CN103789313B - Swede type rape P76247 promotor and preparation method and application - Google Patents
Swede type rape P76247 promotor and preparation method and application Download PDFInfo
- Publication number
- CN103789313B CN103789313B CN201410058108.6A CN201410058108A CN103789313B CN 103789313 B CN103789313 B CN 103789313B CN 201410058108 A CN201410058108 A CN 201410058108A CN 103789313 B CN103789313 B CN 103789313B
- Authority
- CN
- China
- Prior art keywords
- rape
- promotor
- gene
- plant
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of swede type rape P76247 promotor and preparation method and application.Its step: the <i>Bn76247</iGre atT.GreaT.GT upstream region of gene 2kb sequences Design 1 pair of primer 1, obtained according to rape genome sequencing carries out pcr amplification, 5 ' the upstream promoter sequence of amplification rape <i>Bn76247</iGre atT.GreaT.GT; 2, the preparation of rape promotor P76247: utilize SDS cracking process to extract rape leaf genomic dna, as template, pcr amplification is carried out with the primer of described design above, after Gel Extraction kit reclaims, be connected to pMD18-T carrier, obtaining goal gene upstream 2kb flanking sequence, is P76247 through this upstream flanking sequence of bioinformatic analysis.Quantitative fluorescent PCR and GUS coloration result show <i>P76247</iGrea tT.GreaT.GT high expression in rape stamen and petal, do not express in the tissues such as root, stem, leaf, fruit and seed.This promotor, in the security of rape transgenosis edible oil, improves the aspect such as crop quality aspect and manual creation germ plasm resource, has good application potential.
Description
Technical field
The present invention relates to plant genetic engineering and biological technical field, more specifically relate to a kind of swede type rape Bn76247 gene promoter (called after P76247, identical below), also relate to a kind of preparation method of swede type rape P76247 promotor simultaneously.The carrier also related to containing this promotor or its essence homologous nucleotide sequence utilizes the application of this promotor in rape and arabidopsis gene engineering with relating to.
Background technology
Plant gene promoter is positioned at structure gene 5 ' to hold upstream, section of DNA sequence containing cis-acting elements, decides specificity that downstream gene transcribes, direction and efficiency, is the factor of most critical in gene transcription regulation mechanism and expression pattern.In addition, it is the key that plant genetic engineering is studied that foreign gene is expressed in vegetable cell, and first the expression of foreign gene depends on its startup of transcribing, and to a certain extent, promotor determines sequence of time and space and the expression intensity of genetic expression.Therefore, excavation and research Novel promoter have very important scientific meaning for gene expression regulation Mechanism Study and transgenic research.
By finding the analysis of various plants gene promoter area, the promotor of most functional protein gene all has common structural pattern, is generally made up of core promoter element and upstream element.The TATAbox being positioned at transcription initiation site upstream-20--30bp place is core promoter element, it is the conserved sequence district of being rich in AT, relevant with unwinding of DNA double chain, and determine the selection of transcripting start point, be that most plant promoter correction is necessary.The conserved sequence of TATAbox upstream is called promotor upstream element, comprise generally upstream promoter element and other the special upstream elements such as GCbox near CAATbox and-80--110bp that upstream-75bp locates, as element (Zhang Chunxiao etc., Review on Plant Gene Promoters such as jasmonate response element (JRE), ethylene response elements (ERE).Acta Genetica Sinica, 2004,31(12): 1455-1464; Road is waited quietly, Plant Promoter and applied research progress thereof.Natural science is in progress, 2004,14(8): 856-862).CAATbox is the sequence relatively guarded, and with the identification of RNA polymerase with in conjunction with relevant, has stronger activation to genetic transcription.But some gene is without this frame, as replaced by CATC frame without CAAT box in the storage protein gene of cereal crop.The conserved sequence of GCbox is 5 ' GGGCGG3 ', can have multiple copy, and (road is quiet, Zhao Huayan, He Yikun, Song Yanru, Plant Promoter and applied research progress thereof not affect its function with the existence of any direction.Natural science is in progress, 2004,14(8): 856-862; The summer east of a river, Chen Quan, Wu Yusheng, Ji Pengzhang, Plant Promoter function and structure progress.Yunnan Prov Agriculture University's journal, 2006,21(1): 7-14).As long as be provided with the structural frames that these are conservative, the corresponding function starting downstream gene expression so just can be had.
Transcriptional profile according to plant promoter can be divided into constitutive promoter, tissue specific promoter and inducible promoter.The foreign gene that constitutive promoter drives is stably express in all developmental stages and tissue of transfer-gen plant.To the conversion of many dicotyledonss, usually the plasmid vector of the 35S promoter from cauliflower mosaic virus (CaMV) or the nopaline synthase no promotor from bacterium is all used, and the most frequently used in monocot transformation be containing rice actin Act promotor, the plasmid vector of maize ubiquitin Ubi promotor and 35S promoter (Guan Liying etc., the effective expression of foreign gene and safety evaluation thereof in transgenic plant.Capital Normal University's journal, 2002,23(2): 52-56).But many times the lasting high expression of foreign gene in recipient plant not only causes the waste of the energy in organism, and in a organized way in expression likely to plant itself, there is toxic action, even cause Transgene-safty problem (JiaS-R.Environmentandfoodbiosaftyassessmentoftransgenicp lants.AdvancedofBioengineer.1997,17:37-42; MorrisSH, AdleyC.C.Irishpublicperceptionsandattitudestomodernbiote chnology:anoverviewwithafocusonGMfoods.TrendsinBiotechno logy.2001,19:43-48).Therefore, the investigation and application of inducible promoter and tissue-specific promoter is subject to the attention of breeder day by day.The inducible promoter identified in transgenic plant mainly comprises abiotic stress inducible promoter, (Nie Lina etc., the clone of plant gene promoter and the Research progress on Function thereof such as biotic inducible promoter and hormone inducible promoter.Plant genetic resources journal, 2008,9 (3): 385-391).But the application of inducible promoter also has a definite limitation, to the external condition process that recipient plant carries out, as heat shock, HORMONE TREATMENT etc. may cause a series of biochemical reactions in organism and be unfavorable for the normal growth of plant.In addition, Methylprednisone acetate (the dex of inductor is used as in chemical regulation system, dexamethasone), estradiol (estradiol) and tsiklomitsin (tetracycline) be all harmful to ecotope, should not for the production of practice.Use the tissue-specific promoter of itself in plant materials just can avoid this problem, obviously, the tissue specific expression of foreign gene effectively will improve the biological safety of genetically modified crops (Song Yang etc., the research of plant tissue specificity promoter.Biotechnology is circulated a notice of, and 2007, (4): 21-24).
In the last few years, make significant headway about tissue-specific promoter's research, these tissue-specific promoters mainly comprise the reproductive organ specific expression promoters such as organ specific expression promoter and pollen, floral organ, fruit, seed such as blade, phloem, vascular bundle and root, and (Song Yang etc., plant tissue specificity promoter is studied.Biotechnology is circulated a notice of, and 2007, (4): 21-24).As Ariizumi etc. has been separated LTP12, the promotor of XTH3 and PGA4 arabidopsis thaliana transformation, GUS dyeing shows that these 3 promotors are anther specific expression promoter, and expression there are differences (Ariizumietal in different periods, Comparativestudyofpromoteractivityofthreeanther-specific genesencodinglipidtransferprotein, xyloglucanendotransglucosylase/hydrolaseandpolygalacturo naseintransgenicArabidopsisthaliana.PlantCellReport.2002, 21:90 – 96).In sesame, clone obtains the promotor of microsomal oleate dehydrogenase gene (FAD2), E-box with the G-box element that forecast analysis shows in this promotor is relevant with the biosynthesizing of triacylglycerol.Express by detecting gus gene after arabidopsis thaliana transformation, result shows this promotor specifically expressing (MiJungKimetal.Seed-specificexpressionofsesamemicrosomalo leicaciddesaturaseiscontrolledbycombinatorialpropertiesb etweennegativecis-regulatoryelementsintheSeFAD2promotera ndenhancersinthe5'-UTRintron.MolecularGeneticsandGenomic s.2006,276:351-368) in seed.Geng An very waits and from turnip type rape, swede type rape, tender flower stalk, wild cabbage, has been separated 4 promotors and transformation of tobacco, GUS staining analysis its be the promotor (Gengetal.Expressionanalysisoffourflower-specificpromoter sofBrassicaspp.intheheterogeneoushosttobacco.AfricanJour nalofBiotechnology.2009,8 (20): 5193-5200) of floral organ specifically expressing.In addition, conversion of plant after tobacco anther Tapetum specific expression genes promotor TA29 and nuclease gene Barnase, RnaseT1 merge by Mariani etc., nuclease gene is specifically expressing in flower pesticide, and destroy tapetum, obtain male sterile tobacco and rape (MarianiC.etal.Inductionofmalesterilityinplantsbyachimaer icribonucleasegene.Nature, 1990,347:737-741).Current TA29 promotor has been applied and succeed (Song Yang etc., the research of plant tissue specificity promoter on the plants such as tobacco, corn, rape, Arabidopis thaliana, paddy rice.Biotechnology is circulated a notice of, and 2007, (4): 21-24).As can be seen here, even if internal milieu between different plants is different and exist between gene and make difference mutually, even the plant larger with Arabidopis thaliana nature difference, as long as have conservative core starting region and corresponding conservative controlling element, the biological function starting downstream gene expression just can be played in other different plants.
In recent years, to the functional study of promotor, the method that lot of documents report adopts is normally first with information biology tentative prediction with after analyzing promoter sequence, again by promoter fragment and reporter gene fusion construction of expression vector, the Cells In Vitro of transformation mode plant Arabidopsis thaliana, tobacco, paddy rice etc. or plant materials, then analyze the function of promotor by the expression of examining report gene in trans genie individual and be used.The promotor of a large amount of bibliographical information display other plants is transformed in above-mentioned plant all can exercise its biological function normally, as: the promotor of the microsomal oleate dehydrogenase gene (FAD2) of cloning in sesame, E-box with the G-box element in this promotor is relevant with the biosynthesizing of triacylglycerol.Expression (the MiJungKim of seed-specific is also show in transgenic arabidopsis and other transgenic plant, HeejaKim, MiChungSuh.Seed-specificexpressionofsesamemicrosomalolei caciddesaturaseiscontrolledbycombinatorialpropertiesbetw eennegativecis-regulatoryelementsintheSeFAD2promoterande nhancersinthe5 '-UTRintron.MolecularGeneticsandGenomics.2006,276 (4): 351-368).The ZmGLU1 gene promoter of cloning from corn, be converted in tobacco after connecting gus reporter gene, detect the ZmGLU1 promoters driven of analytical results corn gus gene at tobacco root high expression (RiliangGu, LiZhao, GuoyingWang.Isolationofamaizebeta-glucosidasegenepromote randcharacterizationofitsactivityintransgenictobacco.Pla ntCellReports.2006,25 (11): 1157-1165).The promotor of one that is separated from potato TDF511 (tran-scriptderivedfragment) the gene Stgan closely similar with ethanol dehydrogenase.Build Stgan promotor-GUS fusion expression vector transformation of tobacco, GUS histochemical stain shows this promoters driven gene at tobacco stem tubercle place specifically expressing, tuber character process (TrindadeLM may be participated in, etal.Isolationandfunctionalcharacterizationofastolonspec ificpromoterfrompotato (SolanumtuberosumL.) .Gene, 2003,303:77-84.).These reports are all the examples utilizing transgenic technology to carry out promoter function analysis between different plants above, these examples show that Land use models plant Arabidopsis thaliana, tobacco etc. are as carrier, confirm that the function coming from the promotor of other plant is by extensive recognition and acceptance by the expression analysis of transfer-gen plant.
Rape, as the main oil crops of China, is extensively planted in the Yangtze valley, is had material impact to national economy.Along with the maturation of transgenic technology, transgene rape will inevitably face the public opinion of Transgene-safty risk.Being used in the promotor do not expressed completely in Semen Brassicae campestris is the feasible method addressed this problem to start the expression of goal gene, has both reached and has both improved rape each side quality, and do not caused again the object of edible oil security risk.
Present invention applicant to take part in by the Chinese Academy of Agricultural Sciences vegetables be responsible for, BGI-Shenzhen and Korea Spro, English, add, Australia, the Chinese cabbage genome sequencing that Mei Deng state related research institutes scientific research personnel has cooperated and analytical work, by oil plant institute of the Chinese Academy of Agricultural Sciences (being responsible for), vegetables institute of the Chinese Academy of Agricultural Sciences, BGI-Shenzhen, Hua Zhong Agriculture University, Hunan University, Agricultural University Of Southwest, Jiangsu academy of agricultural sciences, Sichuan academy of agricultural sciences, Qinghai University, and absorb English, Australia, beautiful, Fa Deng state related research institutes scientific research personnel cooperates the genome sequencing and the analysis that complete wild cabbage and rape, Chinese cabbage genome paper is delivered (TheBrassicarapaGenomeSequencingProjectConsortium.Thegeno meofthemesopolyploidcropspeciesBrassicarapa.NatureGeneti cs, 2011, 43:1035 – 1039), and wild cabbage and swede type rape sequencing data of whole genome also unexposed.Chinese cabbage, wild cabbage and swede type rape genome sequencing information have been set up can for the database http://www.ocri-genomicls.org/bolbase (ChengF of applicant's inquiry; LiuS; WuJ, FangL, SunS; LiuB; LiP, HuaW, WangX:BRAD.thegeneticsandgenomicsdatabaseforbrassicaplan ts.BMCPlantBiol; 2011,11:136; JingyinYu, MeixiaZhao, XiaowuWang, ChaoboTong, ShunmouHuang, SadiaTehrim, YumeiLiu, WeiHuaandShengyiLiu.Bolbase:acomprehensivegenomicsdataba seforBrassicaoleracea [J] .BMCGenomics, 2013,14:664).These sequencing data of whole genome for applicant utilizes high-throughout swede type rape organize transcript profile to check order, the gene of analyses and prediction a large amount specifically expressing in each tissue, and the promoter sequence obtaining these genes is thus laid a good foundation.
Therefore, the present invention, on swede type rape genome sequencing and transcript profile order-checking basis, develops a swede type rape endogenesis promoter.Fluorescence quantitative PCR detection shows that this gene is not expressed in the root of swede type rape, stem, leaf, angle fruit, and only in stamen and petal, a large amount is expressed.Prove that the native gene of promoters driven is not expressed in root, stem, blade, angle fruit by the expression characteristic of examining report gene GUS, in stamen and petal, a large amount is expressed.Our result imply that the promotor of this gene has a good application prospect in transgenic plant.
Summary of the invention
The object of the invention is to there are provided a kind of swede type rape P76247 promotor, fast prediction can go out the candidate gene that a large amount is expressed in rape petal and stamen, it is the new organizing specific expression promotor of a kind of acquisition of high efficient and reliable, derive from the endogenous tissue-specific promoter of rape and can accurately locate regulated and controled gene, drive goal gene in the particular organization of transgene rape or express period, avoid the waste causing plant self energy and material, improve the expression efficiency of foreign gene in transgenic plant, limit its expressive site, this promotor can be applicable to genetically engineered research and the safe transgenic research of seed rape of plant.
A further object of the invention is the preparation method that there are provided a kind of swede type rape P76247 promotor.Simple to operate, result is reliable and stable.The method with to swede type rape genomic dna for template, carry out pcr amplification, obtain swede type rape P76247 sequence.
3rd object of the present invention there are provided a kind of recombinant vectors of expressing promotor containing plant efficient, and it contains described promotor nucleotide sequence.This carrier size is applicable to, in plant easily with transform, with marker gene GUS expression intensity high, easily detect.The Arabidopis thaliana transfer-gen plant of gus gene high expression in plant can be obtained by this vector Arabidopis thaliana.
4th object of the present invention there is provided the application of a kind of swede type rape P76247 promotor in rape and Arabidopis thaliana stamen and petal.Under the driving of this promotor, goal gene is meticulous expression in the stamen and petal of plant mainly, does not express at other position.This promotor with tissue specific expression creates the genetically engineered such as sterile line, manual creation germ plasm resource and Transgene-safty (edible, pollen drift) plant and utilizes in genetic engineering technique manual change ornamental plant pattern and petal form has good using value.
To achieve the above object, the present invention adopts following technical scheme:
In order to obtain the present invention, the swede type rape root that contriver utilizes transcript profile order-checking to obtain, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal totally 11 Gene Expression Profiles data, in conjunction with sequencing data of whole genome, verified by prediction and quantitative fluorescent PCR, obtain a new promotor.Native gene high expression in the stamen and petal of plant of this promoters driven.
According to an aspect of the present invention, above-mentioned purpose can by providing a kind of promotor to realize, described promotor specificity can drive downstream gene high expression in plant, and described promotor contains SEQIDNo.1 nucleotide sequence or the nucleotide sequence with SEQIDNo.1 substantial homologous.
According to another aspect of the present invention, above-mentioned purpose can by providing the recombinant vectors of the nucleotide sequence containing described promotor to realize.
According to another aspect of the present invention, above-mentioned purpose can realize by providing the microorganism transformed with described recombinant vectors.
According to another aspect of the present invention, above-mentioned purpose can realize with the transgenic plant of described microbial transformation by providing.
A preparation method of swede type rape promotor P76247, the steps include:
A, stamen and petal high expression gene Bn76247 and promotor P76247 prediction:
The present invention's rape used is two No. 11 (BrassicanapusL., identical below) in swede type rape.Land for growing field crops is seeded in, normal field management for examination material.The rapeseed plants grown from grown in field condition gets root, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal totally 11 tissues.Three repetitions at least got by often kind of material, eachly repeat at least one strain, with masking foil parcel after sampling, are positioned over rapidly in liquid nitrogen flash freezer ,-80 DEG C of preservations.The extraction of RNA is carried out in the requirement according to test kit utilizing Trirol to extract test kit (purchased from TaKaRa company, identical below).Extract RNA be sent to BGI-Shenzhen carry out reverse transcription, build storehouse and and utilize solexa sequencing technologies (IlluminaSolexa sequencing technologies, biomedical engineering and clinical, 2011,15(2): 149, identical below) carry out transcript profile examining order.Each organizes sequencing data amount to be 10G(base number, below all with).After order-checking, with RPKM value (ReadsPerKilobasesperMillionreads, the identical below) gene expression abundance of icp gene in different tissues.RPKM calculation formula is as follows: RPKM=(109 × C) ÷ (N × L).Wherein C is the reads number that certain gene is arrived in comparison; N is the total reads number of sample comparison to all genes; L is mrna length.RPKM value is higher shows that the expression level of this gene is higher.By comparing the RPKM value of all genes of rape in above-mentioned 11 tissues, find that Bn76247 RPKM value in bud is 36.3, in stamen, RPKM value is 365.8, and in petal, RPKM value is 265.6, and the RPKM value in all the other 8 tissues is 0.Illustrate that Bn76247 may be the gene of a high expression in stamen and petal, and drive the P76247 of this gene to be a new stamen and petal high efficient expression starter.
The expression pattern of the native gene that B, P76247 drive:
In the rape grown from grown in field condition, two No. 11 (as previously mentioned) plant get root, stem, leaf, bud, angle fruit, gynoecium, petal, petal.Three repetitions at least got by often kind of material, eachly repeat at least one strain, with masking foil parcel after sampling, are positioned over rapidly in liquid nitrogen flash freezer ,-80 DEG C of preservations.The extraction of RNA is carried out in the requirement according to test kit utilizing Trirol to extract test kit (as previously mentioned).The explanation of reverse transcription reference reagent box is carried out (purchased from Takara company, identical below).
Quantitative real time PCR Instrument is IQ5(Bio Rad Laboratories), adopt rape Actin as internal standard gene (accession number AF111812), Actin gene primer is 5 ' CTGGAATTGCTGACCGTATGAG3 ' and 5 ' ATCTGTTGGAAAGTGCTGAGGG3 '.The native gene Bn76247 primer that P76247 drives is 5'TTTGTTACCGTGCTGCTCA3' and 5'AAAGCCGTCCATCTATCAT3'.
Quantitative fluorescent PCR reaction often group experiment all completes three biology repetitions, and each biology repeats at least to do three technology and repeats.Detect the expression of native gene in Oil Rape Tissue (root, stem, leaf, flower, angle fruit, gynoecium, petal, petal) that P76247 drives respectively.
With the relative expression quantity comparing Ct method (Δ Δ Ct) and calculate gene.By 2
-Δ Δ Ctthe relative expression quantity of estimation goal gene and systematic error (KennethJLivak.ThomasDSchmittgen.2001, AnalysisofRelativeGeneExpressionDataUsingReal-TimeQuanti tativePCRandthe2
-△ △ CtMethod.METHODS25,402 – 408).Obtain the expression values (Fig. 1) of relative Actin gene.
C, homologous sequence method clone P76247 sequence:
1, the primer sequence of rape promotor P76247:
Carry out pcr amplification according to Bn76247 upstream region of gene 2kb sequences Design 1 pair of primer that rape genome sequencing obtains, the primer of employing is P76247S:5 '-CTTAGTAGTTGTATCCACAGGTG-3' and P76247A:5 '-CTTGATCTATGTTAATGTTATATATG-3 '.
2, the preparation of rape promotor P76247:
SDS cracking process (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning texts guide (third edition) Science Press, identical below) is utilized to extract rape leaf genomic dna, carry out pcr amplification as template, step is: extract genomic dna 25 μ l, increase as template, reaction system is 50 μ l, add 10 × ExTaqbuffer5 μ l respectively, dNTP4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq0.5 μ l, DNA masterplate 1 μ l is about 100ng, ddH
2o37.5 μ l.Bn76247 upstream region of gene 2kb sequences Design PCR the primer according to the acquisition of rape genome sequencing is that P76247S and P76247A carries out pcr amplification, amplified production size is 1986bp(Fig. 2), PCR response procedures be 94 DEG C 5 minutes, 94 DEG C 1 minute, 59 DEG C 1 minute, 72 DEG C 2 minutes, 33 circulations, 72 DEG C 10 minutes, 16 DEG C 3 hours, PCR primer is through 1.0%(sepharose/TE solution quality volume ratio, identical below) agarose gel electrophoresis detection, gel reclaims test kit (purchased from root biochemical technology Beijing, sky company limited, identical below) purifying reclaim after, be connected to pMD18-T carrier (purchased from the precious biotechnology company limited in Dalian, identical below), heat shock method (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning texts guide (third edition) Science Press, identical below) transform the competent cell of gold bacterial strain (purchased from the precious biotechnology company limited in Dalian, identical below), coat containing penbritin 50 μ g/mL(mass volume ratio, identical below) LB solid medium (fill a prescription as follows: take 10 grams of Tryptoness respectively, 5 grams of yeast extracts and 10 grams of sodium-chlor, 8 grams of agar are dissolved in distilled water successively, constant volume is in 1000 milliliters.Be sub-packed in 500 milliliters of triangular flasks, 121 DEG C, autoclave sterilization 20 minutes under 6.859 × 104Pa.Be dispensed in culture dish, 4 DEG C of refrigerations are for subsequent use, identical below) on flat board, 37 DEG C of overnight incubation, select hickie 6, and adopt M13 primer: 5 ' TGTAAAACGACGGCCAGT3 ' and 5 ' CAGGAAACAGCTATGACC3 ', be bacterium colony PCR and detect.Bacterium colony PCR concrete grammar (following identical) does masterplate by a small amount of bacterial plaque of toothpick picking of sterilizing, and reaction system is that 10 μ L include: 10 × Taqbuffer(is containing MgCl
2) 1 μ l, 1.5mmol/LdNTP (10mmol/L) 1 μ l, 5 ' primer (10 μm of ol/L) 0.5 μ l, 3 ' primer (10 μm of ol/L) 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH
2o6.5 μ l.Reaction conditions be 94 DEG C 5 minutes, 94 DEG C 1 minute, 55 DEG C 1 minute, 72 DEG C 2 minutes 30 seconds, 33 circulations, 72 DEG C 10 minutes, amplification size is already described before 1960bp, 1.0%() after agarose gel electrophoresis detected magnitude is correct.LB liquid medium bacterial plaque correct for PCR detected magnitude be inoculated into containing penbritin 50 μ g/mL (is filled a prescription as follows: take 10 grams of Tryptoness respectively, 5 grams of yeast extracts and 10 grams of sodium-chlor, be dissolved in distilled water, constant volume is in 1000 milliliters, 121 DEG C, autoclave sterilization 20 minutes under 6.859 × 104Pa, identical below), at 37 DEG C, 200r/min shaking culture is spent the night, alkaline process (J. Pehanorm Brooker .D.W. Russell work in a small amount, Huang Peitang etc. translate molecular cloning texts guide (third edition) Science Press, identical below) extract plasmid, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (for 1960bp), (2 kinds of enzymes are purchased from TaKaRa company to adopt Kpn I/BamHI enzyme, identical below) cut and double digestion (following identical) is carried out to plasmid, it is 10 μ l that enzyme cuts system (following identical), comprise plasmid DNA 5 μ l, Kpn I 0.5 μ l, BamHI0.5 μ l, ddH
2o4 μ l, 37 DEG C are spent the night, already described before 1.0%() agarose gel electrophoresis detection.Object fragment P76247 is connected into pMD18-T vector construction by the correct Positive recombinant clones called after pMD18-P76247(of detection form, identical below), pMD18-P76247 is served Hai Yingjun company and check order, analytical results, obtain P76247 full length sequence, name P76247.
D, promoter sequence bioinformatic analysis:
By cloned P76247 sequence core promoter element and Upstream cis acting promoter prediction software http://www.fruitfly.org/seq_tools/promoter.html and PLACE (Higoetal., predict Plantcis-actingregulatoryDNAelements (PLACE) database (J) .NucleicAcidsResearch.1999,27:297 ~ 300.http: //www.dna.affrc.go.jp/PLACE).Result shows that cloned promoter sequence contains TATAbox core promoter sequence, the upstream promoter elements such as CAAT and flower specifically expressing element are as POLLEN1LELAT52 and GTGANTG10(BateN, TwellD.Functionalarchitectureofalatepollenpromoter:polle n-specifictranscriptionisdevelopmentallyregulatedbymulti plestage-specificandcodependentactivatorelements.PlantMo lecularBiology.1998, 37, 859 – 869.) and GTGANTG10 (RogersHJetal.Functionalanalysisofcis-regulatoryelementsw ithinthepromoterofthetobaccolatepollengeneg10.PlantMolec ularBiology.2001, 45, 577 – 585.) (Fig. 3).
The application of swede type rape promotor P76247 in the stamen and petal of Arabidopis thaliana transfer-gen plant, the steps include:
1, the structure of P76247 plant expression vector and Agrobacterium tumefaciens strain EHA105(are purchased from Hu Shang bio tech ltd, Shanghai, identical below) conversion:
The recombinant vectors built clone in the preparation method of a kind of swede type rape promotor P76247 of 35S promoter on plasmid pBI121 (purchased from TaKaRa company, identical below) is obtained P76247 fragment replace.For completing this object, first, the primer of band useful BamHI and Kpn I restriction enzyme site redesigned is utilized: P76247 sequence increases from pMD18-P76247 plasmid by P76247S/e:5-' CAGggtaccCTTAGTAGTTGTATCCACAGGTG-3' and P76247A/e5-CGCggatccCTTGATCTATGTTAATGTTATATATG-3'.PCR response procedures be 94 DEG C 5 minutes, 94 DEG C 1 minute, 59 DEG C 1 minute, 72 DEG C 2 minutes, 33 circulations, 72 DEG C 10 minutes, 16 DEG C 3 hours, PCR primer is already described before 1.0%() agarose gel electrophoresis detection, after gel reclaims the recovery of test kit (already described) purifying above, with BamHI/Kpn I (already described above) double digestion purify reclaim PCR primer, cut pBI121(Chen with BamHI/Kpn I enzyme simultaneously, P.Y., Wang, C.K., Soong, S.C.To, K.Y.CompletesequenceofthebinaryvectorpBI121anditsapplica tionincloningT-DNAinsertionfromtransgenicplants.Mol.Bree d.11, 287-293) plasmid.It is that 10 μ l endonuclease reactions carry out in 37 degree of incubators that enzyme cuts system (already described) above, after about 4-6 hour, with already described before 1.0%() agarose gel electrophoresis detection.PCR primer enzyme is cut large fragment (about 1900bp) DNA gel that rear fragment (size is 1986bp, and already described before pBI121() enzyme cuts to reclaim test kit (already described) above and reclaim.In already described before PCR primer endonuclease bamhi and pBI121() large fragment that cuts of enzyme according to ratio (molar concentration rate) biased sample of (150ngPCR product endonuclease bamhi: 50ng large fragment)=3:1, add T
4dNA ligase 1 μ l, 10 × reaction buffer 1 μ l, aseptic ddH
2o supplements volume to 10 μ L, and 16 DEG C of connections are spent the night.After heat shock method (already described above) transforms the competent cell (stating) of gold bacterial strain above, solid LB media (stating above) flat board containing kantlex (50 μ g/mL) screens, picking white bacterial plaque is before bacterium colony PCR(and is stated), extract plasmid (already described) above, through the recombinant plasmid called after pBI-P76247 of digestion verification size correct (1986bp).
Utilize before freeze-thaw method (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate, molecular cloning texts guide (third edition) Science Press, identical below) transformation Agrobacterium EHA105(already described): step is as follows:
A: get 0.2ml competence Agrobacterium, slowly melt in ice.
B: add about 2 μ g recombinant plasmid dnas, mix gently, after ice bath 30min, drops into liquid nitrogen flash freezer 1min, then 37 DEG C of water-bath 5min, melts cell.
C: add 800 μ l not containing microbiotic LB liquid nutrient medium (already described) above, 28 DEG C of jogs cultivate 4-5h.
D:12000rpm, 30s, remove supernatant, and cell is resuspended in 0.2mlLB liquid nutrient medium (already described) substratum above.
E: culture is uniformly coated on containing Rif(50mg/L), Str(50mg/L), on LB solid medium (already described above) agar plate and Kan(50mg/L), cultivate 2 days, treat bacterium colony appears in flat board for 28 DEG C, picking bacterial plaque, with bacterium colony PCR detection validation (already described above).
2, the functional analysis of P76247:
The genetic transformation of A, P76247 plant expression vector pBI-P76247 in Arabidopis thaliana and transfer-gen plant screening:
Inflorescence infestation method (ZhangX.R.etal.Agrobacterium-mediatedtransformationofArab idopsisthalianausingthefloraldipmethod.Nature, 2006,1:1-6, identical below) is adopted to carry out transformation of Arabidopsis thaliana.Preparation is containing already described before the agrobacterium tumefaciens EHA105(of recombinant vectors pBI-P76247) bacterium liquid, proceed in the LB liquid nutrient medium (already described) containing kantlex 50 μ g/ml, Rifampin 50 μ g/ml above the day before yesterday in conversion, 28 DEG C of incubated overnight.Second day, under 276nm nano wave length, detect the light absorption value of bacterium liquid with ultraviolet spectrophotometer (SPEKOL1300), take out when the light absorption value of bacterium liquid reaches between 1.6-2.0.Room temperature (20-25 DEG C, identical below), with the centrifugal 10min of 4000g, abandons supernatant, and precipitation is suspended in isopyknic 5% sucrose solution (mass volume ratio of sucrose and distilled water, identical below).Poured into by the sucrose solution of muddiness in a large culture dish, adding final concentration before conversion is 0.02%(volume ratio) Silwetl-77(purchased from the Five continents, Beijing unit industry science and trade center, identical below).After mixing whole for Arabidopis thaliana to be transformed inflorescence gently be immersed in sucrose, silent several 15 seconds, take out plant.Plant after a conversion black plastic bag is wrapped, and is placed on growth case and cultivates.Within second day, opened by plastics bag, the place being placed on light intensity is cultivated.Tried again every one week conversion.Cultivate and gather in the crops seed in about one month, seed is dry 3-5 days under incubator or daylight.The T0 of results will be transformed for seed 70%(volume ratio) alcohol and 0.1%(mass ratio) mercuric chloride surface sterilization 3 minutes and 10 minutes respectively, then with distilled water wash several (5 ~ 7 times), then blow and beat to MS solid screening culture medium (the MS macroelement mother liquor 100ml containing concentration being 50mg/L kantlex equably; MS trace element mother liquor 10ml; The organic mother liquor 10ml of MS; MS molysite 10ml; Inositol 10ml; Sucrose 30g; Adjust PH to 5.8,12g agar powder with 1MNaOH, be settled to 1L, for subsequent use after high pressure 121 DEG C of sterilizings.Add 8g agar powder and can be configured to solid medium.Various mother liquor formula is in table 1) surface.4 DEG C of vernalization 4-6 days, put into constant incubator (photoperiod 16(daytime)/8(dark) hour, temperature: daytime 22 DEG C, dark cycle 20 DEG C) cultivate, screen the transformed plant obtained, claim T1 for transformed plant (following identical).According to kalamycin resistance screening positive plant distinctive on expression vector.When blade grows to enough sizes (3-4 leaf phase), get a little green seedling leaf, extract DNA, carry out the PCR positive detection (following identical) of converting material.Primer is NPT II F:5 ' GATGGATTGCACGCAGGT3 ' and NPT II R:5 ' TCAGAAGAACTCGTCAAG3 ', and reaction system is that 10 μ l include: template DNA template 1 μ L (about 100ng), 10 × Taqbuffer(are containing MgCl
2) 1 μ l, 1.5mmol/LdNTP (10mmol/L) 1 μ l, 5 ' primer (10 μm of ol/L) 0.5 μ l, 3 ' primer (10 μm of ol/L) 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH
2o5.5 μ l.Reaction conditions be 94 DEG C 5 minutes, 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 1 minute, 32 circulations, 72 DEG C 10 minutes, amplification size is 800bp.Result shows to obtain transgenic positive plant (plant containing testing goal fragment claims positive plant, identical below).
Table 1MS substratum mother liquor formula
B, P76247 functional analysis:
Replace before pBI121(already described with P76247) 35S promoter sequence on plasmid, form pBI-P76247 recombinant plant expression vector, gus gene is wherein by the regulation and control of P76247.Utilize before agrobacterium tumefaciens EHA105(already described) inflorescence infestation method (already described above) arabidopsis thaliana transformation that mediates.T0 is for after seed for results, obtains T1 obtain positive plant (above already described) for transformed plant (already described) and PCR detection screening above through kalamycin resistance screening.
That positive T1 is already described before the MS(being 50mg/L kantlex for transfer-gen plant seed by PCR checking containing concentration) substratum is sowed, sprout growing in case after 4 DEG C of vernalization, sprouting condition: light application time 16h, temperature: 22 ± 2
, after emerging 5 days, start sampling dyeing.Dyeing course is as follows: sample is immersed in GUS dye liquor (X-gluc0.5mg/mL, phosphoric acid buffer 50mmol/L, the Tripotassium iron hexacyanide and each 0.5mmol/L of yellow prussiate of potash, EDTA10mmol/L, Triton-x-1000.001%(volume ratio), methyl alcohol 20%(volume ratio) in, vacuum suction 5 minutes, 37 DEG C are spent the night.Within second day, decolour with alcohol-acetic acid (volume ratio is 1:1), until blade bleaches, use distilled water rinsing for several times (5 ~ 7 times) afterwards, Stereo microscope (OLYMPUSSZX16) is taken pictures.Seedling stage gets 5 days respectively, 10 days, the whole plant of 15 days; Reproductive stage, blade gets tender leaf and mature leaf; Flower rounds the flower that an inflorescence contained out and the bud do not opened; Angle fruit after fertilization 5 days, 10 days, the angle of 15 days and 20 days really.It is exactly the position that gus gene is expressed that plant is dyed to blue position.The spatial and temporal expression pattern of P76247 is explored by the expressive site and expression intensity detecting gus gene under different space-time.
Result shows the stamen of gus gene at Arabidopis thaliana, the petal of this promoters driven and withers high expression in the petal after 2 days, but does not express (Fig. 6) in seed, blade and root and stem.Therefore, this promotor has driving downstream gene high expression in plant stamen and petal, and does not express at seed and other positions.This promotor with tissue specific expression at plant genetic engineering and Transgene-safty (eating), and utilizes in genetic engineering technique manual change ornamental plant pattern and petal form and has good using value.As contained by building the carrier that this promoters driven causes the gene of Anther Abortion, transformation receptor plant, artificial creation's male sterile material, be applied in the production of cross-breeding, or control transgenic plant by the elegant genetically modified escape caused of pollen, or by promoters driven, some improves the gene of pollens nutrition composition, improves pollens nutrition etc.The gene simultaneously driven due to P76247 is not expressed in seed, in seed, therefore there will not be the protein product of external source quiding gene, have important using value in netically modified foods security fields.
The description of a kind of rape P76247 promotor full length sequence SEQIDNO:1 functional expression in model plant Arabidopis thaliana different tissues.Homologous sequence method is utilized to clone the 5 ' upstream sequence obtaining swede type rape Bn76247 gene, through core promoter element and Upstream cis acting promoter prediction software http://www.fruitfly.org/seq_tools/promoter.html and PLACE (Higoetal., Plantcis-actingregulatoryDNAelements (PLACE) database (J) .NucleicAcidsResearch.1999, 27:297 ~ 300) http://www.dna.affrc.go.jp/PLACE/ predicts, result shows that cloned promoter sequence contains TATAbox core promoter sequence, the upstream promoter elements such as CAAT and flower specifically expressing element are as POLLEN1LELAT52 and GTGANTG10(Fig. 3).In addition, fluorescent quantitation and GUS coloration result show that the native gene that P76247 drives is expressed in stamen and petal, do not express (Fig. 1, Fig. 6) in other tissue.This illustrates that the native gene that P76247 drives is the gene of a high expression in rape stamen and petal, proves that P76247 is the promotor of high expression in a rape stamen and petal.
The application of swede type rape P76247 promotor in the stamen and petal high expression of model plant Arabidopis thaliana, its process is: utilize homologous sequence method to clone the 5 ' upstream promoter sequence obtaining rape Bn76247 gene.Build by already described before the plant expression vector pBI-P76247(of the Reporter gene GUS of this promoter regulation).Adopt agriculture bacillus mediated florescence infestation method (already described) arabidopsis thaliana transformation above, T1 generation be added with before the MS(of kantlex already described) preliminary screening transfer-gen plant on substratum, after Arabidopis thaliana grows two panels true leaf, be transplanted on vermiculite and continue plantation, after there is inflorescence in plant, carry out PCR detection, utilize Molecular tools to identify positive strain.In T2 generation, selects 10 transgenic lines to carry out GUS dyeing.The dyeing of GUS histochemical method shows, gus gene high expression in the stamen and petal of Arabidopis thaliana of this promoters driven.As can be seen here, the gus gene of this promoters driven has certain spatial and temporal expression specificity, has and drives downstream gene high expression in stamen and petal, do not express the function of (Fig. 6) in seed completely.This promotor with tissue specific expression has using value in manual creation germ plasm resource, rape and arabidopsis thaliana genetically engineered and Transgene-safty (eating), relevant goal gene is grown with pollen granule as utilized this promoters driven, first the over-express vector that P76247 drives goal gene is built, transformation receptor plant, then goal gene is under the driving of P76247 promotor, the expression amount of goal gene in above-mentioned tissue can be improved, do not express completely in seed, can not food-safety problem be caused.Because rape and Arabidopis thaliana belong to brassica plant, and brassica plant flower development genes involved sequence and functionally there is very strong conservative property.Therefore, this promoters driven and the relevant goal gene of anthocyanidin synthesis can also be utilized, first the over-express vector that P76247 drives goal gene is built, transform rape and other Btassica recipient plant, then goal gene is under the driving of P76247 promotor, the expression amount of goal gene in rape and other Btassica Petals can be improved, reach the object changing petal color, in the initiative of ornamental plant (a lot of ornamental plant belongs to Brassica genus) novel material, have important using value.
Described rape any one all.
Compared with prior art, have the following advantages heavy effect in the present invention:
1, the root of swede type rape, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal totally 11 high-throughput transcript profile sequencing technologies organized are utilized, in conjunction with sequencing data of whole genome, by analysis, fast prediction goes out the candidate gene of a large amount specifically expressing in rape stamen and petal, being verified by the method for fluorescent quantitation subsequently, is a kind of new organizing specific expression promotor method of acquisition of high efficient and reliable.
2, the promotor that the promotor cloning process provided is cloned into by the regulation and control of gus gene and histochemical analysis, can obtain the rape promotor with tissue specific expression function.
3, P76247 is in the security of transgenosis edible oil, improves the aspect such as crop quality aspect and manual creation germ plasm resource, has good application potential.
4, this promotor has good application potential in ornamental plant pattern and the improvement of petal form.
Accompanying drawing illustrates:
Fig. 1 is the expression pattern analysis figure of the native gene that a kind of P76247 drives.
Fig. 2 is a kind of homologous clone method amplification P76247 fragment electrophoretic figure.
It is template PCR amplifications result that swimming lane 1 does not represent genomic dna; Swimming lane M represents nucleic acid Marker.
Fig. 3 is the analysis of P76247 promoter sequence.
Shaded boxes represents primary element, and underscore represents the relevant element of anther-specific expression.
Fig. 4 is a kind of pBI-P76247 carrier schematic diagram of structure.
Fig. 5 is the partial transgenic plant PCR qualification figure of a kind of conversion carrier pBI-P76247.
Swimming lane M represents the nucleic acid Marker of DL2000; Swimming lane 1 represents the PCR of pBI-P76247 positive plasmid
Amplification; The pcr amplification result of the positive strain of swimming lane 2-18: swimming lane 19 wildtype Arabidopsis thaliana
Pcr amplification result.
Fig. 6 is the histochemical stain result of the gus gene that a kind of P76247 drives.
A:15 day seedling (colourless); B: blade (colourless); C: stem (colourless); D: angle fruit (colourless);
E: bud (the blue look of stamen, petal); F: petal (blue look).
Embodiment
According to following examples, can better understand the present invention, but described embodiment is to better explain the present invention, instead of limitation of the present invention.
Embodiment 1:
Flower pesticide specific expression gene Bn76247 and promotor P76247 prediction:
The present invention's rape used is two No. 11 (already described above) in swede type rape.Land for growing field crops is seeded in, normal field management for examination material.The rapeseed plants grown from grown in field condition gets root, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal totally 11 tissues.Three repetitions at least got by often kind of material, eachly repeat at least one strain, with masking foil parcel after sampling, are positioned over rapidly in liquid nitrogen flash freezer ,-80 DEG C of preservations.The extraction of RNA is carried out in the requirement according to test kit utilizing Trirol to extract test kit (already described) above.The RNA extracted is sent to BGI-Shenzhen and carries out reverse transcription, build storehouse and and utilize solexa sequencing technologies (already described) to carry out transcript profile examining order above.Each organizes sequencing data amount to be already described before 10G().After order-checking, with the gene expression abundance of RPKM value (already described above) icp gene in different tissues.RPKM calculation formula is as follows: RPKM=(109 × C) ÷ (N × L) wherein C be the reads number that certain gene is arrived in comparison; N is the total reads number of sample comparison to all genes; L is mrna length.RPKM value is higher shows that the expression level of this gene is higher.By comparing the RPKM value of all genes of rape in above-mentioned 11 tissues, find that Bn76247 RPKM value in bud is 36.3, in stamen, RPKM value is 365.8, and in petal, RPKM value is 265.6, and the RPKM value in all the other 8 tissues is 0.Illustrate that Bn76247 may be the gene of a high expression in stamen and petal, and drive the P76247 of this gene to be a new stamen and petal high efficient expression starter.
Embodiment 2:
The expression pattern analysis of the native gene that rape P76247 drives:
Land for growing field crops is seeded in, normal field management for examination material.In the rape grown from grown in field condition, two No. 11 (as previously mentioned) plant get root, stem, leaf, bud, angle fruit, gynoecium, petal, petal.Three repetitions at least got by often kind of material, eachly repeat at least one strain, with masking foil parcel after sampling, are positioned over rapidly in liquid nitrogen ,-80 DEG C of preservations.Extract before RNA(method already described).Quantitative real time PCR Instrument is IQ5(Bole company), adopt rape Actin(accession number AF111812) as internal standard gene, Actin gene primer is forward primer 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and oppositely draws 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.The native gene Bn76247 primer that P76247 drives is 5'5'TTTGTTACCGTGCTGCTCA3' and 5'AAAGCCGTCCATCTATCAT3'.Quantitative fluorescent PCR reaction system is 20 μ L: containing SYBRMix10 μ L, and forward and reverse primer (10 μm of ol/L) each 0.8 μ L, template 2 μ L, the sterilized water of DEPC process complements to 20 μ L.Amplification condition is: 94 DEG C, 5min:94 DEG C, 15s, 60 DEG C, 20s, 72 DEG C, 30s, 40 circulations; Eachly be circulated in 72 DEG C of renaturation ends and carry out fluoroscopic examination.Reaction terminates first to be heated to 95 DEG C afterwards, is then down to 72 DEG C, is more slowly warming up to 95 DEG C, and the change of record fluorescent signal, draws the melting curve of amplified production.Often group experiment all completes three biology repetitions, and each biology repeats at least to do three technology and repeats.Detect the expression of native gene in Oil Rape Tissue (root, stem, leaf, bud, angle fruit, gynoecium, petal, petal) that P76247 drives respectively.
With the relative expression quantity comparing Ct method (Δ Δ Ct) and calculate gene.Utilize instrument (IQ5, Bole company) be with software, first internal standard gene and goal gene amplification condition is optimized, measure the Ct value of Actin and goal gene respectively, choose three results (systematic error of Ct value is less than 0.3) the most close in nine measured value of experiment to average, then by internal standard gene, correction is carried out to goal gene and obtain Δ Δ Ct, finally by 2
-Δ Δ Ctthe relative expression quantity of estimation goal gene and systematic error (already described above).When calculating relative expression quantity, with the expression level of internal reference Gene A ctin for reference, convert 1 to by its value, other sample compares with it again, obtains Relative Expression values.
Result shows: the native gene that P76247 drives a large amount in stamen and petal expresses (Fig. 1), does not express in other tissue.This illustrates that the native gene that P76247 drives is the gene of a high expression in stamen and petal, proves that P76247 is a stamen and petal high efficient expression starter.
Embodiment 3:
A preparation method for swede type rape promotor P76247 promotor, the steps include:
1, the primer sequence of rape promotor P76247:
Carry out pcr amplification according to Bn76247 upstream region of gene 2kb sequences Design 1 pair of primer that rape genome sequencing obtains, the primer of employing is P76247S:5 '-CTTAGTAGTTGTATCCACAGGTG-3' and P76247A:5 '-CTTGATCTATGTTAATGTTATATATG-3 '.
2, the preparation of rape promotor P76247:
SDS cracking process (already described) is utilized to extract rape leaf genomic dna above, carry out pcr amplification as template, step is: extract genomic dna 25 μ l, increase as template, reaction system is 50 μ l, add 10 × ExTaqbuffer5 μ l respectively, dNTP4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq0.5 μ l, DNA masterplate 1 μ l is about 100ng, ddH
2o37.5 μ l.Bn76247 upstream region of gene 2kb sequences Design PCR the primer according to the acquisition of rape genome sequencing is already described before P76247S and P76247A().Amplified production size is 1986bp, PCR response procedures be 94 DEG C 5 minutes, 94 DEG C 1 minute, 59 DEG C 1 minute, 72 DEG C 2 minutes, 33 circulations, 72 DEG C 10 minutes, 16 DEG C 3 hours, PCR primer is already described before 1.0%() agarose gel electrophoresis detection, after gel reclaims the recovery of test kit (already described) purifying above, be connected to pMD18-T carrier (already described) above, heat shock method (already described above) transforms the competent cell (already described) of gold bacterial strain above, coat containing already described before penbritin 50 μ g/mL() LB solid medium (already described above) flat board on, 37 DEG C of overnight incubation, select hickie 6, adopt M13 primer (already described) above, be bacterium colony PCR and detect (already described) above, already described before 1.0%() after agarose gel electrophoresis detected magnitude is correct.Bacterial plaque correct for PCR detected magnitude is inoculated into the LB liquid medium (already described) containing penbritin 50 μ g/mL above, at 37 DEG C, 200r/min shaking culture is spent the night, alkaline process (already described above) extracts plasmid in a small amount, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (for 1960bp), adopt Kpn I/BamHI enzyme (already described) to cut above and double digestion (already described above) is carried out to plasmid, it is 10 μ l that enzyme cuts system (already described) above, 37 DEG C are spent the night, already described before 1.0%() agarose gel electrophoresis detection.Detect correct Positive recombinant clones, already described before called after pMD18-P76247(), pMD18-P76247 is served Hai Yingjun company and check order, pMD18-P76247 is served Hai Yingjun company sequencing, analytical results, obtains P76247 full length sequence, name P76247.A promotor for separation, its series is the nucleotide sequence shown in SEQIDNo.1 or the nucleotide sequence with SEQIDNo.1 substantial homologous.
3, the structure of rape P76247 recombinant expression vector and Agrobacterium tumefaciens transformation:
Utilize the primer of band useful BamHI and Kpn I restriction enzyme site redesigned: P76247 sequence increases from pMD18-P76247 plasmid by P76247S/e:5-' CAGggtaccCTTAGTAGTTGTATCCACAGGTG-3' and P76247A/e5-CGCggatccCTTGATCTATGTTAATGTTATATATG-3'.PCR response procedures be 94 DEG C 5 minutes, 94 DEG C 1 minute, 59 DEG C 1 minute, 72 DEG C 2 minutes, 33 circulations, 72 DEG C 10 minutes, 16 DEG C 3 hours, PCR primer is already described before 1.0%() agarose gel electrophoresis detect, gel reclaim test kit (already described above) purifying reclaim after, with BamHI/Kpn I (already described above) double digestion purify reclaim PCR primer, cut before pBI121(already described with BamHI/Kpn I enzyme simultaneously) plasmid.Gel reclaims before the P76247 fragment that scales off of enzyme and pBI121(already described) fragment, connect, heat shock method (already described above) transformation of E. coli, is built into before plant expression vector pBI-P76247(already described) (Fig. 4).Finally use freeze-thaw method (already described) above by already described before this vector introduction agrobacterium tumefaciens EHA105(), positive colony is being selected, with already described before bacterium colony PCR(above containing (already described) on kantlex (50mg/L) and Rifampin (50mg/L) Double LB flat board) verify whether contain target fragment.
Embodiment 4:
The transformation of Arabidopsis thaliana of pBI-P76247 and PCR detect:
Adopt inflorescence infestation method (already described) arabidopsis thaliana transformation above, kalamycin resistance specific to transfer-gen plant, already described before the MS(containing concentration being 50mg/L kantlex) substratum grows, the green seedling of acquisition tentatively thinks transformed plant.After plant to be transformed grows two panels true leaf, be transplanted in vermiculite, after inflorescence appears in plant to be planted, get a slice true leaf SDS method and extract genomic dna (already described) above, do PCR qualification.Primer sequence is already described before NPT II F and NPT II R(), PCR reaction system is as follows: template DNA 1 μ L (about 100ng), 10 × Taqbuffer(are containing MgCl2) 1 μ l, 1.5mmol/LdNTP (10mmol/L) 1 μ l, 5 ' primer (10 μm of ol/L) 0.5 μ l, 3 ' primer (10 μm of ol/L) 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH2O5.5 μ l.Response procedures is: 94 DEG C of sex change 5min, and 94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 2min32 circulations, 72 DEG C extend 5min.By 1% sepharose (already described above) electrophoresis detection PCR reaction product, size is 800bp.Result shows that P76247 expression vector pBI-P76247 has successfully proceeded to Arabidopis thaliana (Fig. 5), obtains the positive seedling of 20 strains altogether.
Embodiment 5:
The functional analysis of swede type rape P76247 promotor:
The present invention clones the sequence obtaining P76247 first, and has carried out functional analysis to it.From embodiment 4, detect (above already described) by model plant transformation of Arabidopsis thaliana (already described) and PCR above and screen the positive seedling T1 generation obtained, selfing results seed (i.e. T2 generation).At different times, the different tissues getting T2 generation 10 strain transformed plants carries out GUS dyeing.
It is as follows that in T2 generation, gets dyeing course: sample is immersed in GUS dye liquor (X-gluc0.5mg/mL, phosphoric acid buffer 50mmol/L, the Tripotassium iron hexacyanide and each 0.5mmol/L of yellow prussiate of potash, EDTA10mmol/L, Triton-x-1000.001%, methyl alcohol 20%(volume ratio) vacuum suction 5 minutes, 37 DEG C are spent the night.Within second day, decolour with alcohol-acetic acid (volume ratio is 1:1), until blade bleaches, use distilled water rinsing 3-5 time afterwards, Stereo microscope (OLYMPUSSZX16) is taken pictures.Get the whole plant of different time sections seedling stage; Reproductive stage, blade gets tender leaf and mature leaf; The flower that flower took away; Angle fruit gets the angle fruit of different times; Seed gets the Post flowering seed of about 10 days.It is exactly the position that gus gene is expressed that plant is dyed to blue position.
Coloration result finds (asking for an interview table 2, Fig. 6), in seedling, root, stem, blade and angle fruit, all do not occur blueness, only has in the stamen of open bud and petal and occurs significantly blue reaction.As can be seen here, the gus gene of this promoters driven is mainly expressed in stamen and petal thereof, does not express in other tissue.
Experimental result shows, rape P76247 has following biological function: the gus gene of this promoters driven is expressed in the stamen and petal of Arabidopis thaliana, does not express in other tissue.Gus gene under P76247 regulation and control has certain spatial and temporal expression characteristic, and this illustrates that P76247 has the function driving downstream Reporter gene GUS to express in recipient plant.Under the regulation and control of this promotor, gus gene can mainly meticulous expression in the stamen and petal of transfer-gen plant, and does not express completely in other tissue (asking for an interview table 2, Fig. 6).
Table 2P76247 transgenic arabidopsis T2 is for the GUS dyeing cartogram of strain
This promotor with tissue specific expression has using value in plant genetic engineering and Transgene-safty (eating).
The application of a kind of swede type rape P76247 promotor in the stamen and petal of model plant Arabidopis thaliana.Its process is: utilize homologous sequence method to clone the 5 ' upstream promoter sequence obtaining rape Bn76247 gene.There is through this promoter sequence of bioinformatic analysis core parts and the upstream element of promoter expression, build before the plant expression vector pBI-P76247(by the Reporter gene GUS of this promoter regulation already described).Adopt agriculture bacillus mediated florescence infestation method arabidopsis thaliana transformation, T1 generation be added with before the MS(of kantlex already described) preliminary screening transfer-gen plant on substratum, after Arabidopis thaliana grows two panels true leaf, be transplanted on vermiculite and continue plantation, after there is inflorescence in plant, carry out PCR detection, utilize Molecular tools to identify positive strain.In T2 generation, selects 10 transgenic lines to carry out GUS dyeing.The dyeing of GUS histochemical method shows, the gus gene of this promoters driven is expressed in the stamen and petal of Arabidopis thaliana.As can be seen here, the gus gene of this promoters driven has certain spatial and temporal expression specificity, has and drives downstream gene to express in stamen and petal, do not express the function of (asking for an interview Fig. 6) in other tissue completely.This promotor with tissue specific expression has good using value in plant genetic engineering and Transgene-safty (eating), as utilized this promoters driven pollen fertility or the goal gene relevant with oleaginousness, first the over-express vector that P76247 drives goal gene is built, transformation receptor plant, then goal gene is under the driving of P76247 promotor, express in stamen and petal, the expression amount of goal gene in above-mentioned tissue can be improved, do not express completely in seed, can not food-safety problem be caused.This promoters driven and the relevant goal gene of anthocyanidin synthesis can also be utilized simultaneously, first the over-express vector that P76247 drives goal gene is built, transformation receptor plant, then goal gene is under the driving of P76247 promotor, the expression amount of goal gene in Petal can be improved, reach the object changing petal color, in the initiative of ornamental plant novel material, have important using value.
SEQIDNo.1
<110> Inst. of Oil Crops, Chinese Academy of Agriculture
<120> swede type rape P76247 promotor and preparation method and application
<130> swede type rape P76247 promotor and preparation method and application
<160>1
<170>PatentInversion3.1
<210>1
<211>1989
<212>DNA
<213> swede type rape P76247 promotor and preparation method and application
<400>1
ttagtagttgtatccacaggtgcgcacacacctccatgccgtcttgagttcctctccttc60
cacagcacataaatggctgtctgaaaaactaagtggaggagtatagcatcgagtctgttc120
ctgttctggcgtaacggggaggtgactgtatcttcccagttcggtgttatcgctggacca180
agtaatttctctgcaacattcatccatactgtgaaggtatatgggcaagcgaaaaacaaa240
tgatctctgctttcatccttctctccgcagtagacacagcattgctccattccccattct300
ctcattctagtgcttgttgataatctgtccttgaaagctaaccataccatgaaggattgt360
cggggtatggcctgagggaaccacacaatacaatgccagggaagctttctctttttaact420
cgcaggtagttccatgtcttggtagctgagaagtatggtttgaaatcatcctggtcatgt480
ctccatatagctatatctggtcctgcagtagctaccggtcgtggagtctctgcaagcata540
tcacagagatggtggtatcgtctctgtccacatctccgaatgttccagctgtcgtcgcgg600
gttgcttcagcgagcgttgcggacctgctcactctaaggtagcttatgcccagctctcct660
gttatatcaatcaatctgcccatttctaaccagttatcgaaccaaaaatgcacgttaccc720
catttctaacctcgaaccgaatgcattcgtatgcaatgggtctaagtttgagcagtttcc780
gccatacccacgatccctttttgtcactggcatcccagtgagagctattcttgagtagat840
actgtcgggtccaagcaacccaaaaggagccagtaagagagaatagtttccagataagac900
tcagtgcaaatactcgcgaagtgtcgctaagacgtctgatgcctagtccaccttcttcct960
tggggcaacagagatctttccaagcaactttggctttatgagtaatggttggcgaaccag1020
accataagaaggcactgcacatactctcgatggtatctaaacagccttgcggcaagataa1080
acgctgagctccaaaaattgacggtacttgcggtcacagactttatcaattggagtcgac1140
ctgcaaaagataatgctcgatgcgtccatgagagaattttttttgcgaagctgatcaata1200
agaggctcgtactccagcttgctccaagacttggtcgttagaggcatacccaaatatctc1260
accggtagcgttcctgttacaaacccacggctctgagcagcttgaataaatagatgatgg1320
ttcttcccagcggcaaagatggaagacttagagacattaatctgtagacctgataatgct1380
gcgaacttgtccataacttcaagaaccccgttaagagacctcacacttccatcagtgaat1440
actaatatatcatgctgcgaacttgtccaaaataagtattgttttggacaacttacagat1500
taatcatattcacaagtagaaaaataaaatacaaaagctgaagaatatatgtaatttggt1560
agtatataaaatataggcctgaatattatacgaaatttatttatctaccatacattaaat1620
actgtaatttattagacttgtaaattactaaatatataattgaattctccagtccacata1680
catgcaaagattgagaacttattctcatctcaaaagaagttccttcacttttacagccat1740
gcatccatcggtcggtctcgaatgcattttctctagacaataatgttattttaacctcgt1800
atagctcatatattatatacatagatacgaatccacgtacgtgttaaagcatgttgtgta1860
cacgcgagaggttgtcttttgtatatcacccccagaatttcctagctatttcctgttctc1920
tctctctcactctctataaatatgaaaacttagatgtatacatatataacattaacatag1980
atcaag1986
Claims (7)
1. the promotor P76247 be separated, its sequence is the nucleotide sequence shown in SEQIDNo.1.
2. the recombinant vectors pBI-P containing promotor according to claim 1
76247, described recombinant vectors pBI-P
76247by BamHI/Kpn I two kinds of restriction endonucleases promotor P76247 is connected in pBI121 to obtain.
3. the preparation method of a kind of swede type rape promotor P76247 according to claim 1, the steps include:
(1) primer sequence of rape promotor P76247:
Pcr amplification is carried out according to Bn76247 upstream region of gene 1986bp sequences Design 1 pair of primer that rape genome sequencing obtains, amplification obtains 5 ' the upstream promoter sequence of rape Bn76247, and the primer is P76247S:5 '-CTTAGTAGTTGTATCCACAGGTG-3' and P76247A:5 '-CTTGATCTATGTTAATGTTATATATG-3 ';
(2) preparation of rape promotor P76247:
Utilize SDS cracking process to extract rape leaf genomic dna, carry out pcr amplification as template, step is: extract rapeseed gene group DNA25 μ l, as template, primer P76247S and P76247A adopting step (1) to design increases, and reaction system is 50 μ l, adds 10 × ExTaqbuffer5 μ l respectively, dNTP4 μ l, P76247S1 μ l, P76247A1 μ l, ExTaq0.5 μ l, DNA masterplate 1 μ l100ng, ddH
2o37.5 μ l, amplified production size is 1986bp, PCR response procedures be 94 DEG C 5 minutes, 94 DEG C 1 minute, 59 DEG C 1 minute, 72 DEG C 2 minutes, 33 circulations, 72 DEG C 10 minutes, 16 DEG C 3 hours, PCR primer detects through 1.0% mass volume ratio agarose gel electrophoresis, after Gel Extraction kit reclaims, be connected to pMD18-T carrier, heat shock method transforms the competent cell of gold bacterial strain, picking positive colony, PCR checks order after detecting positive and digestion verification, obtain goal gene upstream 1986bp flanking sequence, through the promotor full length sequence that this sequence of bioinformatic analysis is Bn76247, called after P76247,
Described rape is in swede type rape two No. 11.
4. the promotor P76247 of a kind of separation described in claim 1 is in the application driving goal gene in rape stamen is expressed.
5. the promotor P76247 of a kind of separation described in claim 1 is in the application driving goal gene in Arabidopis thaliana stamen is expressed.
6. the promotor P76247 of a kind of separation described in claim 1 is in the application driving goal gene in rape petal is expressed.
7. the promotor P76247 of a kind of separation described in claim 1 is in the application driving goal gene in Arabidopis thaliana petal is expressed.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410058108.6A CN103789313B (en) | 2014-02-20 | 2014-02-20 | Swede type rape P76247 promotor and preparation method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410058108.6A CN103789313B (en) | 2014-02-20 | 2014-02-20 | Swede type rape P76247 promotor and preparation method and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103789313A CN103789313A (en) | 2014-05-14 |
CN103789313B true CN103789313B (en) | 2015-11-18 |
Family
ID=50665369
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410058108.6A Active CN103789313B (en) | 2014-02-20 | 2014-02-20 | Swede type rape P76247 promotor and preparation method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103789313B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107099532B (en) * | 2017-06-05 | 2019-12-13 | 中国农业科学院油料作物研究所 | cabbage type rape embryo specific promoter pBnaA09g21960D and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102965374A (en) * | 2012-11-27 | 2013-03-13 | 中国农业科学院油料作物研究所 | Preparation method and applications of rape BnRabGDI3 promoter |
-
2014
- 2014-02-20 CN CN201410058108.6A patent/CN103789313B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102965374A (en) * | 2012-11-27 | 2013-03-13 | 中国农业科学院油料作物研究所 | Preparation method and applications of rape BnRabGDI3 promoter |
Non-Patent Citations (4)
Title |
---|
The genetics and genomics database for Brassica plants;Feng Cheng et al.;《BMC Plant Biology》;20111013;全文 * |
The ginome of the mesopolyploid crop species Brassica rapa;The Brassica rapa genome sequencing project consortium;《NATURE GENETICS》;20110828;第1035-1040页 * |
甘蓝型油菜RabGDI3基因启动子的克隆和功能验证;王轩鹏 等;《中国油料作物学报》;20131231;第109-116页 * |
白菜型油菜PABP5基因启动子的克隆及表达特性分析;石磊 等;《分子植物育种》;20091231;第341-346页 * |
Also Published As
Publication number | Publication date |
---|---|
CN103789313A (en) | 2014-05-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Wang et al. | Multi-gene co-expression can improve comprehensive resistance to multiple abiotic stresses in Brassica napus L. | |
CN105753953B (en) | Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant | |
WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
CN103789314B (en) | Swede type rape P17673 promotor and preparation method and application | |
CN107365370A (en) | The albumen related to fruit development and its encoding gene and application | |
CN102220325A (en) | Method for preparing cabbage type rape BnPABP3 promoter and application thereof | |
Van Beveren et al. | Transformation of cambial tissue in vivo provides an efficient means for induced somatic sector analysis and gene testing in stems of woody plant species | |
CN102965374B (en) | Preparation method and applications of rape BnRabGDI3 promoter | |
CN104945492B (en) | Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application | |
CN102220327B (en) | Brassica napus BnPABP8 promoter and preparation method and use thereof | |
CN103789313B (en) | Swede type rape P76247 promotor and preparation method and application | |
CN102634516B (en) | Brassica napus BnCP51 promoter as well as preparation method and application of promoter | |
CN102226181B (en) | Method for preparing promoter of Brassica napus BnPABP2 and application thereof | |
CN105087587A (en) | Peanut AhFAD2-2A gene promoter and application of peanut AhFAD2-2A gene promoter | |
CN105132428B (en) | A kind of and the relevant ZmLRT genes of root system of plant character and its relevant biological material and application | |
CN104878014A (en) | Wheat promotor induced by rust fungi | |
CN105274106B (en) | Peanut AhWRI-1 promoters and preparation method and application | |
CN104109682B (en) | A kind of pectin lyase BnPL gene and promoter thereof and application | |
CN103397048B (en) | Method for cultivation of transgenic wheat resisting take-all and sharp eyespot and related biological materials thereof | |
CN106929518A (en) | A kind of rubber tree HbAG genes and its application | |
CN103788187B (en) | Flowering of plant associated protein GmSOC1-like and encoding gene thereof and application | |
CN105420241B (en) | Promoter of watermelon ClCP2 genes and its preparation method and application | |
CN108753777A (en) | A kind of promoter and its application with anther tissue specificity | |
CN108795942A (en) | A kind of rice external cause stress-inducing expression promoter Ps ubs3 and its application | |
US20240093217A1 (en) | Rice suberin biosynthetic genes and regulators |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |