CN104611243B - A kind of pink mould engineered strain of helix poly spore for turning perilipin gene and its application - Google Patents

Abstract

The invention discloses an engineering strain of Clonosporium pinkhelix translipid droplet coating protein gene and its application. The engineering strain is named Cr-per44, and the preservation registration number in the General Microbiology Center of China Microbiological Strain Management Committee is CGMCC No.10028, the engineering strain is obtained by protoplast transformation, and the parasitic related gene-lipid droplet coating protein gene Per3 is transferred into Clonospora pinkhelix HLD-1 strain, and the engineering strain Cr-per44 of the present invention has strong disease resistance , Stable control effect, can effectively control crop sclerotinia and gray mold, and also has good control effect on various plant fungal diseases such as fusarium wilt and root rot.

Description

A polyspora pink helix engineering strain transfected with lipid droplet coat protein gene and its application

technical field

The invention belongs to the technical field of bioengineering and biological control, in particular to an engineering bacterial strain of Clonosporium pinkhelix translipid droplet coating protein gene.

Background technique

Clonostachys rosea, formerly known as: Gliocladium roseum, is an important type of fungal parasite, which can infect Sclerotinia, Botrytis cinerea, Fusarium and Rhizoctonia by winding, puncturing, etc. A variety of plant pathogenic fungi can also produce antibacterial substances to inhibit the growth of pathogenic bacteria, promote plant growth, and induce plant resistance, so they have great biocontrol potential. However, the lack of highly pathogenic strains in the prior art and the lack of large-scale cultivation technology of excellent strains are the key factors restricting its wide application in the field of plant disease control.

The prior art shows that lipases play an important role in plant disease resistance, among which lipid droplet coating protein is a kind of phosphoprotein that regulates fat metabolism, and its regulation is a kind of bidirectional regulation of metabolism. Protein eggs are anchored on the surface of lipid droplets as a physiological barrier to prevent hydrolysis by lipase in the cytoplasm; under the special circumstances of lack of energy, stimulated by lipolysis, lipid droplets break and form many small lipid droplets, the total surface area increases, but The number of lipid droplet coating protein did not increase significantly, so the protective effect of lipid droplet coating protein was relatively weakened, which made the lipid droplet decompose. In the study of the infection of locusts by Metarhizium anisopliae, the lipid droplet coating protein affects the turgor pressure of appressoria by regulating lipid droplet metabolism. Decomposition eventually leads to the decrease of appressorium turgor and distortion of appressoria in mutant strains, thus reducing the ability to penetrate the locust epidermis.

Clonospora pink helix strain HLD-1 is a high-efficiency bacterial parasite, the preservation number of China Microorganism Culture Collection Center is CGMCC No.1037, the parasitic rate of sclerotia can reach 100%, and it is effective against Botrytis cinerea, Likusi Pathogenic fungi such as Sclerotinia and Fusarium also exhibit strong parasitic and obvious inhibitory effects, but there is a problem of unstable control effect. It is of great significance to further improve the disease resistance of the biocontrol strains through genetic improvement.

Contents of the invention

The purpose of the present invention is to provide a translipid droplet coating protein gene Clonospora pink helix engineering strain and its application, to solve the lack of highly pathogenic strains in the prior art and the existing unstable control effect of Clonospora pink helix question.

An engineering strain of Clonosporium pinkhelix with translipid droplet coat protein gene, named Cr-per44, and the preservation registration number is CGMCC No.10028 in the General Microbiology Center of China Microbiological Culture Management Committee, Beichenxi, Chaoyang District, Beijing Road No. 1 Courtyard No. 3.

The culture characteristics of the above-mentioned engineering strain Cr-per44 are: it grows faster on the PDA medium, and the diameter of the colony can reach 8-9 cm after 10 days of culture at 26 ° C, as shown in Figure 1 . The colony is felt-like, initially white, and gradually turns gray-green after sporulation. The suitable temperature for growth and sporulation is 25-28°C, the optimum pH value is 6-7, and it is more sensitive to light. Microscopic examination morphology is: hyphae are colorless and separated, conidiophores are upright and can produce 2-3 levels of broom-like branches, and a large number of conidia are produced at the top of bottle stems, which aggregate into spherical shapes. Spores are oval or cylindrical, 3-5 μm in diameter.

The construction method of above-mentioned engineering bacterial strain Cr-per44 is:

1) Enzyme digestion of the pAN7-1 vector to obtain a linearized pAN7-1 vector, fusion and splicing of the linearized pAN7-1 vector and the lipid droplet coating protein target fragment to obtain a transformation vector;

2) Cultivate Clonospora rosea HLD-1 strain, screen and collect young mycelium, mix enzymolysis with young mycelium and helicase, filter and centrifuge, collect protoplast precipitate, dissolve it with STC solution Obtain protoplast solution;

3) Mix the transformation vector with the protoplast solution and let it stand still, revive it through the liquid medium TB3, shake the culture, remove the supernatant by centrifugation, suspend and precipitate through the STC solution, mix it with the TB3 medium, and then pour it into culture to obtain a stable genetic transformants, from which positive transformants were picked.

The above method for picking positive transformants is as follows: extract stable genetic transformant RNA, reverse transcribe to obtain cDNA, detect by agarose gel electrophoresis after PCR amplification, and pick positive transformants.

Application of the above-mentioned engineering strain Cr-per44 in the preparation of microbial bactericides.

A bacterial agent containing the above-mentioned engineering strain Cr-per44.

The preparation method of the above-mentioned microbial agent containing engineering strain Cr-per44:

First, the recombinant strain Cr-per44 was cultured on a PDA plate, and the bacterial block was cut after 7-10 days, and then the cut bacterial block was placed on the PD culture medium for shaking culture, and finally a suspending agent and a spreading agent were added to the culture medium to obtain Liquid bacteria.

The shaking culture conditions in the above microbial preparation method are as follows: on a shaker, the rotation speed is 180r/min, the temperature is 28°C, and the culture time is 2-3 days.

The application of the above bacterial agent in the prevention and treatment of crop sclerotinia, botrytis, fusarium wilt and root rot.

In this technology, through protoplast transformation, the parasitic-related gene-lipid droplet coating protein gene Per3 is transferred into Clonospora pinkhelix HLD-1 strain, and the Clonosporium pinkhelix engineering strain with translipid droplet coating protein gene is obtained. The recombinant strain Cr-per44 has strong disease resistance and stable control effect, can effectively prevent and control crop sclerotinia and gray mold, and also has good control effect on various plant fungal diseases such as fusarium wilt and root rot.

Description of drawings

Fig. 1 The colony morphology of Cr-per44 strain cultured on PDA medium for 10 days.

Fig. 2 Infection of Sclerotinia sclerotia by HLD-1 strain and Cr-per44 strain (5d).

detailed description

The following examples further supplement the technical solutions of the present invention, but do not limit the present invention.

The full-length lipid droplet coat protein gene is 1284bp, including an open reading frame of 555bp, GenBank accession number KF269990.

Example 1

Construction of lipid droplet-coated protein transformation vector

Using 3′-Full RACE Core Set Ver.2.0 and 5′-Full RACE Kit kits, respectively, the cDNA sequence fragment of the lipid droplet coating protein gene was amplified by 3′RACE and 5′RACE, and the two amplified products were cloned To the pMD19-T vector, sequencing, splicing, obtaining the full-length Per3 cDNA, and performing PCR verification; using specific primers Per3F: 5′-3′GAAACTTCTCTTTCGTCTCTATCGA and Per3R: CTTGCAAGCACAGAAAGAAAATCAA to amplify to obtain the full-length Per3 gene, GenBank accession number KF269990;

The transformation vector is pAN7-1 eukaryotic expression vector (provided by the Chinese Academy of Sciences Microbiology), which contains eukaryotic promoter gene gpda, hygromycin resistance marker gene hph and terminator gene trpC.采用PCR扩增启动子、终止子和脂滴包被蛋白基因片段，引物分别为：(5′-3′)gpdaF：ACTCGACCTGCAGGCATGCAAGCTTGAATTCCCTTGTATCTCTACACA，gpdaR：ACCAATCCAAAAGCCTACTCTGAAGGGAAAAGAAAGAGAAAAGAAAAG，trpCF：TGTGATTATGAGCAAATATGGGGTGGATCCACTTAACGTTACTGAAA，trpCR：GTAAACGACGGCCAGTGCCAAGCTTTCGAGTGGAGATGTGGAGTGG，Per3F：GAAACTTCTCTTTCGTCTCTATCGA，Per3R : (CTTGCAAGCACAGAAAGAAAATCAA. The reaction system is 50 μl, including 1 μl template, 1 μl upstream and downstream primers, 0.5 μl high-fidelity PCR polymerase (TransStart FastPfu Fly DNAploymerase), 10 μl Buffer, 5 μl dNTPs and 31.5 μl ddH ₂ O. PCR process: 95°C Pre-denature for 5 minutes, and perform 35 cycles according to the following steps: denature at 95°C for 30s, anneal at 55°C for 30s, and extend at 72°C for 1min. Finally, keep at 72°C for 10min to end the amplification reaction. After agarose gel electrophoresis, the fragments were washed with agarose Glycan Gel Recovery Kit for gel recovery.

The vector pAN7-1 was digested with HindIII. The digestion system is: plasmid 30 μl, HindIII 1 μl, Buffer 4 μl and ddH ₂ O 5 μl. The reaction conditions are 37° C., 1 h. After digestion, the product was purified using a PCR purification kit to obtain a linear pAN7-1 vector.

The concentrations of the recovered promoter fragments, lipid droplet coating protein fragments, terminator fragments, and linear pAN7-1 fragments were measured using a nucleic acid quantifier, and the concentrations were adjusted to an optimal molar ratio of 1:2 between the vector and each insert fragment. Put the 4 fragments in 10 μl fusion reaction system for fusion, the system includes proportional addition of linear vector and each insert fragment, 5 μl of 2× fusion Mix, and ddH ₂ O to make up. Gently mix, react at 50°C for 15min, place on ice for a few seconds, transfer the recombinant vector into E. 5g/L, sodium chloride 10g/L) and cultivated overnight. Select positive clones for PCR identification and recombinant plasmid digestion identification, and send the PCR products to Shanghai Sangon Bioengineering Co., Ltd. for sequencing to ensure the correctness of the fragment insertion. The recombinant plasmid was named: pAN7-1-per3.

Example 2

Transformation of recombinant vector pAN7-1-per3

Clonospora rosea HLD-1 was inoculated on PDA medium and cultured for 10 days, 5 ml of sterile water was added to elute the spores, 1 ml was drawn and inoculated into PD culture medium, and cultured at 26°C for 12 hours with shaking at 160 r/min. The hyphae were collected with a sterilized 500-mesh sieve, the nutrients were washed out with sterile water, and then rinsed with 0.7M NaCl osmotic pressure stabilizer to make it equilibrated. Pick a small amount of mycelium, put it into a solution containing 40mg/ml helicase, vortex it to disperse it, enzymolyze it at 100r/min at 28°C for 3 hours, add an equal volume of osmotic pressure stabilizer to dilute to avoid excessive enzymolysis. 500-mesh sieve to remove cell debris, transfer the filtrate to a 50ml centrifuge tube, centrifuge at 4000r/min for 10min, discard the supernatant, STC solution (sucrose 200g/L, 1M Tris-HCL 50ml/L, calcium chloride 5.55g/L ) to suspend the precipitate, wash twice by STC centrifugation, suspend, and adjust the concentration to 10 ⁷ protoplasts/ml.

Take 100 μl of protoplast solution, add 20 μg of linearized plasmid and mix, ice bath for 20 minutes, add 1.25ml of PTC solution (PEG4000 400g/L, 1M Tris-Hcl 10ml/L, 2.5M calcium chloride 20ml/L), and let stand at room temperature for 20 minutes. Then transfer to a 15ml centrifuge tube, and add 5mL TB3 culture solution (yeast extract powder 3g/L, acid hydrolyzed casein 3g/L, sucrose 200g/L) and ampicillin antibiotic (final concentration 100μg/mL), 28 ℃, 100r/ Min shaker shaking culture 16h. Centrifuge the culture solution at 5000r/min for 10min, suspend the precipitate with 200μl STC, mix with 10mL TB3 culture solution containing low-melting point agarose, hygromycin (final concentration 300μg/mL) and ampicillin antibiotic (final concentration 100μg/mL) and pour the plate , cultivated overnight at 28°C. Cover the surface of the medium with 10 mL of TB3 medium containing low-melting point agarose and hygromycin (final concentration 300 μg/mL). Incubate in a 28°C incubator in the dark for 5 days, transfer the transformants to PDA medium containing hygromycin (final concentration 300 μg/mL), and transfer for 3 consecutive generations to obtain stable genetic transformants.

Transformant RNA was extracted, and cDNA was obtained by reverse transcription. PCR amplification was performed using cDNA as a template and hphF and hphR as primers, hphF: (5′-3′)ATGCCTGAACTCACCGCGACGTCTG, hphR: CTATTCCTTTGCCCTCGGACGAGTG. The PCR conditions were: pre-denaturation at 95°C for 5 min; then denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, a total of 30 cycles; finally, hold at 72°C for 10 min. Agarose gel electrophoresis was performed to obtain positive transformants.

Example 3

Determination of Gene Expression of Lipid Droplet Coating Protein in Engineering Strain Cr-per44

Real-time quantitative PCR method was used to measure the expression of lipid droplet coating protein in engineering strain Cr-per44, and elongation factors (Elongation factors) were used as internal reference genes. The elongation factor and Per3-specific primers were designed using Primer5 software, respectively. EFF: TCGATGTCGCTCCTGACT, EFR: AGCGTGACCGTTTATTTGA, Per3F: GAAACTTCTCTTTCGTCTCTATCGA, Per3R: CTTGCAAGCACAGAAAGAAAATCAA. The cDNA samples were diluted 10 times, and the SYBR Green method was used for fluorescence quantitative determination. The reaction system is: SYBR Premix 12.5 μl, cDNA template 2 μl, upstream and downstream primers 1 μl, and ddH ₂ O 8.5 μl. The reaction conditions were: denaturation at 95°C for 2 min, followed by 40 cycles of the following reactions: denaturation at 95°C for 10 s and annealing at 60°C for 30 s. The relative expression was calculated using the 2- ^ΔΔCt method. The results showed that the gene expression of the lipid droplet envelope protein in the engineering strain Cr-per44 was 3 times higher than that in the wild strain HLD-1.

Example 4

Determination of parasiticity of engineering strain Cr-per44 on Sclerotinia sojae

Bacterial blocks were cut from the 10d-grown S. sclerotiorum PDA plate and transferred to carrot medium, 10 blocks per bottle. Cultivate at 26°C for 3 weeks. After the growth of black granular sclerotia, place it on a 10-mesh sieve, wash it repeatedly with distilled water, and remove the culture medium and mycelium. The surface of the collected sclerotia was disinfected, air-dried, and stored in a cool and dry place.

The engineering strain Cr-per44 and HLD-1 wild strain were inoculated on a PDA plate, cultured at 26°C for 10 days, added 5ml of sterile water, gently scraped the spores with a spatula, filtered through sterilized coarse filter paper, and prepared a spore suspension. Count on a hemocytometer and add water to adjust the spore concentration to 1×10 ⁷ /ml. The sclerotia were sterilized with 75% ethanol and 2.5% NaClO solution respectively, rinsed repeatedly with sterile water, and aired on sterilized filter paper for 10 minutes. Take 30 sclerotias that are neat and of the same size and place them in different spore liquids, soak them for 10 minutes, absorb excess water with sterilized filter paper, place them on sterilized wet filter paper, and culture at 26°C with moisture. Start detection at 8 hours, observe the parasitization of sclerotia under the dissecting microscope, and record the parasitism rate. Measured every 2h to 24h. 3 repetitions. Statistics show that the parasitic rate of the Cr-per44 strain to S. sclerotiorum was significantly higher than that of the HLD-1 strain, as shown in Figure 2. The Cr-per44 strain began to parasitize at 10h, and the parasitic rate reached 80.0% and 100% at 16h and 20h, respectively, while the wild The parasitic rate of strain 16h was 46.7%.

Example 5

Experiment on Controlling Botrytis Botrytis of Tomato with Engineering Strain Cr-per44 in Greenhouse

Pass the natural soil through a 40-mesh sieve, mix with 1 times the vermiculite, put it into a seedling tray after mixing, and sow tomatoes. After 4 weeks, the seedlings with consistent growth were transplanted into flowerpots, 3 plants per pot. When the seedlings reach the stage of 3-4 compound leaves, spore suspensions of HLD-1 and Cr-per44 strains are evenly applied to the front and back of the leaves, with a bacterial concentration of 5×10 ⁶ CFU/ml. After 2 hours, spray inoculate the conidia suspension of Botrytis cinerea (concentration: 5×10 ⁶ /ml). The test area was set up with supports and covered with plastic shed film to keep moisture. Control the greenhouse temperature at 25°C to 30°C during the day and 15°C at night. After 7 days, the tomato leaf disease was investigated according to the 9-level grading standard, and the disease index and control effect were calculated. Clear water and 1000-fold dilution of 98% carbendazim were used as controls. The results showed that the control effect of engineering strain Cr-per44 on tomato gray mold reached 80.7%, and that of wild strain and carbendazim were 63.9% and 62.1%, respectively.

Claims (6)

1. A Clonosporium pinkhelix engineering strain of translipid droplet coat protein gene named as Cr-per44, characterized in that, the preservation registration number in the General Microorganism Center of China Microbiological Culture Management Committee is CGMCC No.10028. 2. the application of engineering strain Cr-per44 as claimed in claim 1 in the preparation of microbial bactericide. 3. A bacterial agent, characterized in that: the components of the bacterial agent include the engineering strain Cr-per44 according to claim 1. 4. a preparation method of bacterial agent as claimed in claim 3: First, the recombinant strain Cr-per44 was cultured on a PDA plate, and the bacterial block was cut out, then placed on the PD culture medium for shaking culture, and finally a suspending agent and a spreading agent were added to the culture liquid to obtain a liquid bacterial agent. 5. The preparation method of the bacterial agent according to claim 4, characterized in that the shaking culture conditions are as follows: the rotating speed of the shaker is 180r/min, the temperature is 28°C, and the culture time is 2-3 days. 6. the application of bacterial agent as claimed in claim 3 in the prevention and treatment of crop sclerotinia, botrytis cinerea, fusarium wilt and root rot.