CN105671003A - Infectious bronchitis low-virulent live vaccine YX10 D90 strain - Google Patents

Abstract

The invention belongs to the field of the biotechnology and discloses an infectious bronchitis low-virulent live vaccine YX10 D90 strain. The infectious bronchitis low-virulent live vaccine YX10 D90 strain is preserved in China Center for Type Culture Collection on 14th March, 2016, the preservation number is CCTCC NO:V201610, and the preservation address is Wuhan University, Wuhan, China. The low-virulent strain is safe for all chickens and has no side reaction, the low-virulent strain is prepared into a vaccine safely and effectively, toxin attacking on homological strong toxicity can be protected, and practical and wide application value is achieved.

Description

A kind of chicken infectious bronchitis attenuated live vaccine YX10 D90 strain

technical field

The invention relates to the field of biotechnology, and more specifically relates to a YX10D90 strain of chicken infectious bronchitis attenuated live vaccine.

Background technique

Infectious bronchitis (IB) is an acute, highly contagious respiratory disease of chickens caused by avian infectious bronchitis virus (IBV). The main features are respiratory symptoms in sick chickens, enlarged and pale kidneys, a large amount of urate deposits, and even the appearance of "mottled kidneys"; the egg production and egg quality of laying hens are reduced, and infection of young hens can cause permanent fallopian tubes degenerates, leading to the production of "false hens". In addition, some IBV strains can also cause lesions in the intestinal tract, glandular stomach, and muscles. IBV can infect chickens of all ages and most types, especially chicks aged 1 to 5 weeks are very susceptible, which can easily lead to growth retardation, weight gain, reduced feed remuneration, and even death of chicks; and it is easy to cause mycoplasma to mix Infection and secondary infection such as Escherichia coli lead to increased mortality of chicken flocks and bring huge economic losses to the global poultry industry. IB is one of the major infectious diseases that seriously affect the world's poultry industry.

IBV belongs to Nidovirales, Coronaviridae, and Coronavirus, and is the representative strain of the third group of avian coronaviruses. IBV is an enveloped, nonsegmented, single-stranded positive-sense RNA virus. The most prominent feature of IBV is that there are many serotypes, and different serotypes have no or only low cross-immunogenicity with each other. At present, it has been reported that there are at least more than 30 serotypes or genotypes of IBV, and new serotypes, genotypes and variants are still emerging. Diagnosis and prevention have brought great difficulties.

Vaccines play a very important role in the prevention of IBV. At present, the vaccines used in my country mainly include inactivated vaccines and attenuated vaccines. Inactivated vaccines are mainly used before breeders and laying hens start production. However, there are still many problems such as the large amount of inactivated vaccine used, the need to cooperate with adjuvants, the preparation is complicated, and the cost is high. In addition, the inactivated vaccine cannot induce mucosal immunity and cellular immunity, so it cannot provide effective protection for the trachea. The attenuated live vaccine is prepared by weakening the domesticated virus strain through continuous passage of chicken embryos. The attenuated vaccine can effectively stimulate the immune system of the body, and simultaneously stimulate cellular immunity, mucosal immunity and humoral immunity, and is easy to use and low in production cost. Generally, we mainly use it for the first free of broiler, breeder and laying hens. Inherited attenuated live vaccines have been used in the Netherlands since 1956, and H52 and H120 are currently the most widely used live vaccines in the world. Although my country has been widely using Mass-type vaccines (H120, H52), in recent years, renal-type transmission has frequently and widely exploded in China.

Contents of the invention

The technical problem to be solved by the present invention is to overcome the defect that the existing vaccine strains cannot effectively prevent the attack of the popular strain of chicken infectious bronchitis virus, and the control effect is not ideal, and provide a live attenuated chicken infectious bronchitis vaccine YX10D90 strain.

The second object of the present invention is to provide the application of the attenuated live vaccine YX10D90 strain of chicken infectious bronchitis.

The third object of the present invention is to provide a medicine containing the attenuated live vaccine YX10D90 strain of chicken infectious bronchitis.

The purpose of the present invention is achieved through the following technical solutions:

A chicken infectious bronchitis attenuated live vaccine strain YX10D90 was deposited in the China Center for Type Culture Collection on March 14, 2016, with the preservation number CCTCCNO: V201610, and the preservation address is: Wuhan University, Wuhan, China.

The inventor conducted an evolutionary analysis of the S1 gene of Chinese isolates from 2008 to 2015, and the results were consistent with the reports of domestic scholars. The QX-like IBV has become the most important IBV genotype in my country, accounting for about 60% of the isolates. The S1 gene similarity between the QX-like type and the commonly used vaccine strains in my country (H120, H52, LDT3A, 4/91, etc.) is low (70-85%), and the evolutionary distance is relatively long. Further research found that chicken flocks were immunized with domestic main attenuated vaccines (H120, H52, LDT3A, 4/91, etc.), and then challenged with QX-like genotype strains, indicating that commercial vaccine strains cannot provide enough for the current dominant epidemic strains. protection of.

The attenuated live vaccine YX10D90 strain of the present invention is obtained by separating and attenuating the YX10 strong virus strain through multiple passages. Specifically, the YX10 strain is continuously passaged and weakened by using 9 to 11-day-old SPF chicken embryos. Five chicken embryos were inoculated into the allantoic cavity, each embryo was inoculated with 200 μL, and after incubation at 37°C for 36-48 hours, the allantoic fluid of the chicken embryos was aseptically collected for the next passage. Passed down continuously to the 90th generation, named YX10D90.

The biological characteristics of YX10D90 strain are as follows: the allantoic fluid of the virus has no hemagglutination, inoculation of 9-11-day-old chicken embryos can cause developmental retardation or death of chicken embryos, no pathogenicity to SPF chickens, and the morphological observation is a typical coronavirus.

The present invention also provides a polypeptide whose amino acid sequence is shown in SEQ ID NO:2.

The present invention also provides the nucleotide sequence encoding the polypeptide, which is shown in SEQ ID NO:1.

After sequencing and analysis, the polypeptide sequence encoded by the gene of the vaccine YX10D90 strain is shown in SEQ ID NO: 2; the nucleotide sequence of the gene of the vaccine YX10D90 strain is shown in SEQ ID NO: 1, or the sequence described in SEQ ID NO: 1 Basically, one or more nucleotides are replaced, deleted and/or added, and the gene sequence encoding the protein described in SEQ ID NO: 2 has equivalent functions.

The invention also provides the application of the attenuated live vaccine YX10D90 strain of chicken infectious bronchitis in the preparation of medicine for treating chicken infectious bronchitis.

The present invention also provides medicines containing the attenuated live vaccine YX10D90 strain of chicken infectious bronchitis; specifically, it can be a vaccine, and the vaccine includes the attenuated live vaccine YX10D90 strain of chicken infectious bronchitis described in claim 1 or 4 or 5 and a pharmaceutically acceptable lyoprotectant.

Compared with the prior art, the present invention has the following beneficial effects:

The invention provides a chicken infectious bronchitis attenuated live vaccine strain YX10D90, which was preserved in the China Center for Type Culture Collection on March 14, 2016, with the preservation number CCTCCNO: V201610, and the preservation address is: China, Wuhan, Wuhan University; The attenuated strain is safe to various chickens and has no side effects, and the attenuated strain is made into a vaccine which is safe and effective, can protect homologous virulent virus challenge, and has practical and extensive application value.

Description of drawings

Figure 1 is the control effect of the attenuated vaccine injected with YX10D90.

detailed description

The present invention will be further specifically described below through the accompanying drawings and specific embodiments. The design ideas of the present invention or simple substitutions of similar substances belong to the protection scope of the present invention. Unless otherwise specified, the experimental methods used below are conventional methods in this technical field, and the ingredients or materials used, unless otherwise specified, are commercially available ingredients or materials.

Example 1 Isolation and Identification of Infectious Bronchitis Virus YX10 Strain

YX10 was isolated and identified by our laboratory in 2010 from a 30-day-old diseased yellow-feathered broiler chicken in Huzhou, Zhejiang. The specific process is as follows:

(1) Isolation and culture of virus

Aseptically collect the kidneys, spleen, lungs, and trachea of dead chickens, sterilize the normal saline at a volume ratio of 1:5 (volume ratio), grind, freeze-thaw 3 times, centrifuge at 5000rpm for 20min, and filter the supernatant to sterilize the allantois Inoculate 10 10-day-old SPF chicken embryos in the cavity, inoculate 0.2ml per embryo, incubate the inoculated chicken embryos at 37°C, illuminate the embryos twice a day, discard dead embryos within 24 hours, and take 5 embryos within 48 hours to harvest the allantois solution, and the rest continued to incubate until 144 hours, and the pathological changes of chicken embryos were recorded. So blindly passed on for 5 generations. Harvested virus was stored at -80°C. The chicken embryos of the third generation exhibited typical lesions of the mycovirus, manifested as growth retardation of chicken embryos, curling up of embryo bodies and dehydration. The virus content measured at the fifth generation was 10 ^5.0 EID ₅₀ /0.1ml.

(2) Virus identification

1. Hemagglutination: the allantoic fluid harvested from the 1st to 5th generations was subjected to hemagglutination test. Results The allantoic fluid of each generation did not agglutinate 1% chicken erythrocytes, and the virus had no hemagglutination. The possibility of hemagglutination of poultry viruses such as orthomyxovirus, paramyxovirus and adenovirus was ruled out.

2. PCR identification: 200 μl of fifth-generation allantoic fluid, TAKARA RNA extraction reagent RNAisoPlus to extract viral RNA, and RT-PCR with N gene primers.

Upstream 5'-CGGAGCAATAGCAAGAAAAGC-3'

Downstream: 5'-GCAGCAACCCACACTATACCATC-3'.

The PCR product was subjected to 1.5% agarose gel electrophoresis, and the result was a target band at about 500 bp, which proved that the isolated virus was IBV.

3. Clade S1 gene sequencing and analysis

200 μl of the fifth-generation allantoic fluid, TAKARA company RNA extraction reagent RNAisoPlus to extract viral RNA, amplify S1 gene, IBVS1 upstream: 5'-AAGACTGAACAAAAGACCGACT-3'; downstream: 5'-CAAAACCTGCCATAACTAACATA-3'; the product length is about 1700bp. The PCR products were subjected to 1.5% agarose gel electrophoresis, and the target bands were clear and free of impurities, and were directly sent to Huada Gene Company for sequencing. The full length of the S1 gene sequence is 1620bp after splicing.

The S1 gene sequence of YX10 strain was submitted to Genebank, Accession No: JX840411. Multiple comparisons with S1 genes of H120 (EU822341), H52 (AF352315), W93 (AY842862), M41 (DQ664534), 4/91 (JN192154), LDT3-A (AY702975) vaccine strains showed low homology ( are lower than 85%), 77.9%, 78.3%, 77.5%, 77.8%, 78.6%, 84.8% respectively. The spike protein encoded by the S1 gene is located on the surface of the virus, which induces the body to produce neutralizing antibodies, and is closely related to the body's protective response. The S1 gene is the gene most likely to mutate during the evolution of the virus, and its sequence difference is greater than 5%. Produce or fail to fully produce cross-protection.

4. Morphological observation

The allantoic fluid of YX10D90 strain virus was centrifuged and negatively stained with phosphotungstic acid, and the coronavirus with a diameter of about 80-120nm can be seen under the electron microscope. , evenly arranged coronal processes. It has the typical shape of coronavirus.

5. Animal regression test

20 7-day-old SPF chickens were inoculated with the fifth-generation virus by nasal drops and eye drops, 100 μl each. The chickens began to show clinical symptoms 2 days after the challenge, and chickens died 3 days later, with a morbidity rate of 100% ( 10/10), and the mortality rate was 50% (5/10). The affected chickens showed mild respiratory symptoms, and some chickens were depressed, had diarrhea, increased drinking water, and decreased feed intake. The dead chickens were extremely emaciated, and all the dead chickens had slight tracheal mucus, hemorrhage, air sacculitis, obviously enlarged kidneys, mottled, and a large amount of white urate deposits. After the 14th day, the clinical symptoms gradually took a turn for the better, and 20 days after the attack, they basically returned to normal. Clinical cases can be reproduced by infection of susceptible chicks with isolated mycoviruses.

6. Serum neutralization test

Preparation of positive serum of YX10 strain: 20 14-day-old SPF chickens were raised in a negative pressure isolator, and the fifth-generation virus of YX10 strain was inoculated by nasal drops and eye drops, with a dose of 0.1ml/bird. Inject 0.3ml of inactivated oil emulsion vaccine of YX10 strain, 0.5ml of inactivated vaccine of oil emulsion of YX10 strain was injected subcutaneously again 14 days later, blood was collected from the heart after 10 days, serum was aseptically separated, and penicillin and streptomycin were added at 2000 units per milliliter, divided For equipment.

Cross-neutralization test with positive sera of similar diseases: Dilute the fifth-generation virus of YX10 strain 1000 times, and mix with equal amounts of ND, IBD, ITL, IB (M41) positive sera (purchased from China Veterinary Drug Administration) and After YX10 positive serum was mixed, inoculated at 37°C for 60 minutes, and inoculated five 10-day-old SPF chicken embryos, 0.2 mL in the allantoic cavity of each embryo. The virus control group was the 10 ^-4 diluted virus of YX10 strain mixed with the same amount of saline. Incubate at 37°C and observe for 6 days. The results are shown in Table 1.

Neutralization test with IB positive serum: Dilute YX10 strain with physiological saline to contain 100 EID ₅₀ per 0.1ml; IBVM41 strain, 4/91 strain, LDT3-A strain and YX10 strain positive serum were diluted 16 times respectively, Diluted virus and serum were mixed in equal amounts, incubated at 37°C for 60 minutes, and inoculated with SPF chicken embryos through the allantoic cavity, 5 eggs per serum, 0.2 mL per embryo, incubated at 37°C for 168 hours, and the chickens that died within 24 to 168 hours were selected. In embryos and 144-hour live embryos, the fetuses have specific lesions such as dehydration, curling up, and small development, which are used as infection indicators for IB specific lesions. The results are shown in Table 2.

The results showed that the positive sera of ND, IBD and ILT could not neutralize the IBVYX10 strain virus. IBV, YX10 strain can be completely neutralized by the positive serum of YX10 strain, and all chicken embryos develop normally. The positive serum of IBVM41 strain, 4/91 strain and LDT3-A strain cannot neutralize the YX10 strain virus.

So far, through virus isolation and identification, PCR identification, morphological observation, serum chicken embryo neutralization test, animal regression test and other pathogenic biological characteristics research, a QX-like avian infectious bronchitis virus was obtained, named YX10 strain. The whole gene sequence of YX10 has been sequenced and uploaded to GenBank, AccessionNo: JX840411.

The cultivation of embodiment 2YX10D90 attenuated strain

1. Continuous subculture of chicken embryos weakened the virus strain

Use 9-11 day-old SPF chicken embryos to carry out continuous subculture to weaken the YX10 strain, inoculate 10 chicken embryos through the allantoic cavity for each generation, 0.1ml/piece, incubate at 37°C, discard dead chicken embryos within 24 hours, 36 Harvest 5 live embryos in about 1 hour, collect the embryo fluid aseptically for the next subculture, and keep the rest until 144 hours to observe whether there are branched lesions in the chicken embryos. Such continuous passage to the 120th generation. During a certain interval, virus content, sterility and mycoplasma detection, exogenous virus detection, and safety tests on susceptible chicks were carried out to determine whether the virulence was attenuated.

2. Determination of virus content

The EID ₅₀ of the D5, D25, D40, D58, D75, D90, and D120 viruses were measured during the subculture process. The virus was diluted 10 times with sterilized normal saline, and 5 dilutions (10 ^-4 ~ 10 ^-8 ) were selected to inoculate 5 10-day-old SPF chicken embryos, 0.2m1 per embryo, and incubated at 37°C for 144 hours, 24 The chicken embryos that died within one hour were not counted, and the number of infected chicken embryos was recorded, and the EID ₅₀ was calculated according to the Reed-Muench method. The measurement results are shown in Table 3.

The strain _YX10 passaged virus can quickly adapt to chicken embryos. The virus price of ^YX10D5 generation is as high as 10 ^6.3 EID ₅₀ /0.2ml. After passage, the virus titer continues to increase, but the range is not large. ml, most of them are maintained at about 10 ^6.5 EID ₅₀ /0.2ml.

3. Sterility and mycoplasma detection

The D5, D25, D58, D75, D90, and D120 generation viruses were tested for sterility and mycoplasma according to the appendix of the current Veterinary Pharmacopoeia of the People's Republic of China. The test results of each generation were negative.

4. Exogenous virus detection

The D5, D25, D58, D75, D90, and D120 generations of viruses were tested for exogenous viruses according to the appendix of the current Veterinary Pharmacopoeia of the People's Republic of China. The test results of each generation were negative.

5. Safety test on susceptible chicks

During the continuous passage process, the safety tests of D5, D25, D58, D75, D90, and D120 generations of viruses were carried out respectively. 30 1-day-old SPF chicks were randomly divided into two groups. Only intranasal 10 ^5.5 EID ₅₀ /200μl, another group as a control without treatment. Raised in a negative pressure isolator with free access to water and food. Observe daily after inoculation, record the morbidity and death of chicken flocks, and conduct autopsy on dead chickens in time. After 2 weeks, the surviving chickens were autopsied, and the lesions of organs such as the kidney and trachea were recorded. The results are shown in Table 4.

As the virus gradually adapts to chicken embryos, its pathogenicity to chickens gradually decreases. The incidence of chicks after D5, D25, and D58 inoculation is 100%, 100%, 75% (9/12), and the mortality rate is 50% ( 6/12), 25% (3/12), 16.7% (2/12), the pathogenicity of D75 has decreased, only 16.7% (2/12) showed transient respiratory symptoms, and no death. The D90 and D120 generation chickens were completely normal after inoculation, no respiratory symptoms, no death, no lesions in the trachea and kidney after autopsy, and the virus had no pathogenicity after passage to the D90 generation.

6. Immunogenicity test of YX10D90

The immunogenicity assay was carried out on the attenuated YX10D90 virus. Thirty 1-day-old SPF chicks were randomly divided into 4 groups, and the test group was immunized with YX10D90 virus by three different doses of 10 ^6.0 EID ₅₀ / 10 ^5.0 EID ₅₀ / 10 ^4.0 EID 50 / 10 4.0 EID ₅₀ / eye drops, 200 μl/ Only, group 4 was not treated as a control. Raised in a negative pressure isolator with free access to water and food. After inoculation, observe and record the situation of the flocks every day. Two weeks later, use the homologous virulent YX10D5 to challenge the virus, and use nasal and eye drops, each 10 ^5.5 EID ₅₀ /200μl. After the challenge, observe and record the morbidity, Death situation, timely autopsy dead chicken. After 2 weeks of observation, the surviving chickens were dissected, and the lesions of the kidneys, trachea and other organs were recorded. After immunization, the chickens in the experimental group and the control group were normal. On the third day after the challenge, the chickens in the control group showed respiratory symptoms. Tracheal hemorrhage, mucus in the trachea, enlarged and pale kidneys and other lesions. The immune group had no disease and no death; the results are shown in Table 5.

Conclusion: When the immunization dose of YX10D90 is ≥10 ^4.0 EID ₅₀ per bird, a satisfactory protective effect can be achieved, and the protection rate is 100%.

7. Whole gene sequencing of attenuated vaccine strain YX10D90

Whole gene sequencing of YX10D90 has been completed. The sequence of YX10D90S1 is shown in SEQ ID NO: 1, and the 3'-UTR of YX10D90 is shown in SEQ ID NO: 3.

YX10 has been subcultured 120 times in SPF chicken embryos. The virus adapts well on SPF chicken embryos. After D40, the virus price is stable at 10 ^7.0 EID ₅₀ /0.2ml or more. By the 90th passage, the virus has been completely weakened and retained a good immunogen sex, and the test results of bacteria, mycoplasma, and other exogenous viruses are all negative. YX10D90 can be used as the original seed virus of the attenuated vaccine.

Submit the obtained strain for preservation, the preservation name of the strain is chicken infectious bronchitis virus YX10D90 strain, the preservation time is March 14, 2016, the preservation number is CCTCCNO: V201610, and the preservation unit is China Center for Type Culture Collection , and the deposit address is: China, Wuhan, Wuhan University.

The nucleotide sequence of the S1 gene of the strain is shown in SEQ ID NO: 1, and the encoded polypeptide sequence is shown in SEQ ID NO: 2.

Embodiment 3 YX10D90 attenuated vaccine preparation

1. Preparation of IBV virus liquid

Dilute the YX10D90 species poison obtained in Example 2 1000 times with sterilized saline, inoculate 100 pieces of 10-day-old SPF chicken embryos in the allantoic cavity, 0.2ml per embryo, seal the pinholes, and continue incubation at 37°C without turning the eggs. Eggs were illuminated once within 24 hours after inoculation, and dead embryos were discarded. After that, eggs were illuminated once every 4 hours, and dead chicken embryos were taken out at any time until 36 hours. Stand upright and cool at 4°C for 12 hours. Take out the cooled chicken embryo, sterilize the air cell, and then use aseptic surgery to peel off the egg shell of the air cell, remove the egg shell membrane, cut the chorioallantoic membrane and amniotic membrane (do not break the yolk), and absorb the chicken embryo fluid , samples were taken for inspection, and stored at -20°C for later use.

2. Examination of IBV venom

The harvested virus liquid was subjected to sterility test and red blood cell agglutination test bottle by bottle according to the current "Chinese Veterinary Pharmacopoeia" appendix method, and a sample was taken to determine the virus content (EID ₅₀ ). Results The harvested virus liquid grew aseptically, and the agglutination test of 1% chicken erythrocyte suspension should be negative, and the virus content per 0.1ml was above 10 ^7.0 EID ₅₀ .

3. Seedling matching and packaging

Filter the qualified virus liquid with 4 layers of sterilized gauze, mix it in the same container, add an equal amount of 5% sucrose skim milk as a stabilizer, and add penicillin and streptomycin at 1000 units per milliliter, shake well, Quantitatively packaged so that the virus content per feather is 10 ^4.0 EID ₅₀ , 1000 feathers per bottle.

4. Freeze-dry, cover and label, and store below -15°C.

5. Vaccine safety test

The 1-day-old SPF chickens were immunized with 10 times the immunization dose, and the safety of the vaccine was tested. Vaccines were appropriately diluted with sterilized saline to immunize 10 1-day-old SPF chickens, each with 200 μl of nasal drip (containing 10 vaccines), and 10 non-immunized controls were set up at the same time. Daily observation records the health status of the chickens for 21 days. Results There was no disease and no difference in weight gain between the immunized group and the control group, which indicated that the vaccine was safe.

6. Vaccine efficacy test

20 1-day-old SPF chickens were divided into two groups. One group was immunized with a dose of YX10D90 live vaccine prepared above, and the other group was not treated as a control. They were raised in a negative pressure isolator and had free access to water and food. After inoculation, observe and record the condition of the flocks daily. After 2 weeks, use the virulent YX10D5 to challenge the virus. The route of nasal and eye drops is 10 ^5.5 EID ₅₀ /0.2ml per bird. After the challenge, observe and record the morbidity and death of the flocks every day. , Timely autopsy dead chicken. After 2 weeks of observation, the surviving chickens were dissected, and the lesions of the kidneys, trachea and other organs were recorded.

After immunization, the chickens in the experimental group and the control group were all normal. On the second day after the challenge, the chickens in the control group showed respiratory symptoms, some chickens were depressed and defecated, and a total of 5 died. Surviving chickens had different degrees of tracheal hemorrhage, There are mucus in the trachea, swollen and pale kidneys and other lesions, the incidence rate is 100% (10/10), and the mortality rate is 50% (5/10). In the immunized group, there was no disease and death, and the health of the chickens was normal (Figure 1), indicating that the live vaccine prepared with the attenuated D90 virus is safe and effective, and can protect the homologous virulent challenge.

SEQUENCELISTING

<110> South China Agricultural University

<120> A chicken infectious bronchitis attenuated live vaccine YX10D90 strain

<130>

<160>7

<170>PatentInversion3.3

<210>1

<211>1620

<212>DNA

<213> Nucleotide sequence of S1 gene of YX10D90

<400>1

atgttggggaagtcactgtttttagtgaccattttgtgtgcactatgtagtgcaaatttg60

tttgattctgccaataattatgtgtactactaccaaagtgcctttaggcctccaaatgga120

tggcatctgcaagggggtgcttatgcagtagtgaattctactaattatactaataatgcc180

ggttctgcaagtgggtgcactgttggtgtttattaaggacgtctataatcaaagtgcggct240

tccatagctatgacagcacctcctcagggtatggcttggtctaagtcacaattttgtagt300

gcacactgtaacttttctgaaattacagtttttgtcaacacattgttatagtagtggtgca360

ggttcttgtcctataacaggcatgattgcacgtgatcatattcgtatttctgcaatgaaa420

aatggttctttattttataatttaacagttagcgtatctaaataccctacgtttaaatct480

tttcaatgtgttaacaattccacatctgtttatctaaatggtgatcttgtttttacttct540

aacaaaactgctgatgttacgtcagcaggtgtgtattataaagcaggtggacccgtaaat600

tatagtgttatgaaagaatttaaggttcttgcttactttgttaatggtacagcacaagat660

gtaattttgtgcgacaattcccccaagggtttgctggcttgtcaatataatactggcaat720

ttttcagatggcttttatccttttactaatagtactttagttagggacaagttcattgtc780

tatcgtgaaagtagtgtcaatactactttgacgttaactaatttcacttttactaatgta840

agtactgcacagcctaatagtggtggtgttagtacttttcatttatatcaaacacaaaca900

gctcagagtggttattataattttaatttgtcatttctgagtcagtttgtgtataaggca960

agtgattttatgtatgggtcttaccaccctaggtgttcttttagaccagaaaccattaat1020

agtggtttatggtttaattccttgtcagtttctcttacttatggacccctacagggaggg1080

tgtaagcaatctgtttttaatggtaaggcaacgtgttgttatgcctactcttataatggc1140

ccaagggcatgtaaaggtgtttattcaggtgaattaagcaagacttttgaatgtggattg1200

ctggtttatgttactaagagtgatggctctcgtatacagactagaacggagcccttagta1260

ttaatgcaacacaattataataatattactttagataagtgtgttgactataatatatat1320

ggcagagtaggccaaggttttattactaatgtgactgattctgctgctaattttagttat1380

ttagcagatggtgggttagctattttagatacttcgggtgccatagatgtctttgttgta1440

cagggcagctatggtcttaattattacaaggtcaatccttgtgaagatgttaaccaacag1500

tttgtagtgtctggtggcaatatagttggcattcttacttctagaaatgaaacaggttct1560

gaacaggttgagaaccagttttatgttaagttaaccaatagctcacatcgtcgcaggcgt1620

<210>2

<211>540

<212>PRT

<213> Amino acid sequence encoded by S1 gene of YX10D90

<400>2

MetLeuGlyLysSerLeuPheLeuValThrIleLeuCysAlaLeuCys

151015

SerAlaAsnLeuPheAspSerAlaAsnAsnTyrValTyrTyrTyrGln

202530

SerAlaPheArgProProAsnGlyTrpHisLeuGlnGlyGlyAlaTyr

354045

AlaValValAsnSerThrAsnTyrThrAsnAsnAlaGlySerAlaSer

505560

GlyCysThrValGlyValIleLysAspValTyrAsnGlnSerAlaAla

65707580

SerIleAlaMetThrAlaProProGlnGlyMetAlaTrpSerLysSer

859095

GlnPheCysSerAlaHisCysAsnPheSerGluIleThrValPheVal

100105110

ThrHisCysTyrSerSerSerGlyAlaGlySerCysProIleThrGlyMet

115120125

IleAlaArgAspHisIleArgIleSerAlaMetLysAsnGlySerLeu

130135140

PheTyrAsnLeuThrValSerValSerLysTyrProThrPheLysSer

145150155160

PheGlnCysValAsnAsnSerThrSerValTyrLeuAsnGlyAspLeu

165170175

ValPheThrSerAsnLysThrAlaAspValThrSerAlaGlyValTyr

180185190

TyrLysAlaGlyGlyProValAsnTyrSerValMetLysGluPheLys

195200205

ValLeuAlaTyrPheValAsnGlyThrAlaGlnAspValIleLeuCys

210215220

AspAsnSerProLysGlyLeuLeuAlaCysGlnTyrAsnThrGlyAsn

225230235240

PheSerAspGlyPheTyrProPheThrAsnSerThrLeuValArgAsp

245250255

LysPheIleValTyrArgGluSerSerValAsnThrThrLeuThrLeu

260265270

ThrAsnPheThrPheThrAsnValSerThrAlaGlnProAsnSerGly

275280285

GlyValSerThrThrPheHisLeuTyrGlnThrGlnThrAlaGlnSerGly

290295300

TyrTyrAsnPheAsnLeuSerPheLeuSerGlnPheValTyrLysAla

305310315320

SerAspPheMetTyrGlySerTyrHisProArgCysSerPheArgPro

325330335

GluThrIleAsnSerGlyLeuTrpPheAsnSerLeuSerValSerLeu

340345350

ThrTyrGlyProLeuGlnGlyGlyCysLysGlnSerValPheAsnGly

355360365

LysAlaThrCysCysTyrAlaTyrSerTyrAsnGlyProArgAlaCys

370375380

LysGlyValTyrSerGlyGluLeuSerLysThrPheGluCysGlyLeu

385390395400

LeuValTyrValThrLysSerAspGlySerArgIleGlnThrArgThr

405410415

GluProLeuValLeuMetGlnHisAsnTyrAsnAsnIleThrLeuAsp

420425430

LysCysValAspTyrAsnIleTyrGlyArgValGlyGlnGlyPheIle

435440445

ThrAsnValThrAspSerAlaAlaAsnPheSerTyrLeuAlaAspGly

450455460

GlyLeuAlaIleLeuAspThrSerGlyAlaIleAspValPheValVal

465470475480

GlnGlySerTyrGlyLeuAsnTyrTyrLysValAsnProCysGluAsp

485490495

ValAsnGlnGlnPheValValSerGlyGlyGlyAsnIleValGlyIleLeu

500505510

ThrSerArgAsnGluThrGlySerGluGlnValGluAsnGlnPheTyr

515520525

ValLysLeuThrAsnSerSerHisArgArgArgArg

530535540

<210>3

<211>391

<212>DNA

<213> YX10D90 3'-UTR sequence

<400>3

cataattgttgattgcagtttgctttctttctgtgcttattgtttttattctgctttatt60

ctttgttatatcgtagaagtttattaaaggttaaggaagataggcatgtagcttgattac120

ctacatgtctatcgccagggaaatgtctaatctgtctacttagtagcctggaaacgaacg180

gtagaccccttagattttaatttagtttaatttttagttttagtttaagttagtttagagta240

ggtataaagatgccagtgccggggccacgcggagtacgatcgagggtacagcactaggac300

gcccactaggggaagagctaaattttagtttaagttaagtttaattgtctaagtatagtt360

aaaatttataggctagtatagagttagagca391

<210>4

<211>21

<212>DNA

<213> N gene upstream primer

<400>4

cggagcaatagcaagaaaagc21

<210>5

<211>23

<212>DNA

<213> N gene downstream primer

<400>5

gcagcaacccaacactataccatc23

<210>6

<211>22

<212>DNA

<213>Upstream primers for amplifying the S1 gene

<400>6

aagactgaacaaaagaccgact22

<210>7

<211>23

<212>DNA

<213> Downstream primers for amplifying the S1 gene

<400>7

caaaacctgccataactaacata23

Claims (7)

1. A chicken infectious bronchitis attenuated live vaccine YX10D90 strain, characterized in that it was preserved in the China Center for Type Culture Collection on March 14, 2016, and the preservation number is CCTCCNO: V201610. 2. A polypeptide, characterized in that its amino acid sequence is shown in SEQ ID NO:2. 3. The nucleotide sequence encoding the polypeptide according to claim 2, characterized in that said sequence is shown in SEQ ID NO: 1. 4. The chicken infectious bronchitis attenuated live vaccine YX10D90 strain according to claim 1, characterized in that the polypeptide sequence encoded by the gene of the vaccine YX10D90 strain is shown in SEQ ID NO:2. 5. according to claim 4 said chicken infectious bronchitis attenuated live vaccine YX10D90 strain, it is characterized in that, the nucleotide sequence of the gene of said vaccine YX10D90 strain is shown in SEQIDNO: 1, or in the sequence described in SEQIDNO: 1 Basically, one or more nucleotides are replaced, deleted and/or added, and the gene sequence encoding the protein described in SEQ ID NO: 2 has equivalent functions. 6. The application of the attenuated live vaccine YX10D90 strain of chicken infectious bronchitis described in claim 1 or 4 or 5 in the preparation of a medicament for treating chicken infectious bronchitis. 7. A vaccine for preventing and treating chicken infectious bronchitis, characterized in that it comprises the attenuated live vaccine YX10D90 strain of chicken infectious bronchitis described in claim 1 or 4 or 5 and a pharmaceutically acceptable lyoprotectant.