CN104611243A - Engineering strain-clonostachys rosea for perilipin gene transfer and application of engineering strain - Google Patents
Engineering strain-clonostachys rosea for perilipin gene transfer and application of engineering strain Download PDFInfo
- Publication number
- CN104611243A CN104611243A CN201510098635.4A CN201510098635A CN104611243A CN 104611243 A CN104611243 A CN 104611243A CN 201510098635 A CN201510098635 A CN 201510098635A CN 104611243 A CN104611243 A CN 104611243A
- Authority
- CN
- China
- Prior art keywords
- engineering strain
- per44
- strain
- perilipin
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
Abstract
The invention discloses an engineering strain-clonostachys rosea for perilipin gene transfer and an application of the engineering strain. The engineering strain is named as Cr-per44, has a preservation registration number of CGMCC (China General Microbiological Culture Collection Center) No.10028 in the CGMCC, is obtained by transferring a parasitic related gene-perilipin gene Per3 into clonostachys rosea HLD-1 through protoplast transformation, is strong in disease resistance and stable in prevention effect, can effectively prevent and control sclerotinia and gray mold of crops, and has relatively good prevention and control effects on various plant fungous diseases such as blight and root rot.
Description
Technical field
The invention belongs to biotechnology and technical field of biological control, specifically a kind of mould engineering strain of pink helix poly spore turning perilipin gene.
Background technology
The mould Clonostachys rosea of pink helix poly spore, original name: Gliocladium roseum Gliocladium roseum, it is the important bacterium bacterial parasite of a class, the various plants pathogenic fungies such as sclerotinite, Botrytis cinerea, sickle-like bacteria and rhizoctonia are infected by modes such as winding, punctures, the growth that antibacterial substance suppresses pathogenic bacteria can also be produced simultaneously, promote plant strain growth, inducing plant resistance, thus has huge Biocontrol Potential.But lacking highly pathogenicity bacterial strain in prior art, lacking strain excellent pilot scale culture technology is its key factor in field of plant disease control widespread use of restriction.
Prior art shows that lipase class plays an important role in plant disease-resistant, wherein perilipin is that a class regulates lipometabolic phosphorprotein, its adjustment is a kind of double regulation control metabolism, under base state perilipin egg be anchored to fat drip surface as physiologic barrier, prevent by intracytoplasmic lipase hydrolysis; Stimulate in the steatolysis that is in particular cases subject to lacking energy, fat drips fracture, forms much little fat and drips, and total surface area increases, but perilipin quantity does not significantly increase, and therefore the provide protection of perilipin weakens relatively, makes fat drip decomposition.Infect in locust research at Metarhizium anisopliae; perilipin drips by regulating fat the turgescence that metabolism affects appressorium; in this gene deletion mutants, fat drips the provide protection owing to losing perilipin and is decomposed; finally cause mutant strain appressorium turgescence to reduce and appressorium distortion, thus reduce the penetrativity to locust epidermis.
Pink helix poly spore trichoderma strain HLD-1 is a kind of Black Liquor with Efficient Bacteria bacterial parasite, Chinese microorganism strain preservation center deposit number CGMCC No.1037, can 100% be reached to the parasitic rate of sclerotium, and strong parasitization and obvious restraining effect are also shown to pathogenic fungies such as ash arrhizus bacteria, dry thread Pyrenomycetes and sickle-like bacteria, but there is the problem of preventive effect instability, improve this biocontrol strain disease-resistant performance further by genetic improvement significant.
Summary of the invention
The object of the invention is to provide a kind of mould engineering strain of pink helix poly spore and the application thereof that turn perilipin gene, solves the problem lacking highly pathogenicity bacterial strain and the mould preventive effect instability of existing pink helix poly spore in prior art.
A kind of mould engineering strain of pink helix poly spore turning perilipin gene, called after Cr-per44, be CGMCC No.10028 at the preservation registration number at Chinese microorganism strain management committee common micro-organisms center, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City.
The cultural characteristic of above-mentioned engineering strain Cr-per44 is: on PDA substratum, growth is very fast, and cultivating 10d colony diameter at 26 DEG C can reach 8 ~ 9cm, sees Fig. 1.Bacterium colony felted, is initially white, becomes greyish-green gradually after producing spore.Suitable growth, product spore temperature are 25 ~ 28 DEG C, and optimum pH is 6 ~ 7, and comparatively responsive to illumination.Microscopy form is: hyphae colorless, separation, and conidiophore is upright, can produce 2 ~ 3 grades of broom shape branches, and bottle stalk top produces a large amount of conidium, is gathered into spherical.Spore is avette or cylindrical, diameter 3 ~ 5 μm.
The construction process of above-mentioned engineering strain Cr-per44 is:
1) enzyme is cut pAN7-1 carrier and is obtained linearizing pAN7-1 carrier, linearizing pAN7-1 carrier and perilipin object segment composition is spliced, obtains conversion carrier;
2) cultivate the mould HLD-1 bacterial strain of pink helix poly spore, children mycelia in age is collected in screening, and children mycelia in age and helicase are carried out mixed enzymolysis, and filtration is also centrifugal, collects protoplast pellet, obtains protoplast solution with after STC solubilize;
3) conversion carrier is mixed with protoplast solution leave standstill, recovered by liquid nutrient medium TB3, shaking culture, centrifugal segregation supernatant liquor, after STC solution suspension precipitation, after mixing with TB3 substratum, a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices is cultivated, obtain the transformant of genetic stability, therefrom picking positive transformant.
The method of above-mentioned picking positive transformant is: the transformant RNA extracting genetic stability, and reverse transcription obtains cDNA, adopts agarose gel electrophoresis to detect, picking positive transformant after pcr amplification.
Above-mentioned engineering strain Cr-per44 is preparing the application in microbial bactericide.
A kind of microbial inoculum containing above-mentioned engineering strain Cr-per44.
The preparation method of the above-mentioned microbial inoculum containing engineering strain Cr-per44:
First recombinant bacterial strain Cr-per44 is cultivated on PDA flat board, after 7 ~ 10d, cut bacterium block, then the bacterium block cut is placed in shaking culture on PD nutrient solution, in the most backward nutrient solution, adds suspension agent and spreader-sticker, obtain liquid bacterial agent.
The condition of the shaking culture in above-mentioned bacterial preparation process is: rotating speed 180r/min on shaking table, temperature 28 DEG C, incubation time 2 ~ 3d.
The application of above-mentioned microbial inoculum in control farm crop sclerotium disease, gray mold, blight and root-rot.
This technology passes through protoplast transformation, parasitic genes involved-perilipin gene Per3 is proceeded in the mould HLD-1 bacterial strain of pink helix poly spore, obtain the mould engineering strain of pink helix poly spore turning perilipin gene, this recombinant bacterial strain Cr-per44 disease-resistant performance is strong, preventive effect is stablized, can effectively prevent and treat farm crop sclerotium disease and gray mold, also have good preventive and therapeutic effect to the various plants such as blight, root-rot fungal disease simultaneously.
Accompanying drawing explanation
Fig. 1 Cr-per44 bacterial strain cultivates the colonial morphology of 10d on PDA substratum.
Fig. 2 HLD-1 bacterial strain and Cr-per44 bacterial strain are to the situation that infects (5d) of sclerotinite sclerotium.
Embodiment
The following examples do further supplementary notes to technical solution of the present invention, but do not limit the present invention.
Perilipin full length gene 1284bp, comprises the open reading frame of 555bp, GenBank accession number KF269990.
Embodiment 1
The structure of perilipin conversion carrier
Utilize 3 '-Full RACE Core Set Ver.2.0 and 5 '-Full RACE Kit test kit respectively, carry out 3 ' RACE and 5 ' RACE to perilipin gene cDNA sequence fragment to increase, by two sections of extension amplification outcomes to pMD19-T carrier, order-checking, splicing, obtain Per3 full-length cDNA, performing PCR of going forward side by side is verified; Use special primer Per3F:5 '-3 ' GAAACTTCTCTTTCGTCTCTATCGA and Per3R:CTTGCAAGCACAGAAAGAAAATCAA to carry out amplification and obtain Per3 full length gene, GenBank accession number KF269990;
Conversion carrier selects pAN7-1 carrier for expression of eukaryon (being provided by Microbe Inst., Chinese Academy of Sciences), containing eukaryotic promoter gene gpda, the disease-resistant marker gene hph of Totomycin and terminator gene trpC.Adopt pcr amplification promotor, terminator and perilipin gene fragment, primer is respectively: (5 '-3 ') gpdaF:ACTCGACCTGCAGGCATGCAAGCTTGAATTCCCTTGTATCTCTACACA, gpdaR:ACCAATCCAAAAGCCTACTCTGAAGGGAAAAGAAAGAGAAAAGAAAAG, trpCF:TGTGATTATGAGCAAATATGGGGTGGATCCACTTAACGTTACTGAAA, trpCR:GTAAACGACGGCCAGTGCCAAGCTTTCGAGTGGAGATGTGGAGTGG, Per3F:GAAACTTCTCTTTCGTCTCTATCGA, Per3R:(CTTGCAAGCACAGAAAGAAAATCAA.Reaction system is 50 μ l, comprises 1 μ l template, 1 μ l upstream and downstream primer, 0.5 μ l High fidelity PCR polysaccharase (TransStart FastPfu Fly DNA ploymerase), 10 μ l Buffer, 5 μ l dNTPs and 31.5 μ l ddH
2o.PCR process is: 95 DEG C of denaturation 5min, carries out 35 circulations according to the following steps: 95 DEG C of sex change 30s, and 55 DEG C of annealing 30s, 72 DEG C extend 1min.Finally at 72 DEG C, keep 10min, terminate amplified reaction.After agarose gel electrophoresis, fragment sepharose is reclaimed test kit and carry out glue recovery.
Carrier pAN7-1 HindIII enzyme is cut.The enzyme system of cutting is: plasmid 30 μ l, HindIII 1 μ l, Buffer 4 μ l and ddH
2o 5 μ l.Reaction conditions is 37 DEG C, 1h.Enzyme is cut rear use PCR purification kit and is carried out purifying to product, obtains linear pAN7-1 carrier.
Promoter fragment, perilipin fragment, terminator fragment that use nucleic acid quantification instrument mensuration reclaims, and linear pAN7-1 fragment concentrations, be adjusted to carrier by concentration and each Insert Fragment optimum mole ratio is 1: 2.The 10 μ l fusion reaction systems that 4 fragments are placed in merge, system comprise the linear carrier that adds in proportion and each Insert Fragment, 2 × merge Mix 5 μ l, ddH
2o polishing.Mix gently, 50 DEG C of reaction 15min, are positioned over the cooled on ice several seconds, recombinant vectors is proceeded in competent escherichia coli cell Transl-T1, overnight incubation in ammonia benzyl resistance LB substratum (Tryptones 10g/L, yeast leaching powder 5g/L, sodium-chlor 10g/L) at 37 DEG C.Select positive colony and carry out PCR qualification and recombinant plasmid enzyme cuts qualification, and PCR primer is delivered to Shanghai Sheng Gong biotechnology company limited and check order, guarantee the exactness that fragment is inserted.Recombinant plasmid called after: pAN7-1-per3.
Embodiment 2
The conversion of recombinant vectors pAN7-1-per3
The mould HLD-1 of pink helix poly spore is inoculated on PDA substratum and cultivates 10d, add 5ml sterilized water wash-out spore, draw 1ml and be inoculated in PD nutrient solution, 26 DEG C, 160r/min shaking culture 12h.Collect mycelia, the nutrition of sterilized water wash-out with 500 order mesh screens of sterilizing, then rinse with the agent of 0.7M NaCl homeo-osmosis and make it balance.The a small amount of mycelia of picking, puts into the solution containing 40mg/ml helicase, and vortex oscillation makes it disperse, 28 DEG C, and 100r/min enzymolysis 3h, adds equal-volume homeo-osmosis dilution agent in order to avoid enzymolysis is excessive.500 order mesh screens remove cell debris, and filtrate be transferred in 50ml centrifuge tube, the centrifugal 10min of 4000r/min, abandons supernatant, STC solution (sucrose 200g/L, 1M Tris-HCL 50ml/L, calcium chloride 5.55g/L) suspended sediment, STC centrifuge washing 2 times, suspends, adjustment concentration to 10
7protoplastis/ml.
Get 100 μ l protoplast solution, add 20 μ g linearization plasmid mixing, ice bath 20min, adds 1.25ml PTC solution (PEG4000 400g/L, 1M Tris-Hcl 10ml/L, 2.5M calcium chloride 20ml/L), the static 20min of room temperature.Then proceed to 15ml centrifuge tube, and add 5mL TB3 nutrient solution (yeast leaching powder 3g/L, acid hydrolysis casein 3g/L, sucrose 200g/L) and ammonia benzyl microbiotic (final concentration 100 μ g/mL), 28 DEG C, 100r/min shaking table shaking culture 16h.The centrifugal 10min of nutrient solution 5000r/min, 200 μ l STC suspend and precipitate, with 10mL containing the TB3 nutrient solution of low melting-point agarose, and Totomycin (final concentration 300 μ g/mL) and ammonia benzyl microbiotic (final concentration 100 μ g/mL) mix a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices, 28 DEG C of overnight incubation.Media surface bedding 10mL contains the TB3 substratum of low melting-point agarose and Totomycin (final concentration 300 μ g/mL).28 DEG C of incubator lucifuges cultivate 5d, are transferred to by transformant on the PDA substratum containing Totomycin (final concentration 300 μ g/mL), continuously 3 generations of switching, obtain the transformant of genetic stability.
Extract transformant RNA, reverse transcription obtains cDNA, take cDNA as template, with hphF and hphR for primer carries out pcr amplification, and hphF:(5 '-3 ') ATGCCTGAACTCACCGCGACGTCTG, hphR:CTATTCCTTTGCCCTCGGACGAGTG.PCR condition is: 95 DEG C of denaturation 5min; Then 95 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 1min, totally 30 circulations; 10min is kept at last 72 DEG C.Agarose gel electrophoresis detects, and obtains positive transformant.
Embodiment 3
The mensuration of engineering strain Cr-per44 perilipin gene expression amount
Real-time quantifying PCR method measures perilipin expression amount in engineering strain Cr-per44, using elongation factor (Elongation factors) as reference gene.Use Primer5 software design extension Summing Factor Per3 Auele Specific Primer respectively.EFF：TCGATGTCGCTCCTGACT，EFR：AGCGTGACCGTTTATTTGA，Per3F：GAAACTTCTCTTTCGTCTCTATCGA，Per3R：CTTGCAAGCACAGAAAGAAAATCAA。By cDNA diluted sample 10 times, SYBR Green method carries out fluorescent quantitative measurement.Reaction system is: SYBR Premix 12.5 μ l, cDNA template 2 μ l, each 1 μ l of upstream and downstream primer, and ddH
2o 8.5 μ l.Reaction conditions is: 95 DEG C of sex change 2min, by following reaction 40 circulation: 95 DEG C sex change 10s and 60 DEG C annealing 30s.The calculating of relative expression quantity adopts 2
-Δ Δ Ctmethod.Result shows, engineering strain Cr-per44 perilipin gene expression amount improves 3 times than wild strain HLD-1.
Embodiment 4
Engineering strain Cr-per44 measures the parasitics of soybean sclerotinite sclerotium
Cut bacterium block from the sclerotinite PDA flat board of growth 10d, be transferred in Radix Dauci Sativae substratum, 10 pieces every bottle.Cultivate 3 weeks, after growing black particle shape sclerotium, be placed on 10 eye mesh screens, repeatedly rinse with distilled water for 26 DEG C, remove substratum and mycelia.By the sclerotium surface sterilization, air-dry of collecting, shady and cool dry place preserves.
Engineering strain Cr-per44 and HLD-1 wild strain are inoculated in PDA flat board, cultivate 10d at 26 DEG C, add 5ml sterilized water, with spatula scraping spore gently, sterilizing coarse filter paper filters, and prepares spore suspension.Blood counting chamber counts, and adds water and regulates spore concentration to be 1 × 10
7/ ml is consistent.By sclerotium respectively with 75% ethanol and the sterilization of 2.5%NaClO solution surface, sterilized water rinses repeatedly, and sterilizing filter paper dries in the air 10min.Get that 30 neat and sclerotium of the same size is positioned in different spore liquid, soak 10min, sterilizing filter paper sucks excessive moisture, is placed in sterilizing and wets on filter paper, and 26 DEG C of moisturizings are cultivated.8h starts to detect, and dissects Microscopic observation sclerotium by the situation of parasitism, record parasitic rate.1 time is measured to 24h every 2h.Repeat for 3 times.Statistics shows, the parasitic rate of Cr-per44 bacterial strain to sclerotinite is significantly higher than HLD-1 bacterial strain, sees Fig. 2.During 10h, Cr-per44 bacterial strain starts parasitism, and 16h, 20h parasitic rate reaches 80.0% and 100% respectively, and the parasitic rate of wild strain 16h is 46.7%.
Embodiment 5
The test of engineering strain Cr-per44 greenhouse control graw mold of tomato
Naturally soil crosses 40 mesh sieves, mixes 1 times of vermiculite, loads seedling dish after mixing, sowing tomato.After 4 weeks by seedling replanting consistent for growing way in flowerpot, the strain of every basin 3.Treat that seedling grows to 3 ~ 4 compound leaf phases, leaf front, back side uniform application HLD-1 and Cr-per44 bacterial strain spore suspension, bacteria concentration is 5 × 10
6cFU/ml.After 2h, spray inoculation botrytis cinerea conidiospore suspension (concentration 5 × 10
6/ ml).Support is set up in test site, and plastic covering canopy film, to keep moisture.Control greenhouse temperature 25 DEG C in the daytime ~ 30 DEG C, night 15 DEG C.By 9 grades of grade scales investigation tomato leaf incidences after 7d, calculate disease index and prevention effect, with clear water and 98% derosal, 1000 times of diluents for contrast.Found that, engineering strain Cr-per44 reaches 80.7% to graw mold of tomato preventive effect, and wild strain and derosal process are respectively 63.9% and 62.1%.
Claims (8)
1. turn the mould engineering strain of pink helix poly spore of perilipin gene, called after Cr-per44, is characterized in that, is CGMCC No.10028 at the preservation registration number at Chinese microorganism strain management committee common micro-organisms center.
2. a construction process of engineering strain Cr-per44 according to claim 1, is characterized in that concrete steps are:
1) enzyme is cut pAN7-1 carrier and is obtained linearizing pAN7-1 carrier, linearizing pAN7-1 carrier and perilipin object segment composition is spliced, obtains conversion carrier;
2) cultivate the mould HLD-1 bacterial strain of pink helix poly spore, collect children mycelia in age, children mycelia in age and helicase are carried out mixed enzymolysis, filtration is also centrifugal, collects protoplast pellet, obtains protoplast solution with after STC solubilize;
3) conversion carrier is mixed with protoplast solution leave standstill, recovered by liquid nutrient medium TB3, shaking culture, centrifugal segregation supernatant liquor, after STC solution suspension precipitation, after mixing with TB3 substratum, a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices is cultivated, obtain the transformant of genetic stability, therefrom picking positive transformant.
3. construction process as claimed in claim 2, it is characterized in that the method for picking positive transformant is: the transformant RNA extracting genetic stability, reverse transcription obtains cDNA, adopts agarose gel electrophoresis to detect, picking positive transformant after pcr amplification.
4. engineering strain Cr-per44 as claimed in claim 1 is preparing the application in microbial bactericide.
5. a microbial inoculum, is characterized in that: the component of this microbial inoculum comprises engineering strain Cr-per44 according to claim 1.
6. the preparation method of a microbial inoculum as claimed in claim 5:
First recombinant bacterial strain Cr-per44 is cultivated on PDA flat board, cut bacterium block, then the bacterium block cut is placed in shaking culture on PD nutrient solution, in the most backward nutrient solution, adds suspension agent and spreader-sticker, obtain liquid bacterial agent.
7. the preparation method of microbial inoculum as claimed in claim 6, is characterized in that the condition of described shaking culture is: rotating speed 180r/min on shaking table, temperature 28 DEG C, incubation time 2 ~ 3d.
8. the application of the microbial inoculum as described in claim 5-7 in control farm crop sclerotium disease, gray mold, blight and root-rot.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510098635.4A CN104611243B (en) | 2015-03-06 | 2015-03-06 | A kind of pink mould engineered strain of helix poly spore for turning perilipin gene and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510098635.4A CN104611243B (en) | 2015-03-06 | 2015-03-06 | A kind of pink mould engineered strain of helix poly spore for turning perilipin gene and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104611243A true CN104611243A (en) | 2015-05-13 |
| CN104611243B CN104611243B (en) | 2017-07-18 |
Family
ID=53145896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510098635.4A Active CN104611243B (en) | 2015-03-06 | 2015-03-06 | A kind of pink mould engineered strain of helix poly spore for turning perilipin gene and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104611243B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110558336A (en) * | 2019-07-19 | 2019-12-13 | 湖南科技学院 | Biocontrol agent for preventing and treating lettuce sclerotinia rot and preparation and using method thereof |
| CN116590155A (en) * | 2023-05-18 | 2023-08-15 | 兰州大学 | Paenispira rosea strain, microbial agent, preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1621511A (en) * | 2003-11-26 | 2005-06-01 | 中国农业科学院生物防治研究所 | Microbe (HLD-1) and its preparing method |
| CN103484421A (en) * | 2013-04-03 | 2014-01-01 | 中国农业科学院植物保护研究所 | Pilot scale production method for gliocladium roseum chlamydospore by liquid fermentation |
-
2015
- 2015-03-06 CN CN201510098635.4A patent/CN104611243B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1621511A (en) * | 2003-11-26 | 2005-06-01 | 中国农业科学院生物防治研究所 | Microbe (HLD-1) and its preparing method |
| CN103484421A (en) * | 2013-04-03 | 2014-01-01 | 中国农业科学院植物保护研究所 | Pilot scale production method for gliocladium roseum chlamydospore by liquid fermentation |
Non-Patent Citations (2)
| Title |
|---|
| SUN,Z.B.等: "Clonostachy rosea f. catenulate strain HL-1-1 perilipin-like protein (per3) gene, complete cds", 《GENBANK DATABASE》 * |
| 姜杰等: "粉红粘帚霉67-1转几丁质酶基因转化子生物学特性及高效工程菌株的筛选", 《广东农业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110558336A (en) * | 2019-07-19 | 2019-12-13 | 湖南科技学院 | Biocontrol agent for preventing and treating lettuce sclerotinia rot and preparation and using method thereof |
| CN116590155A (en) * | 2023-05-18 | 2023-08-15 | 兰州大学 | Paenispira rosea strain, microbial agent, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104611243B (en) | 2017-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103270887B (en) | Silkworm chrysalis northern Chinese caterpillar Fungus industrial cultivation technique | |
| CN110200018B (en) | Optimal DSE inoculation amount for promoting plant rooting | |
| CN106834130A (en) | One plant of Strain of Beauveria bassiana and its application to grub larva highly pathogenicity | |
| CN112592835A (en) | Tremella aurantialba strain suitable for industrial cultivation | |
| CN110408607A (en) | A kind of lactobacillus plantarum production hyaluronidase fermentation optimization technique | |
| CN110343621A (en) | A kind of Trichoderma asperellum strain and its application | |
| CN107164297A (en) | A kind of method for promoting Antrodia camphorata mycelial growth and activated product to synthesize | |
| CN104611243A (en) | Engineering strain-clonostachys rosea for perilipin gene transfer and application of engineering strain | |
| CN104845892A (en) | R.vinctus and application thereof in promoting aquilaria plants to produce agilawood | |
| CN104472221B (en) | A kind of method by natural cordyceps fructification fermented hypha | |
| CN114381379A (en) | Mucuna strain TP-8 capable of improving sprouting capacity of dendrobium seedlings and application thereof | |
| CN103695458A (en) | Methods for efficient induction production of Glycyrrihiza uralensisi Fisch hairy roots and production of licorice root secondary metabolites by using Glycyrrihiza uralensisi Fisch hairy roots | |
| CN109392702A (en) | A kind of method of the normal wild rice stem of artificially breeding | |
| CN102168017A (en) | Huperzine A high-producing strain and method for producing huperzine A by fermenting same | |
| CN1095103A (en) | Producing process of Chinese caterpillar fungus hypha fermentation | |
| CN106010987B (en) | A kind of muscardine bacterial strain and its application to prominent back sugarcane rhinoceros cockchafer with pathogenicity | |
| CN117417840A (en) | Exotomycorrhizal fungi Yunnan sclerotium lappa ZSS01 and application thereof | |
| CN108841748A (en) | Sinorhizobium nitrogen-fixing bacteria strain H6 and its application | |
| CN112812976A (en) | Metarhizium laevigatum CDTLJ1 and application thereof | |
| CN104988080B (en) | A kind of mould engineered strain of pink helix poly spore turning chitinase gene and its application | |
| CN117187076A (en) | Paecilomyces hepialid mutagenesis strain with high adenosine yield and preparation method and application thereof | |
| CN109370922A (en) | A pair of wild rice smut for successfully realizing the normal hay artificially breeding of wild rice stem and its application | |
| CN113025505B (en) | Metarhizium lepigone and biological control method and application thereof in pupal stage of Spodoptera frugiperda | |
| CN109593769A (en) | Wild rice brand spores form related gene Itd1 and its application | |
| CN103650910A (en) | Cordyceps sinensis fruiting body and cultivating method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |