CN104587458A - Divalent DNA vaccine for preventing giardiasis and enteric-coated preparation thereof - Google Patents

Abstract

The invention discloses a divalent DNA vaccine for preventing human or animal giardiasis. The preparation method comprises the following steps: respectively inserting two antigen genes alpha1-giardin and CWP-2 of giardia into a eukaryotic vector pVAX1, thereby obtaining recombinant plasmids pVAX1-alpha1-giardin and pVAX1-CWP-2; and respectively transferring the recombinant plasmids pVAX1-alpha1-giardin and pVAX1-CWP-2 into host bacteria, thereby obtaining recombinant bacteria comprising the recombinant plasmids pVAX1-alpha1-giardin and pVAX1-CWP-2 respectively, wherein the recombinant bacteria form the divalent DNA vaccine disclosed by the invention. The anti-giardiasis divalent DNA vaccine in combined application aiming at two stages of trophozoite and cyst respectively is creatively provided, the formation of the trophozoite is inhibited to block the diseases and inhibit formation of the cyst so as to cut off propagation, and the defect that the vaccine is single in effect in the previous vaccine research and development is overcome. According to the divalent DNA vaccine, passage stability and continuous protectiveness are realized. The invention also discloses a quantitative enteric-coated preparation comprising the divalent DNA vaccine and a preparation method of the enteric-coated preparation.

Description

The Bivalent DNA Vaccine of prevention giardiasis and enteric coated preparation thereof

Technical field

The present invention relates to vaccines arts, be specifically related to the Bivalent DNA Vaccine and the enteric coated preparation thereof that prevent humans and animals giardiasis.

Background technology

Giardia lamblia (Giardia lamblia is called for short giardia lamblia) is human body pathogenic protozoan, can cause diarrhoea, the bad syndrome of alimentation and children growth obstacle.There are about 500,000 new infeetioa cases in the whole world, in HIV sufferers, infection rate high (nearly 20%-50%), is classified as one of ten kinds of main parasitic parasitosis of whole world harm humans health by World Health Organization (WHO) every year.In addition, giardia lamblia can infect 40 many animals, is typical zoonosis, is one of important parasite of harm China animal husbandry development.

The life cycle of giardia lamblia comprises trophozoite (trophozoite) and two stages of development of encapsulation (cyst), and goes out capsule and encystation two processes.Trophozoite is nutrition and the idiophase (or pathogenic phase) of polypide, when people and some mammal eat encapsulation, it goes out capsule at little enteral and forms trophozoite and parasitize this, causing suffering from diarrhoea with dyspepsia is main lambliasis (Giardiasis is called for short giardiasis).Encapsulation is resting stage (or infection period), secrete cyst wall material by trophozoite at colonic to be formed (encystation), excrete with host's feces afterwards, the host that peroral infection is new, on average every 10 encapsulations just can cause host infection, form trophozoite and cause a disease at the little enteral skin lesion of the scrotum of host.

At present, the choice drug of clinical treatment giardiasis is metronidazole (metronidazole).Though this medicine has good curative effect, also have significant untoward reaction, modal is gastrointestinal reaction, and severe patient can occur massive hemorrhage of gastrointestinal tract; Also can there is neurological symptom in some patients, blood system reacts, even myocarditis.In addition, because it is to the teratogenesis of fetus, and avoided by anemia of pregnant woman.Above-mentioned untoward reaction significantly limit the application of metronidazole in primary disease treatment.In addition, Albendazole is many, and in chronic, patient's course of disease is long, and this survival dose is large, and the course for the treatment of is long.In long-term drug therapy process, form the encapsulation with dissemination because of drug resistance as the cause a disease trophozoite in stage of this worm.The cyst wall of encapsulation is abundant has protective effect, and metronidazole molecule is difficult to penetrate cyst wall, loses the lethal effect to encapsulation, cannot block the propagation of giardiasis.

The research and development of anti-giardia lamblia vaccine control giardia lamblia to propagate and pathogenic important means.The research and development of current anti-giardia lamblia vaccine are still in the junior stage, and are the anti-giardia lamblia vaccine product of Unique Product using the crude protein extract of On The Trophozoite of Giardia Lamblia as immunogenic live vaccine.But this product can not control the discharge of animal encapsulation, thus route of transmission can not be cut off.

α-giardin is that the one group of glue being positioned On The Trophozoite of Giardia Lamblia serosa surface connects albumen (Annexin), to transform in the infection adhesion process of (going out capsule) and trophozoite play a significant role at giardia lamblia encapsulation to trophozoite.Wherein α 1-giardin is the minimum α-giardin of molecular weight, and the core texture only containing Annexin, has very strong immunogenicity, produces, be present in whole course of infection in initial infection, can as serodiagnostic markup molecule.In addition, α 1-giardin is relatively conservative between different giardia lamblia pathogenic strains, comprise sequence homology (amino acid identity is 97%) and structural homology, and its protective effect does not rely on the generation of antibody.The CWP-2 of giardia lamblia is the main component albumen of giardia lamblia encapsulation cyst wall, in On The Trophozoite of Giardia Lamblia saccilar process, is secreted produce and infiltrate cyst wall by trophozoite.

The present invention creatively proposes the bivalent vaccine respectively for trophozoite and encapsulation two stage use in conjunction, causes a disease and suppress the formation of encapsulation thus cut off to propagate to realize suppressing the formation of trophozoite thus to block.The present invention adopts α 1-giardin (α 1-merchant element) and CWP-2 (cyst wall protein-2, cyst wall albumen) infect respectively as On The Trophozoite of Giardia Lamblia anti-in bivalent vaccine and suppress the antigen of giardia lamblia encystation.

The pathogenic infection of many human or animals occurs in mucosa or is invaded by mucosa.Mucosal immune system is body anti-infective first immunologic barrier.All be covered with one deck mucosa at organ surfaces such as digestive tract, respiratory tract and reproductive system, by the environment of body and extraneous separation, effectively virulence factor and the material harmful to body can be blocked.In mucosa, immunocyte accounts for 80% of all immunocytes in body, in the immunoprotection of body, occupy very important status.For intestinal parasitic protozoas such as giardia lamblias, the main intestinal mucosa that stimulates produces secretory IgA (sIgA) antibody, greatly may be improved the effect of immunity inoculation by mucosal immune.Simultaneously with regard to the live vaccine that development blocks giardiasis propagation, the immunization route of feeding with bait or feedstuff, reaches the object controlling giardiasis by the infection effectively controlling ill domestic animal, and development oral vaccine is obviously a kind of simple and effective approach.At present, be by the ubiquitous problem of various live vaccines of bait or feedstuff feeding approach the amount being difficult to guarantee feeding animal.

The present invention utilizes the epitope of giardia lamblia α 1-giardin and CWP-2, builds bivalent vaccine, using Attenuated Salmonella SL7207 as transport vehicle, quantitatively prepares enteric coated preparation, makes animal obtain the anti-Albendazole of effective specificity and propagate immunity through intestinal.

Summary of the invention

The present invention is directed to the above-mentioned problems in the prior art, propose effective anti-giardia lamblia vaccine and should comprise two leading indicators, namely blocking causes a disease and cut off propagates.Accordingly, the present invention proposes to adopt the bivalent vaccine respectively for trophozoite and two kinds of Vaccine molecules use in conjunction in two stages of encapsulation, thus realizes suppressing the formation of trophozoite thus block causing a disease and suppress the formation of encapsulation thus cut off to propagate.

One object of the present invention is to provide a kind of for preventing the Bivalent DNA Vaccine of human or animal's giardiasis, and this vaccine can block to cause a disease and cut off simultaneously and propagate.

Another object of the present invention is to provide a kind of enteric coated preparation comprising described Bivalent DNA Vaccine.

Another object of the present invention is to provide a kind of enteric coated preparation comprising quantitative vaccine, to realize the oral quantitative immunological of bivalent vaccine enteric coated preparation.

In a first aspect of the present invention, the invention provides a kind of for preventing the Bivalent DNA Vaccine of human or animal's giardiasis, it is characterized in that, two of giardia lamblia kinds of antigen gene α 1-giardin and CWP-2 are inserted in eukaryotic vector pVAX1 respectively and obtains recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2, described recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 is transported the recombinant bacterium entering in Host Strains and comprised recombiant plasmid pVAX1-α 1-giardin and recombiant plasmid pVAX1-CWP-2 respectively respectively, described recombinant bacterium forms described Bivalent DNA Vaccine, wherein said antigen gene α 1-giardin is SEQ ID NO:1 sequence, described antigen gene CWP-2 is SEQ ID NO:3 sequence.

In a preferred embodiment, described Bivalent DNA Vaccine is prepared by following steps:

(1) using the cDNA of giardia lamblia as template, α 1-giardin and CWP-2 genetic fragment is obtained respectively by PCR amplification,

(2) by between HindIII and the BamHI site of described genetic fragment insertion vector pVAX1, pVAX1-α 1-giardin and pVAX1-CWP-2 recombiant plasmid is produced;

(3) recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 in step 2 is transported respectively enter in Host Strains, comprised the recombinant bacterium of recombiant plasmid pVAX1-α 1-giardin and recombiant plasmid pVAX1-CWP-2 respectively, namely described Bivalent DNA Vaccine is obtained after described recombinant bacterium equal proportion mixing

Wherein, the primer used in PCR amplification is as follows:

The primer of α 1-giardin:

α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)

α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)

The primer of CWP-2:

Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC(HindIII)

Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG(BamHI)。

In a preferred embodiment, described Host Strains is Attenuated Salmonella, i.e. Attenuated Salmonella SL7207.

In another aspect of this invention, the present invention also provides a kind of for preventing the enteric coated preparation of human or animal's giardiasis, and described enteric coated preparation comprises the Bivalent DNA Vaccine for preventing human or animal's giardiasis described in first aspect.

Preferably, described enteric coated preparation is quantitatively preparation, makes every part of enteric coated preparation comprise the recombinant bacterium of substantially mutually commensurability described Bivalent DNA Vaccine.

In a preferred embodiment, the method preparation of described enteric coated preparation by comprising the following steps:

1) amplification cultivation is carried out to the recombinant bacterium of described Bivalent DNA Vaccine and obtain culture;

2) by step 1) in the culture that obtains centrifugal after carry out lyophilizing and obtain lyophilized powder;

3) in step 2) be mixed into quantitative adjuvant in the lyophilized powder that obtains and grinding evenly obtains grounds travel;

4) step 3 is taken) grounds travel that obtains carries out quantitative tabletting, guarantees that every tablet preparation contains the recombinant bacterium of equal number;

5) by step 4) the tablet enteric coating agents that obtains carries out coating.

In a further preferred embodiment, the method preparation of described enteric coated preparation by comprising the following steps:

1) amplification cultivation: the recombinant bacterium of described Bivalent DNA Vaccine is carried out amplification cultivation obtain through amplification culture;

2) lyophilizing: by centrifugal for described culture, add freeze drying protectant in centrifugation, lyophilizing obtains lyophilized powder, described freeze drying protectant comprises 5% defatted milk powder and 2.5% sucrose;

3) grind: in lyophilized powder, be mixed into quantitative adjuvant, grind well and obtain grounds travel, described adjuvant is selected from microcrystalline Cellulose, starch, differential fall apart silica gel, carboxymethyl starch sodium and magnesium stearate;

4) tabletting: take quantitative grounds travel, carries out quantitative tabletting according to antibacterial recombinant bacterium viability examination result, guarantees that every sheet contains mutually commensurability 0.2 ~ 5 × 10 ⁵individual recombinant bacterium;

5) coating: take appropriate Opadry, adds under high-speed stirred in distilled water, makes the suspension that concentration is 20%, continue to stir 2h, obtain coating solution, seed-coating machine revolution is adjusted to 40-50r/min, add the tablet prepared, regulate spray gun liquid-gas ratio example, coating to tablet increases weight 6-8%;

6) pack.

Beneficial effect of the present invention:

1. in Albendazole and communication process, encystation and to go out capsule be two important links.The present invention creatively proposes to utilize in encystation and the specific antigen epi-position structure Bivalent DNA Vaccine going out the capsule stage, thus effectively can control the propagation of Albendazole and giardiasis, overcomes the shortcoming that in vaccine research and development in the past, vaccine effect is single.

2.CWP-2 is the important cyst wall albumen of giardia lamblia, essential in the process of giardia lamblia encystation, and research in the past shows that it has the effect reducing encystation rate.But because it has certain toxicity to Host Strains, be difficult to reach stability and go down to posterity.This research is by the analysis to CWP-2 epi-position; filter out the epitope that a section has 125 aminoacid sequences; experiment prove this epi-position not only there is good antigenicity, eliminate the damage to Host Strains simultaneously, achieve stability go down to posterity and protectiveness continue.

3. the present invention adopts the form of enteric coated preparation, realize quantitative immunological, the production technology of existing enteric bacterin preparation is improved simultaneously, eliminate the drying and other steps that may affect vaccine activity, the carrier bacterium live vaccine carrying Vaccine molecules is processed into enteric coated preparation, carries out quantitative immunological.There is administration quick, safe and effective, be easy to the advantages such as large-scale production, there is good application prospect.

Accompanying drawing explanation

Fig. 1 illustrates the stability experiment result of recombinant attenuated Salmonella (bivalent vaccine) of the present invention in vitro after Secondary Culture;

Fig. 2 illustrate recombinant attenuated Salmonella of the present invention in vitro after Secondary Culture through experimental result that fluorescence immunoassay detects;

After Fig. 3 illustrates recombinant attenuated Salmonella immune mouse of the present invention, the change that mice serum IgG antibody is tired;

After Fig. 4 illustrates recombinant attenuated Salmonella immune mouse of the present invention, total SIgA changes of contents in mouse intestinal flushing liquor;

Fig. 5 to illustrate after recombinant attenuated Salmonella immune mouse of the present invention 7 weeks, the content of anti alpha 1-giardin and CWP-2 specificity SIgA in mouse intestinal flushing liquor;

Fig. 6 illustrates the destination protein expression of results of recombinant attenuated Salmonella of the present invention at mice mesenteric lymph node.

Detailed description of the invention

Describe embodiments of the present invention in detail below with reference to drawings and Examples, to the present invention, how application technology means solve technical problem whereby, and the implementation procedure reaching technique effect can fully understand and implement according to this.

Embodiment 1

The structure of recombinant prokaryotic expression vector pET41a-α 1-giardin and pET41a-CWP-2 and qualification

(1) according to the gene sequencing of α 1-giardin in Genbank data base, design and synthesis Auele Specific Primer, and introduce Hind III and EcoR I restriction enzyme site at sequence two ends, all introduce protectiveness bases G C at restriction enzyme site two ends.

The primer of α 1-giardin:

α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)

α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)

(2) according to the gene order of Genbank data base giardia lamblia CWP2, the epitope coded by it is analyzed, filter out one section containing 125 amino acid whose epi-positions.Design Auele Specific Primer, introduces Hind III and EcoR I restriction enzyme site at sequence two ends simultaneously, all introduces protectiveness bases G C at restriction enzyme site two ends.

The primer of CWP-2:

Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC(HindIII)

Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG(BamHI)。

(3) using the cDNA of giardia lamblia as template, carry out RT-PCR amplification and obtain object fragment, be connected through the pET41a carrier segments of Hind III after EcoR I double digestion with same after enzyme action, construction recombination plasmid pET41a-α 1-giardin and pET41a-CWP-2, Transformed E .coli DH5a, picking positive colony.E.coli BL21 is proceeded to through the correct recon of order-checking qualification.

(4) experiment is expressed in a small amount: put into the LB culture fluid of 5ml containing kanamycin (30mg/ml) from picking list bacterium colony pET41a-α 1-giardin/BL21 and pET41a-CWP-2/BL21 antibiotic selection flat board respectively, in duplicate.37 DEG C, 200rpm, jolting overnight incubation; Next day, detect the spectrophotometric value (OD600) of culture, get appropriate bacterium liquid, the LB culture medium containing 30mg/ml kanamycin that inoculation 2ml is fresh, make OD value be 0.2, continue at 37 DEG C, 250rpm, quick jolting is cultured to OD600 ≈ 0.6.Adding IPTG to final concentration is 1mM, 37 DEG C, 200rpm, abduction delivering 4h.By the expression of SDS-PAGE electrophoresis detection destination protein, and carry out soluble analysis.

The aminoacid sequence of α 1-giardin is SEQ ID NO:2 sequence; The aminoacid sequence of CWP-2 is SEQ ID NO:4 sequence.

Embodiment 2

The great expression of recombinant alpha 1-giardin and CWP-2 in escherichia coli and purification, the preparation of specific antibody

(1) expression system is expanded: picking list bacterium colony puts into the LB culture fluid of 50ml containing kanamycin from the flat board of pET41a-α 1-giardin/BL21 and pET41a-CWP-2/BL21.37 DEG C, 200rpm, jolting overnight incubation; Next day, the bacterium liquid getting 25ml incubated overnight is respectively inoculated two and is equipped with in the 4L conical flask of 1L LB (containing kanamycin 30 μ g/ml).37 DEG C, 250rpm, quick jolting is cultured to OD600 ≈ 0.6.Adding IPTG to final concentration is 1mM, at 30 DEG C, and 250rpm, abduction delivering 5h; Collected by centrifugation bacterial sediment, ultrasonic degradation, collects supernatant (solubility expression), adopts His-tag affinity column to carry out destination protein purification.

(2) specific polyclonal antibody preparation: get 20 6 ~ 8 week age BALB/c female mice, use the antigen of 20 μ g/0.1ml (r α 1-giardin and rCWP-2) to add complete Freund's adjuvant (CFA) the back multiple spot subcutaneous injection of equivalent respectively.The full Freund adjuvant (IFA) that cannots be used up every other week mixes with recombiant protein, strengthens, strengthen twice altogether with same dosage.After final immunization 10 days, pluck eyeball and get blood, after the blood of collection is put and is solidified 2 ~ 3h in room temperature, 3000rpm, 4 DEG C are centrifugal 10 minutes; Get supernatant again, 3000rpm, 4 DEG C centrifugal 10 minutes.Collect serum and subpackage.– 80 DEG C preservation.

Embodiment 3

The structure of recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2

(1) according to the gene sequencing of α 1-giardin in Genbank data base, design and synthesis Auele Specific Primer, and introduce Hind III and EcoR I restriction enzyme site at sequence two ends, all introduce protectiveness bases G C at restriction enzyme site two ends.

The primer of α 1-giardin:

α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)

α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)

(2) according to the gene order of Genbank data base giardia lamblia CWP2, the epitope coded by it is analyzed, filter out one section containing 125 amino acid whose epi-positions.Design Auele Specific Primer, introduces Hind III and EcoR I restriction enzyme site at sequence two ends simultaneously, all introduces protectiveness bases G C at restriction enzyme site two ends.

The primer of CWP-2:

Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC(HindIII)

Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG(BamHI)。

(3) using the cDNA of giardia lamblia as template, carry out RT-PCR amplification and obtain object fragment, be connected through the pVAX1 carrier segments of Hind III after EcoR I double digestion with same after enzyme action, construction recombination plasmid pVAX1-α 1-giardin and pVAX1-CWP-2, Transformed E .coli DH5a, picking positive colony.Proceed to salmonella SL7207 through the correct recon of order-checking qualification in electroporated mode, build restructuring salmonella vaccine.

Embodiment 4

The stability of recombinant bacterial strain Secondary Culture in vitro

In order to detect recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 electricity proceed to attenuation salmonella SL7207 after the stable situation that goes down to posterity in antibacterial, respectively by the recombinant attenuated Salmonella of carrying recombiant plasmid containing kanamycin culture medium with do not cultivate 7 days containing in kanamycin culture medium, get equal-volume bacterium liquid bed board counting every 12 hours, carry out computational stability by counting colony counts in two kinds of culture medium.Namely use the colony counts grown in the culture medium containing kanamycin divided by not containing the colony counts grown in the culture medium of kanamycin, then be converted into percentage ratio.

Experimental result is shown in Fig. 1, display cultivation after 168 hours, have the plasmid of more than 90% still stable existence in recombinant attenuated Salmonella.

Collect the recombinant bacterial strain cultivated latter 7 days, PBS washs centrifugal rear smear, closes 30 minutes with 5% normal sheep serum, and drip 1:2000CWP-2 and α 1-giardin immunize rabbit serum respectively after PBS washing, 4 DEG C are spent the night; 1:200DyLight is dripped after PBS washing ^tMthe goat-anti rabbit fluorescence two of 488 labellings resists, and takes a picture at fluorescence microscopy Microscopic observation.Experimental result is shown in Fig. 2, has the expression of corresponding protein in display thalline.

Above experimental result shows, can carry out stable going down to posterity after recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 electricity proceed to attenuation salmonella SL7207 in host bacteria, and can stably express immunizing antigen α 1-giardin and CWP-2.

Embodiment 5

The immune effect of recombinant bacterial strain

After the 1:1 mixed vaccine immunity of Mouse oral Bivalent DNA Vaccine of the present invention and recombinant attenuated Salmonella somatic SL7207/pVAX1-α 1-giardin and SL7207/pVAX1-CWP-2, gather serum and the enteral irrigation liquid of mice, detect respectively serum antibody IgG tire and the total SIgA content of enteral irrigation liquid with the change of immunization time, and when immune mouse 7 weeks the content of anti alpha 1-giardin and CWP-2 specificity SIgA in mouse intestinal flushing liquor.

Experimental result is shown in Fig. 3, Fig. 4 and Fig. 5.Fig. 3 shows the matched group relative to PVAX1/SL7207 and PBS, and the serum antibody IgG of recombinant attenuated Salmonella immune mouse of the present invention tires and significantly to raise with immunization time and to tend towards stability after 7 weeks.Fig. 4 shows that in the enteral irrigation liquid of recombinant attenuated Salmonella immune mouse of the present invention, total SIgA content is significantly higher than the matched group of PVAX1/SL7207 and PBS, and reaches peak value at about 11 weeks.Fig. 5 show recombinant attenuated Salmonella immune mouse of the present invention 7 weeks time in enteral irrigation liquid the content of anti alpha 1-giardin and CWP-2 specificity SIgA be significantly higher than the matched group of PVAX1/SL7207 and PBS.The mice that above experimental result is unequivocally established through Bivalent DNA Vaccine immunity of the present invention creates significant associated antibodies in serum and intestinal, shows that Bivalent DNA Vaccine of the present invention has clear and definite and significant immune effect.

Embodiment 6

Field planting stability in the body of recombinant bacterial strain

The expression of results of restructuring salmonella SL7207/pVAX1-α 1-giardin and pVAX1-CWP-2 at mice mesenteric lymph node is detected by immunofluorescence test.

In oral recombinant attenuated Salmonella somatic SL7207/pVAX1-α 1-giardin and SL7207/pVAX1-CWP-2 immunity after 7 weeks, gather the mesentery tissue of mice, 10% formalin is fixed, paraffin embedding, and section, carries out Immunofluorescence test.

Primary antibodie: 1:2000CWP-2 and α 1-giardin immunize rabbit serum.

Two resist: HRP-goat-anti rabbit anteserum.

Experimental result is shown in Fig. 3, shows two kinds of destination protein α 1-giardin and CWP-2 and is expressed in mice mesenteric lymph node respectively.This experimental result shows that Bivalent DNA Vaccine of the present invention realizes stablizing field planting in Mice Body.

Embodiment 7

The preparation of Bivalent DNA Vaccine enteric coated preparation

1. amplification cultivation: recombinant attenuated Salmonella somatic SL7207/pVAX1-α 1-giardin and SL7207/pVAX1-CWP-2 that 1:1 of the present invention is mixed carry out amplification cultivation obtain through amplification culture;

2. lyophilizing: get 150ml culture centrifugal, in precipitation, add 5ml freeze drying protectant (5% defatted milk powder, 2.5% sucrose), lyophilizing 24h, obtains lyophilized powder;

3. grind: in lyophilized powder, be mixed into quantitative adjuvant (microcrystalline Cellulose, starch, differential silica gel, carboxymethyl starch sodium and magnesium stearate etc.), grind well and obtain grounds travel;

4. tabletting: take quantitative grounds travel, carries out antibacterial recombinant bacterium technology and viability examination, according to the quantitative tabletting of technical result (such as 1 × 10 ⁵individual antibacterial/sheet).

5. coating: take appropriate Opadry, adds under high-speed stirred in distilled water, makes the suspension that concentration is 20%, continue to stir 2h, obtain coating solution, seed-coating machine revolution is adjusted to 40-50r/min, add the tablet prepared, regulate spray gun liquid-gas ratio example, coating to tablet increases weight 6-8%;

6. entirely examine: randomly draw tablet and carry out disintegrate experiment and recombinant bacterium viability experiment, and storage temperature and the shelf-life experiment

7. aluminum-plastic packaged.

Embodiment 8

The potency test of Bivalent DNA Vaccine enteric coated preparation

1.1-2 monthly age experimental dog, 20, about body weight 1.5kg.Be divided into 4 groups at random, often organize 5.Tablet (the dosage: 1 × 10 of the enteric coated preparation that experimental group 0 day feeding embodiment 7 obtains ⁵individual antibacterial/sheet), the 2nd week and the 6th week same dosage are strengthened once.Matched group does not process.Latter 8 weeks of immunity, experimental group and the equal oral gavage 2 × 10 of matched group pup ⁵on The Trophozoite of Giardia Lamblia.

2. within after Albendazole the 3rd day, start to gather Experimental puppies fresh excreta every day some, after adding the dilution of certain water gaging, through 60 order screen filtration, filtrate is through the centrifugal 10min of 3000r/min, abandon supernatant, add saturated solution of zinc sulfate in precipitation to stir evenly, the centrifugal 10min of 2500r/min, get suspension to dilute with 4 times of water, the centrifugal 10min of 3000r/min, precipitation adds the above-mentioned centrifugal of tap water and repeatedly washes 2 times, to wash away zinc sulfate, the standardize solution that finally precipitation added water becomes 5mL, get 1, after dripping Lugol's iodine solution dyeing, add coverslip and put 400 times of light Microscopic observations, check with or without giardia lamblia encapsulation, adhere to 15 days continuously, to determine infection conditions.There is encapsulation discharge person on inspection, be considered as infecting.Result of the test is shown in table 1.

The potency test of table 1 Bivalent DNA Vaccine oral enteric preparation

As seen from Table 1, the immune effect of bivalent vaccine of the present invention is significantly better than being used alone monovalent vaccine, and Bivalent DNA Vaccine oral enteric preparation of the present invention has significant immune effect.

Embodiment 9

The safety testing of vaccine enteric coated preparation

Get BALB/c female mice 25 in 6 ~ 8 week age, random packet, gives the recombinant bacterium liquid of various dose, observes the untoward reaction of mice, and after 7 weeks, execution, evaluates mouse infection salmonella.Except 1 except initial infection death (etiology unknown is true), other all do not find salmonella pathogenic manifestation.Get the liver of all experimental mouse, spleen, mesentery equal samples carry out pathology detection, without Salmonella infection pathological change.

This result of the test shows that Bivalent DNA Vaccine enteric coated preparation of the present invention can not cause Salmonella infection to cause a disease, and animal experiment proves safe.

Practicality of the present invention:

1. the control of human body giardiasis: giardia lamblia is world wide distribution, is the topmost intestinal parasitic protozoa causing intestinal infection.Especially the patient of acquired immune deficiency syndrome (AIDS) or immunologic hypofunction, lethal can be caused to suffer from diarrhoea.The main polluted source of encapsulation of giardia lamblia, has very strong resistance, and conventional filtration or chloridized can not kill the encapsulation of giardia lamblia.Zoogenetic infection source is the major reason causing human disease.In addition, along with the development of tourist industry, the increase of movement of population, there is the trend obviously increased in Albendazole.Therefore, the research and development of effective anti-giardia lamblia vaccine, the control for human body giardiasis is most important.

2. the needs of animal husbandry development: giardia lamblia can infect 40 many animals are typical zoonosis, are also one of main parasitic parasitosis endangering our province animal husbandry development in recent years.The symptom such as can occur anorexia after zoogenetic infection giardia lamblia, suffer from diarrhoea and become thin, severe patient can cause death.Therefore, research and develop the live vaccine that can block giardiasis propagation and seem particularly urgent.With regard to the live vaccine that development blocks giardiasis propagation, developing the oral vaccine of feeding with bait or feedstuff, is obviously a kind of simple and effective approach.

In view of giardia lamblia is for the importance of human health and animal husbandry development, novel anti-succeeding in developing of giardia lamblia Bivalent DNA Vaccine oral enteric preparation of the present invention will welcome wide market.

Although the embodiment disclosed by the present invention is as above, the embodiment that described content just adopts for the ease of understanding the present invention, and be not used to limit the present invention.Technical staff in any the technical field of the invention; under the prerequisite not departing from the spirit and scope disclosed by the present invention; any amendment and change can be done what implement in form and in details; but scope of patent protection of the present invention, the scope that still must define with appending claims is as the criterion.

Claims (7)

1. one kind for preventing the Bivalent DNA Vaccine of human or animal's giardiasis, it is characterized in that, two of giardia lamblia kinds of antigen gene α 1-giardin and CWP-2 are inserted in eukaryotic vector pVAX1 respectively and obtains recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2, described recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 is transported the recombinant bacterium entering in Host Strains and comprised recombiant plasmid pVAX1-α 1-giardin and recombiant plasmid pVAX1-CWP-2 respectively respectively, described recombinant bacterium forms described Bivalent DNA Vaccine, wherein said antigen gene α 1-giardin is SEQ ID NO:1 sequence, described antigen gene CWP-2 is SEQ ID NO:3 sequence.

2. as claimed in claim 1 for preventing the Bivalent DNA Vaccine of human or animal's giardiasis, it is characterized in that, described Bivalent DNA Vaccine is prepared by following steps:

(1) using the cDNA of giardia lamblia as template, α 1-giardin and CWP-2 genetic fragment is obtained respectively by PCR amplification;

(2) by between HindIII and the BamHI site of described genetic fragment insertion vector pVAX1, pVAX1-α 1-giardin and pVAX1-CWP-2 recombiant plasmid is produced;

(3) recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 in step 2 is transported respectively enter in Host Strains, comprised the recombinant bacterium of recombiant plasmid pVAX1-α 1-giardin and recombiant plasmid pVAX1-CWP-2 respectively, after two kinds of recombinant bacterium equal proportion mixing, namely obtain described Bivalent DNA Vaccine.

Wherein, the primer used in PCR amplification is as follows:

The primer of α 1-giardin:

α 1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT, it is SEQ ID NO:5 sequence

α 1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC, it is SEQ ID NO:6 sequence

The primer of CWP-2:

Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC, it is SEQ ID NO:7 sequence

Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG, it is SEQ ID NO:8 sequence.

3. as claimed in claim 1 or 2 for preventing the bivalent vaccine of human or animal's giardiasis, it is characterized in that, described Host Strains is Attenuated Salmonella.

4. for preventing an enteric coated preparation for human or animal's giardiasis, it is characterized in that, described enteric coated preparation comprises as claimed in claim 1 for preventing the Bivalent DNA Vaccine of human or animal's giardiasis.

5. as claimed in claim 4 for preventing the enteric coated preparation of human or animal's giardiasis, it is characterized in that, described enteric coated preparation is quantitatively preparation, makes every part of enteric coated preparation comprise the recombinant bacterium of substantially mutually commensurability described Bivalent DNA Vaccine.

6. as claimed in claim 5 for preventing the enteric coated preparation of human or animal's giardiasis, it is characterized in that, the method preparation of described enteric coated preparation by comprising the following steps:

1) amplification cultivation is carried out to the recombinant bacterium of described Bivalent DNA Vaccine and obtain culture;

2) by step 1) in the culture that obtains centrifugal after carry out lyophilizing and obtain lyophilized powder;

3) in step 2) be mixed into quantitative adjuvant in the lyophilized powder that obtains and grinding evenly obtains grounds travel;

4) step 3 is taken) grounds travel that obtains carries out quantitative tabletting, guarantees that every tablet preparation contains substantially mutually commensurability recombinant bacterium;

5) by step 4) the tablet enteric coating agents that obtains carries out coating.

7. as claimed in claim 6 for preventing the enteric coated preparation of human or animal's giardiasis, it is characterized in that, the method preparation of described enteric coated preparation by comprising the following steps:

1) amplification cultivation: the recombinant bacterium of described Bivalent DNA Vaccine is carried out amplification cultivation obtain through amplification culture;

2) lyophilizing: by centrifugal for described culture, add freeze drying protectant in centrifugation, lyophilizing 24h, obtains lyophilized powder, described freeze drying protectant comprises 5% defatted milk powder and 2.5% sucrose;

3) grind: in described lyophilized powder, be mixed into quantitative adjuvant, grind well and obtain grounds travel, described adjuvant is selected from microcrystalline Cellulose, starch, differential fall apart silica gel, carboxymethyl starch sodium and magnesium stearate;

4) tabletting: take quantitative grounds travel, carries out quantitative tabletting according to antibacterial recombinant bacterium viability examination result, guarantees that every sheet contains 0.2 ~ 5 × 10 ⁵individual recombinant bacterium;

5) coating: take appropriate Opadry, adds under high-speed stirred in distilled water, makes the suspension that concentration is 20%, continue to stir 2h, obtain coating solution, seed-coating machine revolution is adjusted to 40-50r/min, add the tablet prepared, regulate spray gun liquid-gas ratio example, coating to tablet increases weight 6-8%;

6) pack.