaccgaa 300

acgttatccg atctcatcgc caagaagcag tggctgcaag ctctcgaggt gattcagtaa 360

agtttgaatc tttttgaatt aaaaatgatt ttgattcagt aaagtttgaa tctttttgaa 420

ttaaaaatga tttgattcaa taaagtttga atcttttttg agtgaatggt gatttgattc 480

aattgggtgt ttccaggtgt tcgagatgct gagggagcaa ccgttttatc aaccaaagga 540

agggacttac atgaagcttc tcgttctttt ggggaaatca ggacagcctc accgtgcaca 600

gaaggtgttc gacgaaatgc ttgaagaagg actcgaaccc accgctgagc tctacactgc 660

tctactcggt gcttactgtc gtagcaatct tatagactct gctttctcag ttcttgaacg 720

gatgaaagcc ttgcctcagt gtcaacctga tgtttacaca tacagtactc tcctcaaggc 780

gtgtgtggac gcttctttat ttgatttggt tgagtctttg tatagagaga tggatgagcg 840

tttgataact ccaaacactg tgactcaaaa catagttttg agcgggtacg ggagagttgg 900

gaggtttgat cagatggaga aagttttatc cgatatgctg gtgagtactg agtgtaagcc 960

tgatgtgtgg acgatgaaca ttatcctcag cgtgtttggg aacatgggga agatagacat 1020

gatggagagc tggtacgaga agttcaggaa cttcgggatc gagcctgaga ctcggagttt 1080

caatatcttg atcggtgcgt atgggaagaa gagaatgtat gataagatgt cgtccgtgat 1140

ggagtacatg cgtaagcttg agtttccttg gacgacgtcg acttacaaca acatcatcga 1200

ggcgtttgcg gatgtgggtg atgccaagaa catggagtac acgtttgatc agatgcgtag 1260

cgaaggtatg aaggcggaca cgaagacgtt ttgctgtctc attaatggat acgccaacgc 1320

tggtcttttc cataaggtga taagtagtgt tcagttagct gcgaagtttg agatacctga 1380

gaatacttct ttttataatg cggttatatc ggcgtgtgcc aaagcggatg atcttataga 1440

gatggagaga gtgtacacga ggatgaagga gagggaatgt gtgagggatt caagaacgtt 1500

tgagatcatg gtggaggcgt atgagaagga aggtatgaat gataagatct attacttgga 1560

gcaagagagg caaaaggtta tggatcatca tgctgcagct actaaagagg aggagaatct 1620

ccctcgatga ttgcaaggag agtggagata ttgaaagaat cattctcttg gattgaaaca 1680

gtagaattaa aagagagttt gtaatacact tggattgttc ttgcagctat gtgtataaag 1740

cttttcttgt tttggttatg ttgaatgtta tctcattctc ttgcgtgttt tcattatggg 1800

ccgtaaaatt atatattagg cccaaaaaag cccagtaact gcttgtctat tctataaata 1860

tgcatcatct ttctctcttt gttttttctt gtcaaataat caaacgaacc accaaaagaa 1920

aagttgaaga cattcttctg ctctgcaaag acaaaaacaa acagcttaga tcggtcggaa 1980

ttattcgccg gaaatatata atgggaactg ttgtcaagtc tttcaaggat caattctcag 2040

ctggtttgtt ccggttaatc tctctttttg attgatgaat cactctcttt ttatattgat 2100

cggtcgtgtg att 2113

Claims (7)

1. a promotor P17673 for separation, its sequence is the nucleotide sequence shown in SEQ ID No.1.

2. the promotor of a kind of separation according to claim 1, is characterized in that: described promotor contains recombinant vectors pBI-P17673.

3. the preparation method of a kind of swede type rape promotor P17673 claimed in claim 1, the steps include:

(1) primer sequence of rape promotor P17673:

The BnCP51 upstream region of gene 2.2kb sequences Design 1 obtaining according to rape genome sequencing is carried out pcr amplification to primer, amplification obtains 5 ' the upstream promoter sequence of rape Bn17673, the primer be P17673S:5 '-AGAAGACGATGGCGTCAATGT-3' and P17673A:5 '-AATCACACGACCGATCAATATAAAA-3 ';

(2) preparation of rape promotor P17673:

Utilize SDS cracking process to extract rape leaf genomic dna, carry out pcr amplification as template, step is: extract rape genomic dna 25 μ l, as template, adopt primer P17673S and the P17673A of step (1) design to increase, reaction system is 50 μ l, adds respectively 10 × Ex Taq buffer, 5 μ l, dNTP 4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq 0.5 μ l, DNA masterplate 1 μ l100ng, ddH ₂o 37.5 μ l, amplified production size is 2113bp, PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product detects through 1.0% mass volume ratio agarose gel electrophoresis, gel reclaims after the recovery of test kit purifying, be connected to pMD18-T carrier, heat shock method transforms the competent cell of gold bacterial strain, picking positive colony, PCR detects the positive and enzyme is cut the rear order-checking of checking, obtain goal gene upstream 2kb flanking sequence, the promotor full length sequence that is Bn17673 through this sequence of bioinformatic analysis, called after P17673.

4. the application of the promotor P17673 of a kind of separation described in claim 1 in rape flower pesticide.

5. the application of the promotor P17673 of a kind of separation described in claim 1 in Arabidopis thaliana flower pesticide.

6. the application of the promotor P17673 of a kind of separation described in claim 1 in rape flower powder.

7. the application of the promotor P17673 of a kind of separation described in claim 1 in thaliana flower powder.

Images