CN103789313A - Brassica napus promoter P76247 and preparation method and application thereof - Google Patents

Brassica napus promoter P76247 and preparation method and application thereof Download PDF

Info

Publication number
CN103789313A
CN103789313A CN201410058108.6A CN201410058108A CN103789313A CN 103789313 A CN103789313 A CN 103789313A CN 201410058108 A CN201410058108 A CN 201410058108A CN 103789313 A CN103789313 A CN 103789313A
Authority
CN
China
Prior art keywords
promotor
gene
rape
plant
promoter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410058108.6A
Other languages
Chinese (zh)
Other versions
CN103789313B (en
Inventor
刘胜毅
董彩华
黄军艳
程晓辉
童超波
于景印
刘越英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Original Assignee
Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oil Crops Research Institute of Chinese Academy of Agriculture Sciences filed Critical Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority to CN201410058108.6A priority Critical patent/CN103789313B/en
Publication of CN103789313A publication Critical patent/CN103789313A/en
Application granted granted Critical
Publication of CN103789313B publication Critical patent/CN103789313B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a Brassica napus promoter P76247 and a preparation method and application thereof. The method comprises the steps: (1) designing a pair of primers according to an upstream 2kb sequence of a gene Bn76247 which is obtained through sequencing all genomes of napus, and carrying out PCR (Polymerase Chain Reaction) amplification, so as to obtain a 5' upstream promoter sequence of the napus Bn76247; (2) preparing the napus promoter P76247: extracting genomic DNA (Deoxyribonucleic Acid) of napus leaves by using a SDS (Sodium Dodecyl Sulfate) lysis method, taking the genomic DNA as a template, carrying out PCR amplification with the primers, purifying and recovering with a gel recovery kit, and then, connecting to a pMD18-T vector, thereby obtaining an upstream 2kb flanking sequence of a target gene, wherein shown by bioinformatics analysis, the upstream flanking sequence is P76247. Shown by fluorescent quantitative PCR and GUS (glucuronidase) staining results, P76247 is efficiently expressed in the stamens and petals of napus and is not expressed in tissues, such as roots, stems, leaves, fruits, seeds and the like. The promoter has good application potential to the safety of transgenic napus edible oil and the aspects of improving crop quality, artificially creating germplasm resources and the like.

Description

Swede type rape P76247 promotor and preparation method and application
Technical field
The present invention relates to plant genetic engineering and biological technical field, more specifically relate to a kind of swede type rape Bn76247 gene promoter (called after P76247, below identical), also relate to a kind of preparation method of swede type rape P76247 promotor simultaneously.Also relate to the carrier that contains this promotor or its essence homologous nucleotide sequence and utilize the application of this promotor in rape and arabidopsis gene engineering with relating to.
Background technology
Plant gene promoter is the section of DNA sequence that is positioned at structure gene 5 ' end upstream, contains cis-acting elements, is determining specificity, direction and efficiency that downstream gene is transcribed, is the factor of most critical in gene transcription regulation mechanism and expression pattern.In addition, it is the key of plant genetic engineering research that foreign gene is expressed in vegetable cell, and first the expression of foreign gene depends on the startup that it is transcribed, and to a certain extent, promotor has determined sequence of time and space and the expression intensity of genetic expression.Therefore, excavate and study Novel promoter and there is very important scientific meaning for gene expression regulation Mechanism Study and transgenic research.
Find by the analysis to various plants gene promoter area, the promotor of most functional protein genes all has common structural pattern, is generally made up of core promoter element and upstream element.The TATA box that is positioned at transcription initiation site upstream-20--30bp place is core promoter element, it is the conserved sequence district of being rich in AT, relevant with unwinding of DNA double chain, and determine the selection of transcripting start point, be that most plant promoter corrections are necessary.The conserved sequence of TATA box upstream is called promotor upstream element, comprise upstream-75bp place CAAT box and-general upstream promoter element and other special upstream elements such as near GC box 80--110bp, as element (Zhang Chunxiao etc., Review on Plant Gene Promoters such as jasmonate response element (JRE), ethylene response elements (ERE).Acta Genetica Sinica, 2004,31(12): 1455-1464; Wait quietly on road, Plant Promoter and applied research progress thereof.Natural science progress, 2004,14(8): 856-862).CAAT box is the sequence of relatively guarding, and with the identification of RNA polymerase with in conjunction with relevant, genetic transcription is had to stronger activation.But some gene is without this frame, as replaced by CATC frame without CAAT box in the storage protein gene of cereal crop.The conserved sequence of GC box is 5 ' GGGCGG3 ', can have multiple copies, and can exist and do not affect its function (road is quiet, Zhao Huayan, He Yikun, Song Yanru, Plant Promoter and applied research thereof progress with any direction.Natural science progress, 2004,14(8): 856-862; The summer east of a river, Chen Quan, Wu Yusheng, Ji Pengzhang, Plant Promoter function and structure progress.Yunnan Prov Agriculture University's journal, 2006,21(1): 7-14).As long as there are these conservative structural frames, so just can there is the function of corresponding startup downstream gene expression.
Can be divided into constitutive promoter, organizing specific type promotor and inducible promoter according to the transcriptional profile of plant promoter.The foreign gene that constitutive promoter drives is stably express in all developmental stages of transfer-gen plant and tissue.To the conversion of many dicotyledonss, conventionally all use from the 35S promoter of cauliflower mosaic virus (CaMV) or from the plasmid vector of the nopaline synthetic enzyme no promotor of bacterium, and the most frequently used in monocotyledons transforms be to contain rice actin Act promotor, plasmid vector (Guan Liying etc., the effective expression of foreign gene and the safety evaluation thereof in transgenic plant of corn ubiquitin Ubi promotor and 35S promoter.Capital Normal University's journal, 2002,23(2): 52-56).But many times the lasting high efficient expression of foreign gene in recipient plant not only causes the waste of the energy in organism, and the expression in a organized way likely plant itself is had to toxic action, even cause Transgene-safty problem (Jia S-R.Environment and food biosafty assessment of transgenic plants.Advanced of Bioengineer.1997,17:37-42; Morris S H, Adley C.C.Irish public perceptions and attitudes to modern biotechnology:an overview with a focus on GM foods.Trends in Biotechnology.2001,19:43-48).Therefore, the research of inducible promoter and tissue-specific promoter and application are subject to breeder's attention day by day.The inducible promoter of identifying in transgenic plant mainly comprises abiotic stress inducible promoter, (Nie Lina etc., the clone of plant gene promoter and the Research progress on Function thereof such as biological stress induced promoter and hormone induction type promotor.Plant genetic resources journal, 2008,9 (3): 385-391).But the application of inducible promoter also has certain limitation, the external condition processing that recipient plant is carried out, as heat shock, HORMONE TREATMENT etc. may cause a series of biochemical reactions in organism and be unfavorable for the normal growth of plant.In addition, in chemical regulation system, be used as the Methylprednisone acetate (dex of inductor, dexamethasone), estradiol (estradiol) and tsiklomitsin (tetracycline) be all harmful to ecotope, should not be for the production of practice.Use the tissue-specific promoter of itself in plant materials just can avoid this problem, obviously, the tissue specific expression of foreign gene will effectively improve biological safety (Song Yang etc., the research of plant tissue specificity promoter of genetically modified crops.Biotechnology circular, 2007, (4): 21-24).
In the last few years, make significant headway about tissue-specific promoter's research, these tissue-specific promoters mainly comprise the reproductive organ specific expression promoters such as the organ specific expression promoters such as blade, phloem, vascular bundle and root and pollen, floral organ, fruit, seed (Song Yang etc., the research of plant tissue specificity promoter.Biotechnology circular, 2007, (4): 21-24).As Ariizumi etc. has separated LTP12, the promotor of XTH3 and PGA4 arabidopsis thaliana transformation, GUS dyeing shows that these 3 promotors are anther specific expression promoter, and express and there are differences (Ariizumi et al in different periods, Comparative study of promoter activity of three anther-specific genes encoding lipid transfer protein, xyloglucan endotransglucosylase/hydrolase and polygalacturonase in transgenic Arabidopsis thaliana.Plant Cell Report.2002, 21:90 – 96).In sesame, clone obtains the promotor of microsome oleic acid dehydrogenase gene (FAD2), and forecast analysis shows that the E-box in this promotor is relevant with the biosynthesizing of triacylglycerol with G-box element.Express by detecting gus gene after arabidopsis thaliana transformation, result shows this promotor specifically expressing (Mi Jung Kim etal.Seed-specific expression of sesame microsomal oleic acid desaturase is controlled by combinatorial properties between negative cis-regulatory elements in the SeFAD2promoter and enhancers in the5'-UTR intron.Molecular Genetics and Genomics.2006,276:351-368) in seed.The strange grade of Geng An separated 4 promotors transformation of tobacco from turnip type rape, swede type rape, tender flower stalk, wild cabbage, it is the promotor (Geng et al.Expression analysis of four flower-specific promoters of Brassica spp.in the heterogeneous host tobacco.African Journal of Biotechnology.2009,8 (20): 5193-5200) of floral organ specifically expressing for GUS staining analysis.In addition, tobacco anther tapetum specific expression gene promotor TA29 and nuclease gene Barnase, RnaseT1 are merged rear conversion of plant by Mariani etc., nuclease gene is specifically expressing in flower pesticide, and destroy tapetum, obtain male sterile tobacco and rape (Mariani C.etal.Induction of male sterility in plants by a chimaeric ribonuclease gene.Nature, 1990,347:737-741).At present TA29 promotor apply and has been succeeded that (Song Yang etc., plant tissue specificity promoter is studied on the plants such as tobacco, corn, rape, Arabidopis thaliana, paddy rice.Biotechnology circular, 2007, (4): 21-24).As can be seen here, even exist and make mutually difference between the internal milieu difference between different plants and gene, even the plant larger with Arabidopis thaliana nature difference, start region and corresponding conservative controlling element as long as there is conservative core, just can in other different plants, bring into play the biological function that starts downstream gene expression.
In recent years, to the functional study of promotor, the method that lot of documents report adopts is normally first with after information biology tentative prediction and analysis promoter sequence, again promoter fragment and reporter gene are constructed to expression vector, Cells In Vitro or the plant materials of transformation mode plant Arabidopis thaliana, tobacco, paddy rice etc., then the expression in transgenosis individuality is analyzed the function of promotor and is used by examining report gene.A large amount of bibliographical information shows that the promotor of other plant is transformed into and in above-mentioned plant, all can exercise normally its biological function, as: the promotor of the microsome oleic acid dehydrogenase gene (FAD2) of cloning in sesame, the E-box in this promotor is relevant with the biosynthesizing of triacylglycerol with G-box element.In transgenic arabidopsis and other transgenic plant, also demonstrate expression (the Mi Jung Kim of seed-specific, Heeja Kim, Mi Chung Suh.Seed-specific expression of sesame microsomal oleic acid desaturase is controlled by combinatorial properties between negative cis-regulatory elements in the SeFAD2promoter and enhancers in the5 '-UTR intron.Molecular Genetics and Genomics.2006, 276 (4): 351-368).The ZmGLU1 gene promoter of cloning from corn, after connecting gus reporter gene, be converted in tobacco, detect analytical results corn ZmGLU1 promoters driven gus gene efficiently express (Riliang Gu at tobacco root, Li Zhao, Guoying Wang.Isolation of a maize beta-glucosidase gene promoter and characterization of its activity in transgenic tobacco.Plant Cell Reports.2006,25 (11): 1157-1165).From potato, separate one with the promotor of closely similar TDF511 (tran-script derived fragment) the gene Stgan of ethanol dehydrogenase.Build Stgan promotor-GUS fusion expression vector transformation of tobacco, GUS histochemical stain shows that this promoters driven gene is at tobacco stem tubercle place specifically expressing, may participate in stem tuber forming process (Trindade L M, et al.Isolation and functional characterization of a stolon specific promoter from potato (Solanum tuberosum L.) .Gene, 2003,303:77-84.).These reports are all to utilize transgenic technology between different plants, to carry out the example of promoter function analysis above, these examples show to utilize model plant Arabidopis thaliana, tobacco etc. as carrier, and the function that confirms the promotor that comes from other plant by the expression analysis of transfer-gen plant is by extensively recognition and acceptance.
Rape, as the main oil crops of China, is extensively planted in the Yangtze valley, and national economy is had to material impact.Along with the maturation of transgenic technology, transgene rape will inevitably face the public opinion of Transgene-safty risk.Being used in the expression that the promotor of not expressing completely in Semen Brassicae campestris starts goal gene is the feasible method addressing this problem, and has both reached and has both improved rape each side quality, does not cause again the object of edible oil security risk.
The present patent application people has participated in being responsible for by the Chinese Academy of Agricultural Sciences vegetables, BGI-Shenzhen and Korea Spro, English, add, Australia, Chinese cabbage genome sequencing and analytical work that the Mei Dengguo correlative study scientific research personnel of mechanism has cooperated, by oil plant institute of the Chinese Academy of Agricultural Sciences (being responsible for), vegetables institute of the Chinese Academy of Agricultural Sciences, BGI-Shenzhen, Hua Zhong Agriculture University, Hunan University, Agricultural University Of Southwest, Jiangsu academy of agricultural sciences, Sichuan academy of agricultural sciences, Qinghai University, and absorb English, Australia, beautiful, the Fa Dengguo correlative study scientific research personnel of mechanism has cooperated genome sequencing and the analysis of wild cabbage and rape, Chinese cabbage genome paper is delivered (The Brassica rapa Genome Sequencing Project Consortium.The genome of the mesopolyploid crop species Brassica rapa.Nature Genetics, 2011, 43:1035 – 1039), and wild cabbage and swede type rape sequencing data of whole genome are also unexposed.Chinese cabbage, wild cabbage and swede type rape genome sequencing information have been set up can be for database http://www.ocri-genomicls.org/bolbase (the Cheng F of applicant's inquiry; Liu S; Wu J, Fang L, Sun S; Liu B; Li P, Hua W, Wang X:BRAD.the genetics and genomics database for brassica plants.BMC Plant Biol; 2011,11:136; Jingyin Yu, Meixia Zhao, Xiaowu Wang, Chaobo Tong, Shunmou Huang, Sadia Tehrim, Yumei Liu, Wei Hua and Shengyi Liu.Bolbase:a comprehensive genomics database for Brassica oleracea[J] .BMC Genomics, 2013,14:664).These sequencing data of whole genome for applicant utilizes high-throughout swede type rape tissue transcribe group order-checking, the gene of analyses and prediction a large amount specifically expressing in each tissue, and the promoter sequence that obtains thus these genes is laid a good foundation.
Therefore, the present invention organizes on order-checking basis with transcribing at swede type rape genome sequencing, has developed a swede type rape endogenesis promoter.Fluorescence quantitative PCR detection shows that this gene do not express in the root of swede type rape, stem, leaf, angle fruit, and only in stamen and petal, a large amount is expressed.The native gene that proves promoters driven by the expression characteristic of examining report gene GUS is not expressed in root, stem, blade, angle fruit, and in stamen and petal, a large amount is expressed.Our result is indicating that the promotor of this gene has a good application prospect in transgenic plant.
Summary of the invention
The object of the invention is to be to provide a kind of swede type rape P76247 promotor, can fast prediction go out the candidate gene that a large amount is expressed in rape petal and stamen, it is a kind of new organizing specific expression promotor of acquisition of high efficient and reliable, derive from the endogenous tissue-specific promoter of rape and can accurately locate regulated and controled gene, drive goal gene to express in particular organization or the period of transgene rape, avoid causing the waste of plant self energy and material, improve the expression efficiency of foreign gene in transgenic plant, limit its expressive site, this promotor can be applicable to genetically engineered research and the safe transgenic research of seed rape of plant.
A further object of the invention is the preparation method who has been to provide a kind of swede type rape P76247 promotor.Simple to operate, result is reliable and stable.The method take to swede type rape genomic dna as template, carry out pcr amplification, obtain swede type rape P76247 sequence.
The 3rd object of the present invention is to be to provide a kind of recombinant vectors that contains plant efficient expression promotor, and it contains described promotor nucleotide sequence.This carrier size is applicable to, in plant easily with transform, institute with marker gene GUS expression intensity high, easily detection.Can obtain the Arabidopis thaliana transfer-gen plant of gus gene high efficient expression in plant by this carrier arabidopsis thaliana transformation.
The 4th object of the present invention has been to provide the application of a kind of swede type rape P76247 promotor in rape and Arabidopis thaliana stamen and petal.Under the driving of this promotor, goal gene is meticulous expression in the stamen of plant and petal mainly, does not express at other position.This promotor with tissue specific expression has good using value in plant creates the genetically engineered such as sterile line, manual creation germ plasm resource and Transgene-safty (edible, pollen drift) and utilizes genetic engineering technique manual change ornamental plant pattern and petal form.
To achieve the above object, the present invention adopts following technical scheme:
In order to obtain the present invention, contriver utilizes and transcribes swede type rape root, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal totally 11 the Gene Expression Profiles data that group order-checking obtains, in conjunction with sequencing data of whole genome, by prediction and quantitative fluorescent PCR checking, obtain a new promotor.The native gene of this promoters driven is high efficient expression in the stamen of plant and petal.
According to an aspect of the present invention, above-mentioned purpose can be by providing a kind of promotor to realize, described promotor can specificity drives downstream gene high efficient expression in plant, described promotor contain SEQ ID No.1 nucleotide sequence or with the SEQ ID No.1 nucleotide sequence of homology in fact.
According to another aspect of the present invention, above-mentioned purpose can realize by the recombinant vectors that the nucleotide sequence that contains described promotor is provided.
According to another aspect of the present invention, above-mentioned purpose can realize with the microorganism that described recombinant vectors transforms by providing.
According to another aspect of the present invention, above-mentioned purpose can realize with the transgenic plant of described microbial transformation by providing.
A preparation method of swede type rape promotor P76247, the steps include:
The efficient expressing gene Bn76247 of A, stamen and petal and promotor P76247 prediction:
The present invention's rape used is two No. 11 (Brassica napus L., below identical) in swede type rape.Be seeded in land for growing field crops for examination material, normal field management.The rapeseed plants of growing from grown in field condition is got root, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal totally 11 tissues.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen flash freezer-80 ℃ of preservations.That utilizes that Trirol extracts test kit (purchased from TaKaRa company, below identical) carries out the extraction of RNA according to the requirement of test kit.The RNA extracting be sent to BGI-Shenzhen carry out reverse transcription, build storehouse and and utilize solexa sequencing technologies (Illumina Solexa sequencing technologies, biomedical engineering and clinical, 2011,15(2): 149, below identical) carry out and transcribe group examining order.Each organizes sequencing data amount is 10G(base number, below all with).After order-checking, with RPKM value (Reads Per Kilobases per Million reads, below the identical) gene expression abundance of icp gene in different tissues.RPKM calculation formula is as follows: RPKM=(109 × C) ÷ (N × L).Wherein C is the reads number of comparison to certain gene; N is total reads number that sample is compared all genes; L is mrna length.RPKM value is higher shows that the expression level of this gene is higher.By the RPKM value of all genes of rape in above-mentioned 11 tissues relatively, discovery Bn76247 RPKM value in bud is 36.3, and in stamen, RPKM value is 365.8, and in petal, RPKM value is 265.6, and RPKM value in all the other 8 tissues is 0.Illustrating that Bn76247 may be the gene of a high efficient expression in stamen and petal, is a new stamen and petal high efficient expression starter and drive the P76247 of this gene.
The expression pattern of the native gene that B, P76247 drive:
In the rape of growing from grown in field condition, two No. 11 (as previously mentioned) plant are got root, stem, leaf, bud, angle fruit, gynoecium, petal, petal.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen flash freezer-80 ℃ of preservations.That utilizes Trirol extraction test kit (as previously mentioned) carries out the extraction of RNA according to the requirement of test kit.(purchased from Takara company, below identical) carried out in the explanation of reverse transcription reference reagent box.
Quantitative real time PCR Instrument is IQ5(Bio Rad Laboratories), adopt rape Actin as internal standard gene (accession number AF111812), Actin gene primer is 5 ' CTGGAATTGCTGACCGTATGAG3 ' and 5 ' ATCTGTTGGAAAGTGCTGAGGG3 '.The native gene Bn76247 primer that P76247 drives is 5'TTTGTTACCGTGCTGCTCA3' and 5'AAAGCCGTCCATCTATCAT3'.
Quantitative fluorescent PCR reacts every group of experiment and all completes three biology repetitions, and each biology repeats at least to do three technology and repeats.Detect respectively the expression of native gene in Oil Rape Tissue (root, stem, leaf, flower, angle fruit, gynoecium, petal, petal) that P76247 drives.
With the relative expression quantity that compares Ct method (Δ Δ Ct) calculating gene.By 2 -Δ Δ Ctrelative expression quantity and systematic error (Kenneth J Livak.Thomas D Schmittgen.2001, the Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the2 of estimation goal gene -△ △ CtMethod.METHODS25,402 – 408).Obtain the expression values (Fig. 1) of relative Actin gene.
C, homologous sequence method clone P76247 sequence:
1, the primer sequence of rape promotor P76247:
The Bn76247 upstream region of gene 2kb sequences Design 1 obtaining according to rape genome sequencing is carried out pcr amplification to primer, and the primer of employing is P76247S:5 '-CTTAGTAGTTGTATCCACAGGTG-3' and P76247A:5 '-CTTGATCTATGTTAATGTTATATATG-3 '.
2, the preparation of rape promotor P76247:
Utilize SDS cracking process (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) extraction rape leaf genomic dna, carry out pcr amplification as template, step is: extract genomic dna 25 μ l, increase as template, reaction system is 50 μ l, add respectively 10 × Ex Taq buffer5 μ l, dNTP4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq0.5 μ l, the about 100ng of DNA masterplate 1 μ l, ddH 2o37.5 μ l.The Bn76247 upstream region of gene 2kb sequences Design PCR the primer obtaining according to rape genome sequencing is that P76247S and P76247A carry out pcr amplification, amplified production size is 1986bp(Fig. 2), PCR response procedures be 94 5 minutes, 94 1 minute, 59 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 10 minutes, 16 3 hours, PCR product is through 1.0%(sepharose/TE solution quality volume ratio, identical below) agarose gel electrophoresis detection, gel reclaims test kit (purchased from root biochemical technology Beijing, sky company limited, identical below) purifying reclaim after, be connected to pMD18-T carrier (purchased from Dalian precious biotechnology company limited, identical below), heat shock method (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) competent cell that transforms gold bacterial strain is (purchased from Dalian precious biotechnology company limited, identical below), coat and contain penbritin 50 μ g/mL(mass volume ratios, identical below) LB solid medium (fill a prescription as follows: take respectively 10 grams of Tryptoness, 5 grams of yeast extracts and 10 grams of sodium-chlor, 8 grams of agar are dissolved in distilled water successively, constant volume is in 1000 milliliters.Be sub-packed in 500 milliliters of triangular flasks, 121 ℃, autoclave sterilization 20 minutes under 6.859 × 104Pa.Point install in culture dish, 4 ℃ of refrigerations are for subsequent use, below identical) on flat board, 37 ℃ of overnight incubation, select 6 of hickies, employing M13 primer: 5 ' TGTAAAACGACGGCCAGT3 ' and 5 ' CAGGAAACAGCTATGACC3 ', do bacterium colony PCR detection.Bacterium colony PCR concrete grammar (following identical) is to do masterplate by a small amount of bacterial plaque of toothpick picking of sterilizing, and reaction system is that 10 μ L include: 10 × Taq buffer(is containing MgCl 2) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, (5U/ μ is 0.5 μ l l), ddH for Taq 2o6.5 μ l.Reaction conditions be 94 5 minutes, 94 1 minute, 55 1 minute, 72 ℃ 2 minutes 30 seconds, 33 circulations, 72 10 minutes, amplification size is 1960bp, already described before 1.0%() agarose gel electrophoresis detected magnitude correctly after.Bacterial plaque correct PCR detected magnitude is inoculated into containing the liquid LB substratum of penbritin 50 μ g/mL and (is filled a prescription as follows: take respectively 10 grams of Tryptoness, 5 grams of yeast extracts and 10 grams of sodium-chlor, be dissolved in distilled water, constant volume is in 1000 milliliters, 121 ℃, autoclave sterilization 20 minutes under 6.859 × 104Pa, identical below), at 37 ℃, 200r/min shaking culture is spent the night, alkaline process (J. Pehanorm Brooker .D.W. Russell work in a small amount, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) extraction plasmid, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (being 1960bp), (2 kinds of enzymes are purchased from TaKaRa company to adopt Kpn I/BamH I enzyme, identical below) cut plasmid is carried out to double digestion (following identical), it is 10 μ l that enzyme is cut system (following identical), comprise plasmid DNA 5 μ l, Kpn I 0.5 μ l, BamH I0.5 μ l, ddH 2o4 μ l, 37 ℃ are spent the night, already described before 1.0%() agarose gel electrophoresis detects.The correct positive recombinant clone called after pMD18-P76247(of detection is connected into pMD18-T vector construction by object fragment P76247 to be formed, identical below), pMD18-P76247 is served to Hai Yingjun company and check order, analytical results, obtain P76247 full length sequence, name P76247.
D, promoter sequence bioinformatic analysis:
By core promoter element and Upstream cis acting promoter prediction software http://www.fruitfly.org/seq_tools/promoter.html and PLACE (Higo et al. for cloned P76247 sequence, Plant cis-acting regulatory DNA elements (PLACE) database (J) .Nucleic Acids Research.1999,27:297~300.http: //www.dna.affrc.go.jp/PLACE) predict.Result shows that cloned promoter sequence contains TATA box core promoter sequence, the upstream promoter elements such as CAAT and flower specifically expressing element are as POLLEN1LELAT52 and GTGANTG10(Bate N, Twell D.Functional architecture of a late pollen promoter:pollen-specific transcription is developmentally regulated by multiple stage-specific and codependent activator elements.Plant Molecular Biology.1998, 37, 859 – 869.) and GTGANTG10 (Rogers HJ et al.Functional analysis of cis-regulatory elements within the promoter of the tobacco late pollen gene g10.Plant Molecular Biology.2001, 45, 577 – 585.) (Fig. 3).
The application of swede type rape promotor P76247 in stamen and the petal of Arabidopis thaliana transfer-gen plant, the steps include:
1, the structure of P76247 plant expression vector and agrobacterium tumefaciens bacterial strain EHA105(are purchased from Hu Shang bio tech ltd, Shanghai, below identical) conversion:
The recombinant vectors building is that the 35S promoter on plasmid pBI121 (purchased from TaKaRa company, below identical) is obtained to the replacement of P76247 fragment with clone in the preparation method of a kind of swede type rape promotor P76247.For completing this object, first, utilize the primer with useful BamH I and Kpn I restriction enzyme site redesigning: P76247S/e:5-' CAGggtaccCTTAGTAGTTGTATCCACAGGTG-3' and P76247A/e5-CGCggatccCTTGATCTATGTTAATGTTATATATG-3' increase P76247 sequence from pMD18-P76247 plasmid.PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is already described before 1.0%() agarose gel electrophoresis detection, gel reclaims after the recovery of test kit (already described above) purifying, with BamH I/Kpn I (already described above) double digestion purify reclaim PCR product, cut pBI121(Chen with BamH I/Kpn I enzyme simultaneously, P.Y., Wang, C.K., Soong, S.C.To, K.Y.Complete sequence of the binary vector pBI121and its application in cloning T-DNA insertion from transgenic plants.Mol.Breed.11, 287-293) plasmid.It is that 10 μ l endonuclease reactions carry out in 37 degree incubators that enzyme is cut system (already described) above, after about 4-6 hour, with already described before 1.0%() agarose gel electrophoresis detects.PCR product enzyme is cut to large fragment (about 1900bp) DNA gel that rear fragment (size for 1986bp, and already described before pBI121() enzyme cuts to be reclaimed test kit (already described) above and reclaims.In already described before PCR product endonuclease bamhi and pBI121() large fragment that cuts of enzyme is according to ratio (molar concentration rate) biased sample of (150ngPCR product endonuclease bamhi: 50ng large fragment)=3:1, adds T 4dNA ligase 1 μ l, 10 × reaction buffer, 1 μ l, aseptic ddH 2o supplements volume to 10 μ L, and 16 ℃ of connections are spent the night.Heat shock method (already described above) transforms after the competent cell (stating above) of gold bacterial strain, screening on solid LB substratum (the stating above) flat board that contains kantlex (50 μ g/mL), picking white bacterial plaque is before bacterium colony PCR(and is stated), extract plasmid (already described) above, cut the recombinant plasmid called after pBI-P76247 of checking size correct (1986bp) through enzyme.
Utilize freeze-thaw method (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate, molecular cloning test guide (third edition) Science Press, below identical) transform before Agrobacterium EHA105(already described): step is as follows:
A: get 0.2ml competence Agrobacterium, slowly melt in ice.
B: add approximately 2 μ g recombinant plasmid dnas, mix gently, after ice bath 30min, drop into liquid nitrogen flash freezer 1min, then 37 ℃ of water-bath 5min, melt cell.
C: add 800 μ l not containing microbiotic LB liquid nutrient medium (already described) above, 28 ℃ of jogs are cultivated 4-5h.
D:12000rpm, 30s, removes supernatant, and cell is resuspended in 0.2ml LB liquid nutrient medium (already described) substratum above.
E: culture is uniformly coated on containing Rif(50mg/L), Str(50mg/L) on LB solid medium (already described above) agar plate and Kan(50mg/L), cultivate 2 days for 28 ℃, treat to occur on flat board bacterium colony, picking bacterial plaque, with bacterium colony PCR detection validation (already described above).
2, the functional analysis of P76247:
A, P76247 plant expression vector pBI-P76247 genetic transformation and the transfer-gen plant screening in Arabidopis thaliana:
Adopt inflorescence infestation method (Zhang X.R.et al.Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method.Nature, 2006,1:1-6, below identical) carry out transformation of Arabidopsis thaliana.Already described before the agrobacterium tumefaciens EHA105(that preparation contains recombinant vectors pBI-P76247) bacterium liquid, proceed in the LB liquid nutrient medium (already described) that contains kantlex 50 μ g/ml, Rifampin 50 μ g/ml 28 ℃ of incubated overnight the day before yesterday above in conversion.Second day, under 276nm nano wave length, detect the light absorption value of bacterium liquid with ultraviolet spectrophotometer (SPEKOL1300), in the time that reaching between 1.6-2.0, takes out the light absorption value of bacterium liquid.Room temperature (20-25 ℃, below identical), with the centrifugal 10min of 4000g, is abandoned supernatant, and precipitation is suspended in isopyknic 5% sucrose solution (mass volume ratio of sucrose and distilled water, below identical).Muddy sucrose solution is poured in a large culture dish, and before conversion, adding final concentration is 0.02%(volume ratio) Silwet l-77(purchased from the Five continents, Beijing unit industry science and trade center, below identical).Mix afterwards whole Arabidopis thaliana to be transformed inflorescence being immersed in sucrose gently, silent several 15 seconds, take out plant.Plant after conversion is wrapped with a black plastic bag, is placed on growth case and cultivates.Plastics bag was opened in second day, cultivate in the place that is placed on light intensity.Conversion tried again every one week.Cultivate and gather in the crops seed in about one month, seed is dry 3-5 days under incubator or daylight.The T0 that will transform results is for seed 70%(volume ratio) alcohol and 0.1%(mass ratio) mercuric chloride distinguish surface sterilization 3 minutes and 10 minutes, then with distilled water wash (5~7 times) for several times, then blow and beat to containing MS solid screening culture medium (the MS macroelement mother liquor 100ml that concentration is 50mg/L kantlex equably; MS trace element mother liquor 10ml; The organic mother liquor 10ml of MS; MS molysite 10ml; Inositol 10ml; Sucrose 30g; With 1M NaOH tune PH to 5.8,12g agar powder, is settled to 1L, for subsequent use after 121 ℃ of sterilizings of high pressure.Add 8g agar powder to can be configured to solid medium.Various mother liquor formulas are in table 1) surface.4 ℃ of vernalization 4-6 days, put into constant incubator (photoperiod 16(daytime)/8(dark) hour, temperature: 22 ℃ of daytimes, 20 ℃ of dark cycles) to cultivate, the transformed plant that screening obtains, claims T1 for transformed plant (following identical).According to distinctive kalamycin resistance screening positive plant on expression vector.When blade grows to enough size (3-4 leaf phase), get a little green seedling leaf, extract DNA, carry out the PCR positive detection (following identical) of converting material.Primer is NPT II F:5 ' GATGGATTGCACGCAGGT3 ' and NPT II R:5 ' TCAGAAGAACTCGTCAAG3 ', and reaction system is that 10 μ l include: template DNA template 1 μ L (about 100ng), 10 × Taq buffer(is containing MgCl 2) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, (5U/ μ is 0.5 μ l l), ddH for Taq 2o5.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute, 32 circulations, 72 ℃ 10 minutes, amplification size be 800bp.Result has shown to obtain transgenic positive plant (plant that contains testing goal fragment claims positive plant, below identical).
Table 1MS substratum mother liquor formula
Figure BDA0000467838470000111
B, P76247 functional analysis:
Replace before pBI121(already described with P76247) 35S promoter sequence on plasmid, form pBI-P76247 recombinant plant expression vector, gus gene is wherein subject to the regulation and control of P76247.Utilize before agrobacterium tumefaciens EHA105(already described) inflorescence infestation method (already described above) arabidopsis thaliana transformation of mediation.Results T0 for seed after, obtain T1 through kalamycin resistance screening and detect to screen for transformed plant (already described above) and PCR and obtain positive plant (already described) above.
By PCR checking be positive T1 for transfer-gen plant seed contain before the MS(that concentration is 50mg/L kantlex already described) substratum upper seeding wheel, after 4 ℃ of vernalization, in growth case, sprout sprouting condition: light application time 16h, temperature: 22 ± 2 , after emerging 5 days, start sampling dyeing.Dyeing course is as follows: sample is immersed in to GUS dye liquor (X-gluc0.5mg/mL, phosphoric acid buffer 50mmol/L, the each 0.5mmol/L of the Tripotassium iron hexacyanide and yellow prussiate of potash, EDTA10mmol/L, Triton-x-1000.001%(volume ratio), methyl alcohol 20%(volume ratio) in, vacuum suction 5 minutes, 37 ℃ are spent the night.Within second day, decolour with alcohol-acetic acid (volume ratio is 1:1), until blade bleaches, use afterwards distilled water rinsing (5~7 times) for several times, Stereo microscope (OLYMPUS SZX16) is taken pictures.Get respectively seedling stage 5 days, 10 days, the whole plant of 15 days; Reproductive stage, blade is got tender leaf and mature leaf; Flower rounds the flower that inflorescence contained out and the bud of not opening; Angle fruit after fertilization 5 days, 10 days, the angle of 15 days and 20 days really.It is exactly the position that gus gene is expressed that plant is dyed to blue position.Explore the spatial and temporal expression pattern of P76247 by detecting the expressive site of gus gene under different space-time and expression intensity.
Result shows the gus gene of this promoters driven at the stamen of Arabidopis thaliana, petal and high efficient expression in withering the petal after 2 days, but in seed, blade and root and stem, does not express (Fig. 6).Therefore, this promotor has the downstream gene of driving high efficient expression in plant stamen and petal, and does not express at seed and other positions.This promotor with tissue specific expression is at plant genetic engineering and Transgene-safty (eating), and utilizes in genetic engineering technique manual change ornamental plant pattern and petal form and have good using value.As contained this promoters driven and cause by structure the carrier of the gene of Anther Abortion, transformation receptor plant, the artificial male sterile material of creating, be applied in the production of cross-breeding, or control transgenic plant by the elegant genetically modified escape causing of pollen, or some improves the gene of pollens nutrition composition by promoters driven, improve pollens nutrition etc.The gene simultaneously driving due to P76247 is not expressed in seed, therefore in seed, there will not be the protein product of external source quiding gene, has important using value in transgenosis food safety field.
The description of a kind of rape P76247 promotor full length sequence SEQ ID NO:1 functional expression in model plant Arabidopis thaliana different tissues.Utilize homologous sequence method clone to obtain 5 ' upstream sequence of swede type rape Bn76247 gene, through core promoter element and Upstream cis acting promoter prediction software http://www.fruitfly.org/seq_tools/promoter.html and PLACE (Higo et al., Plant cis-acting regulatory DNA elements (PLACE) database (J) .Nucleic Acids Research.1999, 27:297~300) http://www.dna.affrc.go.jp/PLACE/ predicts, result shows that cloned promoter sequence contains TATA box core promoter sequence, the upstream promoter elements such as CAAT and flower specifically expressing element are as POLLEN1LELAT52 and GTGANTG10(Fig. 3).In addition, fluorescent quantitation and GUS coloration result show P76247 drive native gene in stamen and petal, express, in other tissue, do not express (Fig. 1, Fig. 6).The native gene that this explanation P76247 drives is the gene of a high efficient expression in rape stamen and petal, proves that P76247 is the promotor of high efficient expression in a rape stamen and petal.
The application of swede type rape P76247 promotor in stamen and the high efficient expression of petal of model plant Arabidopis thaliana, its process is: utilize homologous sequence method clone to obtain 5 ' upstream promoter sequence of rape Bn76247 gene.Build by already described before the plant expression vector pBI-P76247(of the reporter gene GUS of this promoter regulation).Adopt agriculture bacillus mediated florescence infestation method (already described) arabidopsis thaliana transformation above, T1 generation be added with before the MS(of kantlex already described) preliminary screening transfer-gen plant on substratum, when Arabidopis thaliana grows after two true leaves, be transplanted on vermiculite and continue to plant, when plant occurs after inflorescence, carry out PCR detection, utilize Molecular tools to identify positive strain.T2 is for selecting 10 transgenic lines to carry out GUS dyeing.GUS histochemical method dyeing shows, the gus gene of this promoters driven is high efficient expression in the stamen of Arabidopis thaliana and petal.As can be seen here, the gus gene of this promoters driven has certain spatial and temporal expression specificity, has the downstream gene of driving high efficient expression in stamen and petal, does not express the function of (Fig. 6) in seed completely.This promotor with tissue specific expression has using value in manual creation germ plasm resource, rape and arabidopsis thaliana genetically engineered and Transgene-safty (eating), as utilize the goal gene of this promoters driven and pollen granule related to development, first build the over-express vector that P76247 drives goal gene, transformation receptor plant, goal gene is under the driving of P76247 promotor, can improve the expression amount of goal gene in above-mentioned tissue, in seed, do not express completely, can not cause food-safety problem.Because rape and Arabidopis thaliana belong to brassica plant, and brassica plant has very strong conservative property in the sequence of flower development genes involved and function.Therefore, can also utilize the synthetic relevant goal gene of this promoters driven and anthocyanidin, first build the over-express vector that P76247 drives goal gene, transform rape and other Btassica acceptor plant, goal gene is under the driving of P76247 promotor, can improve the expression amount of goal gene in rape and other Btassica Petals, reach the object that changes petal color, in the initiative of ornamental plant (a lot of ornamental plants belong to rape and belong to) novel material, have important using value.
Described rape is any all can.
Compared with prior art, heavy effect has the following advantages in the present invention:
1, the root, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal that the utilizes swede type rape high-throughput of totally 11 tissues transcribed group sequencing technologies, in conjunction with sequencing data of whole genome, by analysis, fast prediction goes out the candidate gene of a large amount specifically expressing in rape stamen and petal, verifying by the method for fluorescent quantitation subsequently, is a kind of new organizing specific expression promotor method of acquisition of high efficient and reliable.
2, the promotor that the promotor cloning process providing is cloned into can be passed through regulation and control and histochemical analysis to gus gene, obtains the rape promotor with tissue specific expression function.
3, P76247, in the security of transgenosis edible oil, improves the aspects such as crop quality aspect and manual creation germ plasm resource, has good application potential.
4, this promotor has good application potential aspect ornamental plant pattern and the improvement of petal form.
Accompanying drawing explanation:
Fig. 1 is a kind of expression pattern analysis chart of native gene of P76247 driving.
Fig. 2 is a kind of homologous clone method amplification P76247 fragment electrophorogram.
Swimming lane 1 does not represent that genomic dna is template pcr amplification result; Swimming lane M represents nucleic acid Marker.
Fig. 3 is the analysis of P76247 promoter sequence.
Shaded boxes represents primary element, and underscore represents the element that anther-specific expression is relevant.
Fig. 4 is a kind of pBI-P76247 carrier schematic diagram of structure.
Fig. 5 is the part transfer-gen plant PCR evaluation figure of a kind of conversion carrier pBI-P76247.
Swimming lane M represents the nucleic acid Marker of DL2000; Swimming lane 1 represents the PCR of pBI-P76247 positive plasmid
Amplification; The pcr amplification result of the positive strain of swimming lane 2-18: swimming lane 19 wild-type Arabidopis thalianas
Pcr amplification result.
Fig. 6 is a kind of histochemical stain result of gus gene of P76247 driving.
A:15 day seedling (colourless); B: blade (colourless); C: stem (colourless); D: angle fruit (colourless);
E: bud (stamen, the blue look of petal); F: petal (blue look).
Embodiment
According to following examples, can better understand the present invention, but described embodiment is in order better to explain the present invention rather than limitation of the present invention.
Embodiment 1:
Flower pesticide specific expression gene Bn76247 and promotor P76247 prediction:
The present invention's rape used is two No. 11 (already described above) in swede type rape.Be seeded in land for growing field crops for examination material, normal field management.The rapeseed plants of growing from grown in field condition is got root, stem, leaf, bud, ovule, angle fruit, angle pericarp, petal, gynoecium, sepal, petal totally 11 tissues.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen flash freezer-80 ℃ of preservations.That utilizes Trirol extraction test kit (already described) above carries out the extraction of RNA according to the requirement of test kit.The RNA extracting is sent to BGI-Shenzhen and carries out reverse transcription, build storehouse and and utilize solexa sequencing technologies (already described) to carry out above and transcribe group examining order.Each organizes sequencing data amount is already described before 10G().After order-checking, with the gene expression abundance of RPKM value (already described above) icp gene in different tissues.RPKM calculation formula is as follows: RPKM=(109 × C) ÷ (N × L) wherein C be that comparison is to the reads number of certain gene; N is total reads number that sample is compared all genes; L is mrna length.RPKM value is higher shows that the expression level of this gene is higher.By the RPKM value of all genes of rape in above-mentioned 11 tissues relatively, discovery Bn76247 RPKM value in bud is 36.3, and in stamen, RPKM value is 365.8, and in petal, RPKM value is 265.6, and RPKM value in all the other 8 tissues is 0.Illustrating that Bn76247 may be the gene of a high efficient expression in stamen and petal, is a new stamen and petal high efficient expression starter and drive the P76247 of this gene.
Embodiment 2:
The expression pattern analysis of the native gene that rape P76247 drives:
Be seeded in land for growing field crops for examination material, normal field management.In the rape of growing from grown in field condition, two No. 11 (as previously mentioned) plant are got root, stem, leaf, bud, angle fruit, gynoecium, petal, petal.Every kind of material is at least got three repetitions, eachly repeats at least one strain, after sampling, with masking foil parcel, is positioned over rapidly in liquid nitrogen-80 ℃ of preservations.Already described before extraction RNA(method).Quantitative real time PCR Instrument is IQ5(Bole company), adopt rape Actin(accession number AF111812) as internal standard gene, Actin gene primer is forward primer 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and oppositely draws 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.The native gene Bn76247 primer that P76247 drives is 5'5'TTTGTTACCGTGCTGCTCA3' and 5'AAAGCCGTCCATCTATCAT3'.Quantitative fluorescent PCR reaction system is 20 μ L: contain SYBR Mix10 μ L, and the each 0.8 μ L of forward and reverse primer (10 μ mol/L), template 2 μ L, the sterilized water that DEPC processed complements to 20 μ L.Amplification condition is: 94 ℃, and 5min:94 ℃, 15s, 60 ℃, 20s, 72 ℃, 30s, 40 circulations; Eachly be circulated in 72 ℃ of renaturation ends and carry out fluoroscopic examination.Reaction finishes to be first heated to 95 ℃ afterwards, is then down to 72 ℃, is more slowly warming up to 95 ℃, records the variation of fluorescent signal, draws the melting curve of amplified production.Every group of experiment all completes three biology and repeats, and each biology repeats at least to do three technology and repeats.Detect respectively the expression of native gene in Oil Rape Tissue (root, stem, leaf, bud, angle fruit, gynoecium, petal, petal) that P76247 drives.
With the relative expression quantity that compares Ct method (Δ Δ Ct) calculating gene.Utilize instrument (IQ5, Bole company) software of being with, first optimize internal standard gene and goal gene amplification condition, measure respectively the Ct value of Actin and goal gene, choosing three results (systematic error of Ct value is less than 0.3) that approach the most in nine measured value of experiment averages, then by internal standard gene, goal gene is proofreaied and correct and obtained Δ Δ Ct, finally by 2 -Δ Δ Ctrelative expression quantity and the systematic error (already described above) of estimation goal gene.Calculating when relative expression quantity, take the expression level of reference gene Actin as reference, convert 1 to by its value, other sample again with its relatively, obtain relative expression's value.
Result shows: the native gene that P76247 drives a large amount in stamen and petal is expressed (Fig. 1), in other tissue, does not express.The native gene that this explanation P76247 drives is the gene of a high efficient expression in stamen and petal, proves that P76247 is a stamen and petal high efficient expression starter.
Embodiment 3:
A preparation method for swede type rape promotor P76247 promotor, the steps include:
1, the primer sequence of rape promotor P76247:
The Bn76247 upstream region of gene 2kb sequences Design 1 obtaining according to rape genome sequencing is carried out pcr amplification to primer, and the primer of employing is P76247S:5 '-CTTAGTAGTTGTATCCACAGGTG-3' and P76247A:5 '-CTTGATCTATGTTAATGTTATATATG-3 '.
2, the preparation of rape promotor P76247:
Utilize SDS cracking process (already described) to extract rape leaf genomic dna above, carry out pcr amplification as template, step is: extract genomic dna 25 μ l, increase as template, reaction system is 50 μ l, add respectively 10 × Ex Taq buffer5 μ l, dNTP4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq0.5 μ l, the about 100ng of DNA masterplate 1 μ l, ddH 2o37.5 μ l.The Bn76247 upstream region of gene 2kb sequences Design PCR the primer obtaining according to rape genome sequencing is already described before P76247S and P76247A().Amplified production size is 1986bp, PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is already described before 1.0%() agarose gel electrophoresis detection, gel reclaims after the recovery of test kit (already described above) purifying, be connected to pMD18-T carrier (already described) above, heat shock method (already described above) transforms the competent cell (already described) of gold bacterial strain above, coat contain before penbritin 50 μ g/mL(already described) LB solid medium (already described above) flat board on, 37 ℃ of overnight incubation, select 6 of hickies, adopt M13 primer (already described) above, be bacterium colony PCR and detect (already described) above, already described before 1.0%() after agarose gel electrophoresis detected magnitude is correct.Bacterial plaque correct PCR detected magnitude is inoculated into the liquid LB substratum (already described) containing penbritin 50 μ g/mL above, at 37 ℃, 200r/min shaking culture is spent the night, alkaline process (already described above) extracts plasmid in a small amount, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (being 1960bp), adopt Kpn I/BamH I enzyme (already described) to cut above plasmid is carried out to double digestion (already described) above, it is 10 μ l that enzyme is cut system (already described) above, 37 ℃ are spent the night, already described before 1.0%() agarose gel electrophoresis detects.Detect correct positive recombinant clone, already described before called after pMD18-P76247(), pMD18-P76247 is served to Hai Yingjun company and check order, pMD18-P76247 is served to Hai Yingjun company sequencing, analytical results, obtains P76247 full length sequence, name P76247.A promotor for separation, its series be the nucleotide sequence shown in SEQ ID No.1 or with the SEQ ID No.1 nucleotide sequence of homology in fact.
3, the structure of rape P76247 recombinant expression vector and agrobacterium tumefaciens transform:
Utilize the primer with useful BamH I and Kpn I restriction enzyme site redesigning: P76247S/e:5-' CAGggtaccCTTAGTAGTTGTATCCACAGGTG-3' and P76247A/e5-CGCggatccCTTGATCTATGTTAATGTTATATATG-3' increase P76247 sequence from pMD18-P76247 plasmid.PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is already described before 1.0%() agarose gel electrophoresis detects, after gel reclaims test kit (already described) purifying above and reclaims, purify with BamH I/Kpn I (already described) double digestion the PCR product reclaiming above, cut before pBI121(already described with BamH I/Kpn I enzyme simultaneously) plasmid.Gel reclaims before the P76247 fragment that scales off of enzyme and pBI121(already described) fragment, connect, heat shock method (already described above) transforms intestinal bacteria, is built into before plant expression vector pBI-P76247(already described) (Fig. 4).Finally use freeze-thaw method (already described) that this carrier is imported before agrobacterium tumefaciens EHA105(already described above), select positive colony containing (already described) on kantlex (50mg/L) and the dual anti-property of Rifampin (50mg/L) LB flat board above, with already described before bacterium colony PCR() whether checking contain target fragment.
Embodiment 4:
The transformation of Arabidopsis thaliana of pBI-P76247 and PCR detect:
Adopt inflorescence infestation method (already described) arabidopsis thaliana transformation above, according to the peculiar kalamycin resistance of transfer-gen plant, contain before the MS(that concentration is 50mg/L kantlex already described) grow on substratum, the green seedling of acquisition is tentatively thought transformed plant.Plant to be transformed grows after two true leaves, is transplanted in vermiculite, and plant to be planted occurs after inflorescence, gets a slice true leaf SDS method and extracts genomic dna (already described) above, is PCR and identifies.Primer sequence is already described before NPT II F and NPT II R(), PCR reaction system is as follows: template DNA 1 μ L (about 100ng), 10 × Taq buffer(are containing MgCl2) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, (5U/ μ is 0.5 μ l l), ddH2O5.5 μ l for Taq.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 2min32 circulations, 72 ℃ are extended 5min.By 1% sepharose (already described above) electrophoresis detection PCR reaction product, size is 800bp.Result shows that P76247 expression vector pBI-P76247 has successfully proceeded to Arabidopis thaliana (Fig. 5), obtains altogether the positive seedling of 20 strains.
Embodiment 5:
The functional analysis of swede type rape P76247 promotor:
The present invention clones the sequence that obtains P76247 first, and it has been carried out to functional analysis.From embodiment 4, detect (above already described) by model plant transformation of Arabidopsis thaliana (already described) and PCR above and screen the positive seedling T1 generation obtaining, selfing results seed (being T2 generation).At different times, the different tissues of getting T2 generation 10 strain transformed plants carries out GUS dyeing.
It is as follows that in T2 generation, is got dyeing course: sample is immersed in to GUS dye liquor (X-gluc0.5mg/mL, phosphoric acid buffer 50mmol/L, the each 0.5mmol/L of the Tripotassium iron hexacyanide and yellow prussiate of potash, EDTA10mmol/L, Triton-x-1000.001%, methyl alcohol 20%(volume ratio) vacuum suction 5 minutes, 37 ℃ are spent the night.Within second day, decolour with alcohol-acetic acid (volume ratio is 1:1), until blade bleaches, use afterwards distilled water rinsing 3-5 time, Stereo microscope (OLYMPUS SZX16) is taken pictures.Get the whole plant of different time sections seedling stage; Reproductive stage, blade is got tender leaf and mature leaf; The flower that flower took away; Angle fruit is got the angle fruit of different times; Seed takes away the seed of spending latter about 10 days.It is exactly the position that gus gene is expressed that plant is dyed to blue position.
Coloration result is found (asking for an interview table 2, Fig. 6), does not all occur bluely in seedling, root, stem, blade and angle fruit, only has in the stamen of open bud and petal and occurs significantly blue reaction.As can be seen here, the gus gene of this promoters driven is mainly expressed in stamen and petal thereof, in other tissue, does not express.
Experimental result shows, rape P76247 has following biological function: the gus gene of this promoters driven is expressed in the stamen of Arabidopis thaliana and petal, in other tissue, does not express.Gus gene under P76247 regulation and control has certain spatial and temporal expression characteristic, and this explanation P76247 has the function that drives downstream reporter gene GUS to express in recipient plant.Under the regulation and control of this promotor, gus gene can be mainly meticulous expression in the stamen of transfer-gen plant and petal, and in other tissue, do not express (asking for an interview table 2, Fig. 6) completely.
Table 2P76247 transgenic arabidopsis T2 is for the GUS dyeing cartogram of strain
Figure BDA0000467838470000171
This promotor with tissue specific expression has using value in plant genetic engineering and Transgene-safty (eating).
The application of a kind of swede type rape P76247 promotor in stamen and the petal of model plant Arabidopis thaliana.Its process is: utilize homologous sequence method clone to obtain 5 ' upstream promoter sequence of rape Bn76247 gene.There is core parts and the upstream element of promoter expression through bioinformatic analysis this promoter sequence, build by already described before the plant expression vector pBI-P76247(of the reporter gene GUS of this promoter regulation).Adopt agriculture bacillus mediated florescence infestation method arabidopsis thaliana transformation, T1 generation be added with before the MS(of kantlex already described) preliminary screening transfer-gen plant on substratum, when Arabidopis thaliana grows after two true leaves, be transplanted on vermiculite and continue to plant, when plant occurs after inflorescence, carry out PCR detection, utilize Molecular tools to identify positive strain.T2 is for selecting 10 transgenic lines to carry out GUS dyeing.GUS histochemical method dyeing shows, the gus gene of this promoters driven is expressed in the stamen of Arabidopis thaliana and petal.As can be seen here, the gus gene of this promoters driven has certain spatial and temporal expression specificity, has the downstream gene of driving and expresses in stamen and petal, does not express the function of (asking for an interview Fig. 6) in other tissue completely.This promotor with tissue specific expression has good using value in plant genetic engineering and Transgene-safty (eating), as utilize this promoters driven pollen fertility or the goal gene relevant with oleaginousness, first build the over-express vector that P76247 drives goal gene, transformation receptor plant, goal gene is under the driving of P76247 promotor, in stamen and petal, express, can improve the expression amount of goal gene in above-mentioned tissue, in seed, do not express completely, can not cause food-safety problem.Can also utilize the synthetic relevant goal gene of this promoters driven and anthocyanidin simultaneously, first build the over-express vector that P76247 drives goal gene, transformation receptor plant, goal gene is under the driving of P76247 promotor, can improve the expression amount of goal gene in Petal, reach the object that changes petal color, in the initiative of ornamental plant novel material, have important using value.
SEQ ID No.1
<110> Inst. of Oil Crops, Chinese Academy of Agriculture
<120> swede type rape P76247 promotor and preparation method and application
<130> swede type rape P76247 promotor and preparation method and application
<160> 1
<170> PatentIn version 3.1
<210> 1
<211> 1989
<212> DNA
<213> swede type rape P76247 promotor and preparation method and application
<400> 1
ttagtagttg tatccacagg tgcgcacaca cctccatgcc gtcttgagtt cctctccttc 60
cacagcacat aaatggctgt ctgaaaaact aagtggagga gtatagcatc gagtctgttc 120
ctgttctggc gtaacgggga ggtgactgta tcttcccagt tcggtgttat cgctggacca 180
agtaatttct ctgcaacatt catccatact gtgaaggtat atgggcaagc gaaaaacaaa 240
tgatctctgc tttcatcctt ctctccgcag tagacacagc attgctccat tccccattct 300
ctcattctag tgcttgttga taatctgtcc ttgaaagcta accataccat gaaggattgt 360
cggggtatgg cctgagggaa ccacacaata caatgccagg gaagctttct ctttttaact 420
cgcaggtagt tccatgtctt ggtagctgag aagtatggtt tgaaatcatc ctggtcatgt 480
ctccatatag ctatatctgg tcctgcagta gctaccggtc gtggagtctc tgcaagcata 540
tcacagagat ggtggtatcg tctctgtcca catctccgaa tgttccagct gtcgtcgcgg 600
gttgcttcag cgagcgttgc ggacctgctc actctaaggt agcttatgcc cagctctcct 660
gttatatcaa tcaatctgcc catttctaac cagttatcga accaaaaatg cacgttaccc 720
catttctaac ctcgaaccga atgcattcgt atgcaatggg tctaagtttg agcagtttcc 780
gccataccca cgatcccttt ttgtcactgg catcccagtg agagctattc ttgagtagat 840
actgtcgggt ccaagcaacc caaaaggagc cagtaagaga gaatagtttc cagataagac 900
tcagtgcaaa tactcgcgaa gtgtcgctaa gacgtctgat gcctagtcca ccttcttcct 960
tggggcaaca gagatctttc caagcaactt tggctttatg agtaatggtt ggcgaaccag 1020
accataagaa ggcactgcac atactctcga tggtatctaa acagccttgc ggcaagataa 1080
acgctgagct ccaaaaattg acggtacttg cggtcacaga ctttatcaat tggagtcgac 1140
ctgcaaaaga taatgctcga tgcgtccatg agagaatttt ttttgcgaag ctgatcaata 1200
agaggctcgt actccagctt gctccaagac ttggtcgtta gaggcatacc caaatatctc 1260
accggtagcg ttcctgttac aaacccacgg ctctgagcag cttgaataaa tagatgatgg 1320
ttcttcccag cggcaaagat ggaagactta gagacattaa tctgtagacc tgataatgct 1380
gcgaacttgt ccataacttc aagaaccccg ttaagagacc tcacacttcc atcagtgaat 1440
actaatatat catgctgcga acttgtccaa aataagtatt gttttggaca acttacagat 1500
taatcatatt cacaagtaga aaaataaaat acaaaagctg aagaatatat gtaatttggt 1560
agtatataaa atataggcct gaatattata cgaaatttat ttatctacca tacattaaat 1620
actgtaattt attagacttg taaattacta aatatataat tgaattctcc agtccacata 1680
catgcaaaga ttgagaactt attctcatct caaaagaagt tccttcactt ttacagccat 1740
gcatccatcg gtcggtctcg aatgcatttt ctctagacaa taatgttatt ttaacctcgt 1800
atagctcata tattatatac atagatacga atccacgtac gtgttaaagc atgttgtgta 1860
cacgcgagag gttgtctttt gtatatcacc cccagaattt cctagctatt tcctgttctc 1920
tctctctcac tctctataaa tatgaaaact tagatgtata catatataac attaacatag 1980
atcaag 1986

Claims (7)

1. a promotor P76247 for separation, its sequence is the nucleotide sequence shown in SEQ ID No.1.
2. the promotor of a kind of separation according to claim 1, is characterized in that: described promotor contains recombinant vectors pBI-P76247.
3. the preparation method of a kind of swede type rape promotor P76247 claimed in claim 1, the steps include:
(1) primer sequence of rape promotor P76247:
Obtain according to rape genome sequencing bnCP51upstream region of gene 2kb sequences Design 1 is carried out pcr amplification to primer, and amplification obtains rape bn762475 ' upstream promoter sequence, the primer be P76247S:5 '-CTTAGTAGTTGTATCCACAGGTG-3' and P76247A:5 '-CTTGATCTATGTTAATGTTATATATG-3 ';
(2) preparation of rape promotor P76247:
Utilize SDS cracking process to extract rape leaf genomic dna, carry out pcr amplification as template, step is: extract rape genomic dna 25 μ l, as template, adopt primer P76247S and the P76247A of step (1) design to increase, reaction system is 50 μ l, adds respectively 10 × Ex Taq buffer, 5 μ l, dNTP 4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq 0.5 μ l, the about 100ng of DNA masterplate 1 μ l, ddH 2o 37.5 μ l, amplified production size is 1986bp, PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product detects through 1.0% mass volume ratio agarose gel electrophoresis, after gel reclaims test kit purifying and reclaims, be connected to pMD18-T carrier, heat shock method transforms the competent cell of gold bacterial strain, picking positive colony, and PCR detects the positive and enzyme is cut the rear order-checking of checking, obtain goal gene upstream 2kb flanking sequence, through this sequence of bioinformatic analysis be bn76247promotor full length sequence, called after P76247.
4. the application of the promotor P76247 of a kind of separation described in claim 1 in rape stamen.
5. the application of the promotor P76247 of a kind of separation described in claim 1 in Arabidopis thaliana stamen.
6. the application of the promotor P76247 of a kind of separation described in claim 1 in rape petal.
7. the application of the promotor P76247 of a kind of separation described in claim 1 in Arabidopis thaliana petal.
CN201410058108.6A 2014-02-20 2014-02-20 Swede type rape P76247 promotor and preparation method and application Active CN103789313B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410058108.6A CN103789313B (en) 2014-02-20 2014-02-20 Swede type rape P76247 promotor and preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410058108.6A CN103789313B (en) 2014-02-20 2014-02-20 Swede type rape P76247 promotor and preparation method and application

Publications (2)

Publication Number Publication Date
CN103789313A true CN103789313A (en) 2014-05-14
CN103789313B CN103789313B (en) 2015-11-18

Family

ID=50665369

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410058108.6A Active CN103789313B (en) 2014-02-20 2014-02-20 Swede type rape P76247 promotor and preparation method and application

Country Status (1)

Country Link
CN (1) CN103789313B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107099532A (en) * 2017-06-05 2017-08-29 中国农业科学院油料作物研究所 Cabbage type rape embryo's specificity promoter pBnaA09g21960D and its application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102965374A (en) * 2012-11-27 2013-03-13 中国农业科学院油料作物研究所 Preparation method and applications of rape BnRabGDI3 promoter

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102965374A (en) * 2012-11-27 2013-03-13 中国农业科学院油料作物研究所 Preparation method and applications of rape BnRabGDI3 promoter

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FENG CHENG ET AL.: "The genetics and genomics database for Brassica plants", 《BMC PLANT BIOLOGY》 *
THE BRASSICA RAPA GENOME SEQUENCING PROJECT CONSORTIUM: "The ginome of the mesopolyploid crop species Brassica rapa", 《NATURE GENETICS》 *
王轩鹏 等: "甘蓝型油菜RabGDI3基因启动子的克隆和功能验证", 《中国油料作物学报》 *
石磊 等: "白菜型油菜PABP5基因启动子的克隆及表达特性分析", 《分子植物育种》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107099532A (en) * 2017-06-05 2017-08-29 中国农业科学院油料作物研究所 Cabbage type rape embryo's specificity promoter pBnaA09g21960D and its application
CN107099532B (en) * 2017-06-05 2019-12-13 中国农业科学院油料作物研究所 cabbage type rape embryo specific promoter pBnaA09g21960D and application thereof

Also Published As

Publication number Publication date
CN103789313B (en) 2015-11-18

Similar Documents

Publication Publication Date Title
Wang et al. Multi-gene co-expression can improve comprehensive resistance to multiple abiotic stresses in Brassica napus L.
CN105753953B (en) Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant
WO2023065966A1 (en) Application of bfne gene in tomato plant type improvement and biological yield increase
CN102220325B (en) Method for preparing cabbage type rape BnPABP3 promoter and application thereof
CN107653262A (en) Applications of the ZmCCT9 in corn Characteristics in florescence is regulated and controled
CN103789314B (en) Swede type rape P17673 promotor and preparation method and application
CN102220327B (en) Brassica napus BnPABP8 promoter and preparation method and use thereof
CN102965374B (en) Preparation method and applications of rape BnRabGDI3 promoter
US20150024388A1 (en) Expression of SEP-like Genes for Identifying and Controlling Palm Plant Shell Phenotypes
CN112342236A (en) Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield
CN104945492B (en) Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application
CN102634516B (en) Brassica napus BnCP51 promoter as well as preparation method and application of promoter
CN102226181B (en) Method for preparing promoter of Brassica napus BnPABP2 and application thereof
CN105087587A (en) Peanut AhFAD2-2A gene promoter and application of peanut AhFAD2-2A gene promoter
CN102226180B (en) Preparation method and application of brassica napus BnPABP5-3 promoter
CN105274106B (en) Peanut AhWRI-1 promoters and preparation method and application
CN103789313B (en) Swede type rape P76247 promotor and preparation method and application
CN105132428B (en) A kind of and the relevant ZmLRT genes of root system of plant character and its relevant biological material and application
CN110904106B (en) Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity
CN109536501B (en) Constitutive promoter pBnaC05g31880D of brassica napus and application thereof
CN104109682B (en) A kind of pectin lyase BnPL gene and promoter thereof and application
CN103788187B (en) Flowering of plant associated protein GmSOC1-like and encoding gene thereof and application
CN105420241B (en) Promoter of watermelon ClCP2 genes and its preparation method and application
CN108795942A (en) A kind of rice external cause stress-inducing expression promoter Ps ubs3 and its application
CN105734064B (en) OsCCT6 gene is in control rice yield, the application in florescence and plant height

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant