CN104587458B - The Bivalent DNA Vaccine of prevention giardiasis and enteric coated preparation thereof - Google Patents
The Bivalent DNA Vaccine of prevention giardiasis and enteric coated preparation thereof Download PDFInfo
- Publication number
- CN104587458B CN104587458B CN201410783255.XA CN201410783255A CN104587458B CN 104587458 B CN104587458 B CN 104587458B CN 201410783255 A CN201410783255 A CN 201410783255A CN 104587458 B CN104587458 B CN 104587458B
- Authority
- CN
- China
- Prior art keywords
- pvax1
- giardin
- cwp
- dna vaccine
- giardiasis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a kind of Bivalent DNA Vaccine for preventing human or animal's giardiasis, wherein the two of giardia lamblia kinds of antigen gene α 1 giardin and CWP 2 are inserted respectively acquisition recombiant plasmid pVAX1 α 1 giardin and pVAX1 CWP 2 in eukaryotic vector pVAX1, being transported into respectively in Host Strains being comprised recombiant plasmid pVAX1 α 1 giardin and the recombinant bacterium of recombiant plasmid pVAX1 CWP 2 respectively by described recombiant plasmid pVAX1 α 1 giardin and pVAX1 CWP 2, described recombinant bacterium constitutes the Bivalent DNA Vaccine of the present invention.The present invention creatively proposes to be respectively directed to the anti-giardiasis Bivalent DNA Vaccine of trophozoite and two stage use in conjunction of encapsulation, achieve suppression trophozoite formed thus block cause a disease and the suppression formation of encapsulation thus cut off propagation, overcome the shortcoming that in the research and development of conventional vaccine, vaccine effect is single.The Bivalent DNA Vaccine of the present invention The invention also achieves stability and passes on and the continuing of protectiveness.The invention also discloses a kind of enteric coated preparation quantitatively comprising described Bivalent DNA Vaccine and preparation method thereof.
Description
Technical field
The present invention relates to vaccines arts, be specifically related to prevent Bivalent DNA Vaccine and the enteric thereof of humans and animals giardiasis
Preparation.
Background technology
Giardia lamblia (Giardia lamblia is called for short giardia lamblia) is human body pathogenic protozoan, may result in abdomen
Rush down, the bad syndrome of alimentation and children growth obstacle.The whole world occurs about 500,000 new infeetioa cases every year, in AIDS sufferer
Infection rate high (about 20%-50%) in person, has been classified as ten kinds of whole world harm human health by World Health Organization (WHO)
One of main parasitic parasitosis.Additionally, giardia lamblia can infect 40 many animals, for typical zoonosis, it is harm China poultry
One of important parasite of animal husbandry development.
The life cycle of giardia lamblia includes trophozoite (trophozoite) and two stages of development of encapsulation (cyst), and goes out
Capsule and two processes of encystation.Trophozoite is nutrition and the idiophase (or pathogenic phase) of polypide, when people and some mammal eat
Encapsulation, it goes out capsule at little enteral and forms trophozoite parasitize this, and cause going into business based on the Lan Shi of diarrhoea and dyspepsia whip
Insect bite dermatitis (Giardiasis is called for short giardiasis).Encapsulation is resting stage (or infection period), by trophozoite at colonic secretory sac
Wall material forms (encystation), excretes with host's feces afterwards, the host that peroral infection is new, and the most every 10 encapsulations are the most permissible
Cause host infection, form trophozoite at host's little enteral skin lesion of the scrotum and cause a disease.
At present, the choice drug of clinical treatment giardiasis is metronidazole (metronidazole).Though this medicine has preferably
Curative effect, but also have significant untoward reaction, be most commonly that gastrointestinal reaction, severe patient may occur in which massive hemorrhage of gastrointestinal tract；Portion
Dividing patient to it may also occur that neurological symptom, blood system reacts, even myocarditis.It addition, because of its teratogenesis to fetus,
And avoided by anemia of pregnant woman.Above-mentioned untoward reaction significantly limit metronidazole application in primary disease is treated.Additionally, giardia lamblia sense
Dye is many, and in chronic, patient's course of disease is long, and this survival dose is big, and the course for the treatment of is long.During long-term drug therapy, cause a disease the stage as this worm
Trophozoite form the encapsulation with dissemination because of drug resistance.The cyst wall of encapsulation is abundant has protective effect, metronidazole molecule
It is difficult to penetrate cyst wall, loses the lethal effect to encapsulation, it is impossible to block the propagation of giardiasis.
The research and development of anti-giardia lamblia vaccine are to control the important means that giardia lamblia is propagated and caused a disease.Current anti-giardia lamblia vaccine
Research and development are still in the junior stage, and are Unique Product using the crude protein extract of On The Trophozoite of Giardia Lamblia as immunogenic live vaccine
The anti-giardia lamblia vaccine product changed.But, this product can not control the discharge of animal encapsulation, thus can not cut off route of transmission.
α-giardin is that the one group of glue being positioned On The Trophozoite of Giardia Lamblia serosa surface connects albumen (Annexin), at giardia lamblia
Encapsulation converts in the infection adhesion process of (going out capsule) and trophozoite to trophozoite and plays a significant role.Wherein α 1-giardin is point
α-the giardin that son amount is minimum, comprises only the core texture of Annexin, has the strongest immunogenicity, produces in initial infection
Raw, it is present in whole course of infection, can be as serodiagnostic markup molecule.Additionally, α 1-giardin is in difference
Giardia lamblia pathogenic strain between the most conservative, including sequence homology (amino acid identity is 97%) and structural homology, and
Its protective effect is not relying on the generation of antibody.The CWP-2 of giardia lamblia is the main component albumen of giardia lamblia encapsulation cyst wall,
In On The Trophozoite of Giardia Lamblia saccilar process, produced by trophozoite secretion and penetrated into cyst wall.
The present invention creatively proposes to be respectively directed to trophozoite and the bivalent vaccine of two stage use in conjunction of encapsulation, with reality
Now suppression trophozoite formed thus block cause a disease and the suppression formation of encapsulation thus cut off propagation.The present invention uses α 1-
Giardin (α 1-merchant's element) and CWP-2 (cyst wall protein-2, cyst wall albumen) is respectively as merchant anti-in bivalent vaccine
Worm trophozoite infects and the antigen of suppression giardia lamblia encystation.
The pathogenic infection of many human or animals occurs to invade at mucosa or by mucosa.Mucosal immune system is body
Anti-infective first immunologic barrier.One layer of mucosa all it is covered with, energy at organ surfaces such as digestive tract, respiratory tract and reproductive system
By the interior environment of body and extraneous separation, effectively by virulence factor and the material blocking-up harmful to body.In mucosa, immunity is thin
Born of the same parents in accounting for body the 80% of all immunocytes, occupy very important status in the immunoprotection of body.For giardia lamblia
Deng intestinal parasitic protozoa, main stimulation intestinal mucosa produces secretory IgA (sIgA) antibody, may be big by mucosal immune
The big effect improving immunity inoculation.Simultaneously for developing and blocking the live vaccine that giardiasis is propagated, raise with bait or feedstuff
The immunization route fed, reaches to control the purpose of giardiasis by effectively controlling the infection of ill domestic animal, and development oral vaccine is clearly
A kind of simple and effective approach.At present, existed by the various live vaccine common problems of bait or feedstuff feeding approach
Amount in very difficult guarantee feeding animal.
The present invention utilizes the epitope of giardia lamblia α 1-giardin and CWP-2, builds bivalent vaccine, with Attenuated Salmonella
SL7207, as transport vehicle, quantitatively prepares enteric coated preparation, makes animal obtain the anti-Albendazole of effective specificity through intestinal
Immune with propagating.
Summary of the invention
The present invention is directed to the above-mentioned problems in the prior art, propose effective anti-giardia lamblia vaccine and should comprise two
Leading indicator, i.e. blocks to cause a disease and cut off and propagates.Accordingly, the present invention proposes employing and is respectively directed to trophozoite and two stages of encapsulation
The bivalent vaccine of two kinds of Vaccine molecules use in conjunction, thus realize suppressing the formation of trophozoite thus block and cause a disease and suppression
The formation of encapsulation thus cut off propagation.
It is an object of the present invention to provide a kind of Bivalent DNA Vaccine for preventing human or animal's giardiasis, should
Vaccine can block to cause a disease and cut off simultaneously and propagate.
A kind of enteric coated preparation comprising described Bivalent DNA Vaccine of offer is provided.
It is yet a further object of the present invention to provide a kind of enteric coated preparation comprising quantitative vaccine, to realize bivalent vaccine intestinal
The oral quantitative immunological of solubility preparation.
In a first aspect of the present invention, the present invention provides a kind of bivalence DNA epidemic disease for preventing human or animal's giardiasis
Seedling, it is characterised in that the two of giardia lamblia kinds of antigen gene α 1-giardin and CWP-2 are inserted in eukaryotic vector pVAX1 respectively
Obtain recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2, by described recombiant plasmid pVAX1-α 1-giardin and
PVAX1-CWP-2 is transported in Host Strains being comprised recombiant plasmid pVAX1-α 1-giardin and recombiant plasmid respectively respectively
The recombinant bacterium of pVAX1-CWP-2, described recombinant bacterium constitutes described Bivalent DNA Vaccine, wherein said antigen gene α 1-giardin
For SEQ ID NO:1 sequence, described antigen gene CWP-2 is SEQ ID NO:3 sequence.
In a preferred embodiment, described Bivalent DNA Vaccine is prepared by following steps:
(1) using the cDNA of giardia lamblia as template, respectively by PCR amplification obtain α 1-giardin and
CWP-2 genetic fragment,
(2) by between HindIII and the BamHI site of described genetic fragment insertion vector pVAX1, pVAX1-α 1-is produced
Giardin and pVAX1-CWP-2 recombiant plasmid；
(3) recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 in step 2 is transported into Host Strains respectively
In, comprised recombiant plasmid pVAX1-α 1-giardin and the recombinant bacterium of recombiant plasmid pVAX1-CWP-2, described restructuring respectively
Described Bivalent DNA Vaccine is i.e. obtained after the mixing of bacterium equal proportion,
Wherein, the primer used in PCR amplification is as follows:
The primer of α 1-giardin:
α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)
α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)
The primer of CWP-2:
Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC(HindIII)
Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG(BamHI)。
In a preferred embodiment, described Host Strains is Attenuated Salmonella, i.e. Attenuated Salmonella SL7207.
In another aspect of this invention, the present invention also provides for a kind of enteric system for preventing human or animal's giardiasis
Agent, described enteric coated preparation comprises the Bivalent DNA Vaccine for preventing human or animal's giardiasis described in first aspect.
Preferably, described enteric coated preparation is quantitatively preparation so that every part of enteric coated preparation comprises the described of essentially identical amount
The recombinant bacterium of Bivalent DNA Vaccine.
In a preferred embodiment, described enteric coated preparation is prepared by the method comprised the following steps:
1) recombinant bacterium to described Bivalent DNA Vaccine carries out amplification cultivation and obtains culture；
2) by step 1) in the culture that obtains centrifugal after carry out lyophilizing and obtain lyophilized powder；
3) in step 2) lyophilized powder that obtains is mixed into quantitative adjuvant and grinds and uniformly obtain grounds travel；
4) step 3 is weighed) grounds travel that obtains carries out quantitative tabletting, it is ensured that and every tablet preparation contains the restructuring of equal number
Bacterium；
5) by step 4) the tablet enteric coating agents that obtains is coated.
In a further preferred embodiment, described enteric coated preparation is prepared by the method comprised the following steps:
1) amplification cultivation: the recombinant bacterium of described Bivalent DNA Vaccine is carried out amplification cultivation and obtains the culture through amplification；
2) lyophilizing: be centrifuged by described culture, adds freeze drying protectant in centrifugation, and lyophilizing obtains lyophilized powder, institute
State freeze drying protectant and comprise 5% defatted milk powder and 2.5% sucrose；
3) grind: in lyophilized powder, be mixed into quantitative adjuvant, grind well and obtain grounds travel, described adjuvant selected from microcrystalline Cellulose,
Starch, differential dissipate silica gel, carboxymethyl starch sodium and magnesium stearate；
4) tabletting: weigh quantitative grounds travel, carries out quantitative tabletting according to antibacterial recombinant bacterium viability examination result, it is ensured that every
Containing same amount of 0.2～5 × 105Individual recombinant bacterium；
5) coating: weigh appropriate Opadry, adds in distilled water under high-speed stirred, makes the suspension that concentration is 20%,
Continuing stirring 2h, obtain coating solution, seed-coating machine revolution is adjusted to 40-50r/min, adds the tablet prepared, and regulates spray gun liquid-gas
Ratio, coating to tablet increases weight 6-8%；
6) packaging.
Beneficial effects of the present invention:
1. in Albendazole and communication process, encystation and to go out capsule be two important links.The present invention creatively carries
Go out to utilize and build Bivalent DNA Vaccine in encystation and the specific antigen epi-position going out the capsule stage such that it is able to efficiently control giardia lamblia
Infect and the propagation of giardiasis, overcome the shortcoming that in the research and development of conventional vaccine, vaccine effect is single.
2.CWP-2 is the cyst wall albumen that giardia lamblia is important, essential during giardia lamblia encystation, conventional research
Show that it has the effect reducing encystation rate.But owing to it has certain toxicity to Host Strains, it is extremely difficult to stability and passes
Generation.This research, by the analysis to CWP-2 epi-position, filters out one section of epitope with 125 aminoacid sequences, experiment card
This epi-position bright not only has good antigenicity, eliminates the damage to Host Strains simultaneously, it is achieved that stability passes on and protects
Continuing of property.
3. the present invention uses the form of enteric coated preparation, it is achieved quantitative immunological, simultaneously the life to existing enteric bacterin preparation
Production. art is improved, and eliminates the drying and other steps that may affect vaccine activity, will carry the carrier bacterium of Vaccine molecules
Live vaccine is processed into enteric coated preparation, carries out quantitative immunological.There is administration quick, safely and effectively, it is easy to the advantages such as large-scale production,
There is preferable application prospect.
Accompanying drawing explanation
Fig. 1 illustrates the stability experiment after recombinant attenuated Salmonella (bivalent vaccine) Secondary Culture in vitro of the present invention
Result；
The experiment knot that Fig. 2 detects through fluorescence immunoassay after illustrating the recombinant attenuated Salmonella Secondary Culture in vitro of the present invention
Really；
After Fig. 3 illustrates the recombinant attenuated Salmonella immune mouse of the present invention, the change of mice serum IgG antibody titer；
After Fig. 4 illustrates the recombinant attenuated Salmonella immune mouse of the present invention, total SIgA content in mouse intestinal flushing liquor
Change；
Fig. 5 illustrates after the recombinant attenuated Salmonella immune mouse of the present invention 7 weeks, anti alpha 1-in mouse intestinal flushing liquor
The content of giardin and CWP-2 specificity SIgA；
Fig. 6 illustrates the recombinant attenuated Salmonella destination protein expression of results at mice mesenteric lymph node of the present invention.
Detailed description of the invention
Describe embodiments of the present invention in detail below with reference to drawings and Examples, whereby how the present invention is applied
Technological means solves technical problem, and the process that realizes reaching technique effect can fully understand and implement according to this.
Embodiment 1
The structure of recombinant prokaryotic expression vector pET41a-α 1-giardin and pET41a-CWP-2 and qualification
(1) according to the gene sequencing of α 1-giardin in Genbank data base, design synthesis specific primer, and in sequence
Row two ends introduce Hind III and EcoR I restriction enzyme site, all introduce protectiveness bases G C at restriction enzyme site two ends.
The primer of α 1-giardin:
α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)
α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)
(2) according to the gene order of Genbank data base giardia lamblia CWP2, its coded epitope is carried out point
Analysis, filters out one section containing 125 amino acid whose epi-positions.Design specific primer, introduces Hind III He simultaneously at sequence two ends
EcoR I restriction enzyme site, all introduces protectiveness bases G C at restriction enzyme site two ends.
The primer of CWP-2:
Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC(HindIII)
Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG(BamHI)。
(3) using the cDNA of giardia lamblia as template, carry out RT-PCR amplification and obtain purpose fragment, after enzyme action with as warp
PET41a carrier segments after Hind III and EcoR I double digestion is connected, construction recombination plasmid pET41a-α 1-giardin and
PET41a-CWP-2, Transformed E .coli DH5a, picking positive colony.Identify that correct recon proceeds to E.coli through order-checking
BL21。
(4) experiment is expressed in a small amount: respectively from pET41a-α 1-giardin/BL21 and pET41a-CWP-2/BL21 antibiotic
During on selectivity flat board, picking list bacterium colony puts into the 5ml LB culture fluid containing kanamycin (30mg/ml), in duplicate.37 DEG C,
200rpm, shakes overnight incubation；Next day, the spectrophotometric value (OD600) of detection culture, take appropriate bacterium solution, 2ml is new in inoculation
The fresh LB culture medium containing 30mg/ml kanamycin, making OD value is 0.2, continues at 37 DEG C, 250rpm, quickly shakes cultivation
To OD600 ≈ 0.6.Addition IPTG to final concentration of 1mM, 37 DEG C, 200rpm, abduction delivering 4h.Examined by SDS-PAGE electrophoresis
Survey the expression of destination protein, and carry out soluble analysis.
The aminoacid sequence of α 1-giardin is SEQ ID NO:2 sequence；The aminoacid sequence of CWP-2 is SEQ ID NO:
4 sequences.
Embodiment 2
Great expression in escherichia coli of recombinant alpha 1-giardin and CWP-2 and purification, the preparation of specific antibody
(1) expression system is expanded: choose from the flat board of pET41a-α 1-giardin/BL21 and pET41a-CWP-2/BL21
Take single bacterium colony to put in the 50ml LB culture fluid containing kanamycin.37 DEG C, 200rpm, shake overnight incubation；Next day, take respectively
In bacterium solution two 4L conical flasks equipped with 1L LB (containing kanamycin 30 μ g/ml) of inoculation of 25ml incubated overnight.37 DEG C,
250rpm, quickly shaking is cultivated to OD600 ≈ 0.6.Add IPTG to final concentration of 1mM, at 30 DEG C, 250rpm, abduction delivering
5h；Centrifugal bacterial sediment of collecting, ultrasonic degradation, collect supernatant (solubility expression), use His-tag affinity column to carry out mesh
Protein purification.
(2) prepared by specific polyclonal antibody: take 20 6～8 week old BALB/c female mices, respectively with 20 μ g/0.1ml
Antigen (r α 1-giardin and rCWP-2) add complete Freund's adjuvant (CFA) the back multiple spot subcutaneous injection of equivalent.Every other week with not
Complete Freund's adjuvant (IFA) mixes with recombiant protein, strengthens with same dosage, strengthens altogether twice.After final immunization 10 days, pluck
Eyeball takes blood, and the blood of collection is put after solidifying 2～3h in room temperature, 3000rpm, and 4 DEG C are centrifuged 10 minutes；Take supernatant again,
3000rpm, 4 DEG C are centrifuged 10 minutes.Collect serum subpackage.80 DEG C of preservations.
Embodiment 3
The structure of recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2
(1) according to the gene sequencing of α 1-giardin in Genbank data base, design synthesis specific primer, and in sequence
Row two ends introduce Hind III and EcoR I restriction enzyme site, all introduce protectiveness bases G C at restriction enzyme site two ends.
The primer of α 1-giardin:
α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)
α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)
(2) according to the gene order of Genbank data base giardia lamblia CWP2, its coded epitope is carried out point
Analysis, filters out one section containing 125 amino acid whose epi-positions.Design specific primer, introduces Hind III He simultaneously at sequence two ends
EcoR I restriction enzyme site, all introduces protectiveness bases G C at restriction enzyme site two ends.
The primer of CWP-2:
Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC(HindIII)
Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG(BamHI)。
(3) using the cDNA of giardia lamblia as template, carry out RT-PCR amplification and obtain purpose fragment, after enzyme action with as warp
PVAX1 carrier segments after Hind III and EcoR I double digestion is connected, construction recombination plasmid pVAX1-α 1-giardin and
PVAX1-CWP-2, Transformed E .coli DH5a, picking positive colony.Identify that correct recon is with electroporated side through order-checking
Formula proceeds to salmonella SL7207, builds restructuring salmonella vaccine.
Embodiment 4
The stability of recombinant bacterial strain Secondary Culture in vitro
Attenuation salmonella SL7207 is proceeded in order to detect recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 electricity
After stablize, in antibacterial, the situation of passing on, the recombinant attenuated Salmonella that will carry recombiant plasmid respectively is being trained containing kanamycin
Support base and cultivate 7 days without in kanamycin culture medium, taking equal-volume bacterium solution bed board counting every 12 hours, by counting two
Plant colony counts in culture medium and carry out computational stability.I.e. by the colony counts of growth in the culture medium containing kanamycin divided by not containing
The colony counts of growth in the culture medium of kanamycin, then it is converted into percentage ratio.
Experimental result is shown in Fig. 1, after display is cultivated 168 hours, has the plasmid of more than 90% to be still stable in the presence of restructuring and subtracts
In poison Salmonella.
Collect the recombinant bacterial strain cultivated latter 7 days, smear after PBS washing is centrifugal, close 30 minutes with 5% normal sheep serum,
Dripping 1:2000CWP-2 and α 1-giardin immunity rabbit anteserum respectively after PBS washing, 4 DEG C overnight；Dropping 1 after PBS washing:
200DyLightTMThe goat-anti rabbit fluorescence two of 488 labellings resists, and takes a picture at fluorescence microscopy Microscopic observation.Experimental result is shown in Fig. 2, aobvious
The expression of corresponding albumen is had in showing thalline.
More than test result indicate that, recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 electricity proceed to be attenuated sramana
Stably can pass in host bacteria after Salmonella SL7207, it is possible to stably express immunizing antigen α 1-giardin and
CWP-2。
Embodiment 5
The immune effect of recombinant bacterial strain
The Bivalent DNA Vaccine the most recombinant attenuated Salmonella somatic SL7207/pVAX1-α 1-of the Mouse oral present invention
After the 1:1 mixed vaccine immunity of giardin and SL7207/pVAX1-CWP-2, gather serum and the enteral irrigation liquid of mice, point
Not Jian Ce serum antibody IgG titer and enteral irrigation liquid total SIgA content with the change of immunization time, and immune mouse 7 weeks
Time mouse intestinal flushing liquor in anti alpha 1-giardin and the content of CWP-2 specificity SIgA.
Experimental result is shown in Fig. 3, Fig. 4 and Fig. 5.Fig. 3 shows the comparison relative to PVAX1/SL7207 and PBS
Group, the serum antibody IgG titer of the recombinant attenuated Salmonella immune mouse of the present invention significantly raise with immunization time and
Tended towards stability after 7 weeks.Fig. 4 shows that in the enteral irrigation liquid of the recombinant attenuated Salmonella immune mouse of the present invention, total SIgA contains
Amount is significantly higher than the matched group of PVAX1/SL7207 and PBS, and reaches peak value at about 11 weeks.Fig. 5 shows the restructuring of the present invention
Attenuation salmonella immune mouse when 7 weeks in enteral irrigation liquid the content of anti alpha 1-giardin and CWP-2 specificity SIgA show
Write the matched group higher than PVAX1/SL7207 and PBS.Above experimental result is unequivocally established through the Bivalent DNA Vaccine immunity of the present invention
Mice in serum and intestinal, create significant associated antibodies, show that the Bivalent DNA Vaccine of the present invention has clearly and shows
The immune effect write.
Embodiment 6
The internal field planting stability of recombinant bacterial strain
Existed by immunofluorescence test detection restructuring salmonella SL7207/pVAX1-α 1-giardin and pVAX1-CWP-2
The expression of results of mice mesenteric lymph node.
Exempt from oral recombinant attenuated Salmonella somatic SL7207/pVAX1-α 1-giardin and SL7207/pVAX1-CWP-2
After epidemic disease 7 weeks, gathering the mesentery tissue of mice, 10% formalin is fixed, paraffin embedding, and section carries out Immunofluorescence test.
One resists: 1:2000CWP-2 and α 1-giardin immunity rabbit anteserum.
Two resist: HRP-goat-anti rabbit anteserum.
Experimental result is shown in Fig. 3, shows that two kinds of destination protein α 1-giardin and CWP-2 are respectively at mice mesenteric lymph
Expressed in knot.This test result indicate that the Bivalent DNA Vaccine of the present invention realizes stablizing field planting in Mice Body.
Embodiment 7
The preparation of Bivalent DNA Vaccine enteric coated preparation
1. amplification cultivation: the recombinant attenuated Salmonella somatic SL7207/pVAX1-α 1-that the 1:1 of the present invention is mixed
Giardin and SL7207/pVAX1-CWP-2 carries out amplification cultivation and obtains the culture through amplification；
2. lyophilizing: take 150ml culture be centrifuged, to precipitation in add 5ml freeze drying protectant (5% defatted milk powder, 2.5%
Sucrose), lyophilizing 24h, obtain lyophilized powder；
3. grind: be mixed in lyophilized powder quantitative adjuvant (microcrystalline Cellulose, starch, differential silica gel, carboxymethyl starch sodium and
Magnesium stearate etc.), grind well and obtain grounds travel；
4. tabletting: weigh quantitative grounds travel, carries out antibacterial recombinant bacterium technology and viability examination, quantitatively presses according to technical result
Sheet (such as 1 × 105Individual antibacterial/sheet).
5. coating: weigh appropriate Opadry, adds in distilled water under high-speed stirred, makes the suspension that concentration is 20%,
Continuing stirring 2h, obtain coating solution, seed-coating machine revolution is adjusted to 40-50r/min, adds the tablet prepared, and regulates spray gun liquid-gas
Ratio, coating to tablet increases weight 6-8%；
Inspection the most entirely: randomly draw tablet and carry out disintegrate experiment and recombinant bacterium viability experiment, and storage temperature and shelf-life
Experiment
The most aluminum-plastic packaged.
Embodiment 8
The potency test of Bivalent DNA Vaccine enteric coated preparation
1.1-2 monthly age experimental dog, 20, about body weight 1.5kg.It is randomly divided into 4 groups, often group 5.0 day feeding of experimental group
Tablet (the dosage: 1 × 10 of the enteric coated preparation that embodiment 7 obtains5Individual antibacterial/sheet), within the 2nd week and the 6th week, same dosage strengthens one
Secondary.Matched group does not processes.After immunity 8 weeks, experimental group and the equal oral gavage of matched group pup 2 × 105On The Trophozoite of Giardia Lamblia.
2. within after Albendazole the 3rd day, start to gather Experimental puppies fresh excreta every day some, add the dilution of a certain amount of water
After, through 60 mesh screen filtration, filtrate is centrifuged 10min through 3000r/min, abandons supernatant, adds saturated solution of zinc sulfate and stir evenly in precipitation,
2500r/min is centrifuged 10min, takes suspension and dilutes with 4 times of water, and 3000r/min is centrifuged 10min, precipitation add tap water with above-mentioned from
The heart sedimentation method are washed 2 times repeatedly, and to wash away zinc sulfate, the constant volume that finally precipitation added water becomes 5mL, takes 1, dropping Lugol's iodine solution dye
After color, add coverslip and put 400 times of light Microscopic observations, check for giardia lamblia encapsulation, adhere to continuously 15 days, to determine infection feelings
Condition.There is encapsulation discharge person on inspection, be considered as infecting.Result of the test is shown in table 1.
The potency test of table 1 Bivalent DNA Vaccine oral enteric preparation
As seen from Table 1, the immune effect of the bivalent vaccine of the present invention is significantly better than and is used alone monovalent vaccine, and this
Bright Bivalent DNA Vaccine oral enteric preparation has significant immune effect.
Embodiment 9
The safety testing of vaccine enteric coated preparation
Take 6～8 week old BALB/c female mice 25, random packet, give the restructuring bacterium solution of various dose, observe mice
Untoward reaction, after 7 weeks put to death, mouse infection salmonella is evaluated.Except 1 dead (etiology unknown is true) in initial infection
In addition, other all do not find salmonella pathogenic manifestation.Take the liver of all experimental mouse, spleen, mesentery equal samples carry out pathology detection,
Pathological change without Salmonella infection.
This result of the test shows that the Bivalent DNA Vaccine enteric coated preparation of the present invention does not results in Salmonella infection and causes a disease, animal
Test proves safe.
The practicality of the present invention:
1. the control of human body giardiasis: giardia lamblia is world wide distribution, is the topmost intestinal causing intestinal infection
Road parasitic protozoa.Especially acquired immune deficiency syndrome (AIDS) or the patient of immunologic hypofunction, lethal can be caused to suffer from diarrhoea.The encapsulation of giardia lamblia is main
Polluted source, has the strongest resistance, and conventional filtration or chloridized can not kill the encapsulation of giardia lamblia.Animal sense
Dye source is the major reason causing human disease.Additionally, along with the development of tourist industry, the increase of movement of population, Albendazole
The trend substantially increased occurs.Therefore, the research and development of effective anti-giardia lamblia vaccine, for human body giardiasis control to close weight
Want.
2. the needs of animal husbandry development: giardia lamblia can infect 40 many animals, for typical zoonosis, are also in recent years
One of main parasitic parasitosis endangering our province animal husbandry development.May occur in which anorexia after zoogenetic infection giardia lamblia, suffer from diarrhoea and become thin
Etc. symptom, severe patient may result in death.Therefore, research and development can block giardiasis propagate live vaccine seem the most urgent.
For developing and blocking the live vaccine that giardiasis is propagated, the oral vaccine that development feeds with bait or feedstuff, it is clear that be
Plant simple and effective approach.
In view of giardia lamblia is for human health and the importance of animal husbandry development, the novel anti-giardia lamblia bivalence of the present invention
Succeeding in developing of DNA vaccination oral enteric preparation will welcome wide market.
Although the embodiment that disclosed herein is as above, but described content is only to facilitate understand the present invention and adopt
Embodiment, be not limited to the present invention.Technical staff in any the technical field of the invention, without departing from this
On the premise of spirit and scope disclosed by invention, in form and any amendment and change can be made in details implement,
But the scope of patent protection of the present invention, still must be defined in the range of standard with appending claims.
Claims (6)
1. the Bivalent DNA Vaccine being used for preventing human or animal's giardiasis, it is characterised in that by the two of giardia lamblia kinds of antigens
Gene α 1-giardin and CWP-2 insert respectively in eukaryotic vector pVAX1 obtain recombiant plasmid pVAX1-α 1-giardin and
PVAX1-CWP-2, is transported in Host Strains respectively by described recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2
To comprising recombiant plasmid pVAX1-α 1-giardin and the recombinant bacterium of recombiant plasmid pVAX1-CWP-2, described recombinant bacterium structure respectively
Becoming described Bivalent DNA Vaccine, wherein said antigen gene α 1-giardin is SEQ ID NO:1 sequence, described antigen gene
CWP-2 is SEQ ID NO:3 sequence；
Described Bivalent DNA Vaccine is prepared by following steps:
(1) using the cDNA of giardia lamblia as template, α 1-giardin and CWP-2 base are obtained by PCR amplification respectively
Because of fragment；
(2) by between HindIII and the BamHI site of described genetic fragment insertion vector pVAX1, pVAX1-α 1-is produced
Giardin and pVAX1-CWP-2 recombiant plasmid；
(3) recombiant plasmid pVAX1-α 1-giardin and pVAX1-CWP-2 in step 2 is transported in Host Strains respectively,
Comprised recombiant plasmid pVAX1-α 1-giardin and the recombinant bacterium of recombiant plasmid pVAX1-CWP-2, two kinds of recombinant bacteriums respectively
After equal proportion mixing, i.e. obtain described Bivalent DNA Vaccine；
Wherein, the primer used in PCR amplification is as follows:
The primer of α 1-giardin:
α 1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT, it is SEQ ID NO:5 sequence；
α 1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC, it is SEQ ID NO:6 sequence；
The primer of CWP-2:
Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC, it is SEQ ID NO:7 sequence；
Gl-CWP2-R5:CG GGATCC CCTTCTGCGGACAATAGGCTTG, it is SEQ ID NO:8 sequence.
2. as claimed in claim 1 for preventing the bivalent vaccine of human or animal's giardiasis, it is characterised in that described host
Bacterium is Attenuated Salmonella.
3. the enteric coated preparation being used for preventing human or animal's giardiasis, it is characterised in that described enteric coated preparation comprises such as power
Profit requires the Bivalent DNA Vaccine for preventing human or animal's giardiasis described in 1.
4. as claimed in claim 3 for preventing the enteric coated preparation of human or animal's giardiasis, it is characterised in that described enteric
Preparation is quantitatively preparation so that every part of enteric coated preparation comprises the recombinant bacterium of the described Bivalent DNA Vaccine of essentially identical amount.
5. as claimed in claim 4 for preventing the enteric coated preparation of human or animal's giardiasis, it is characterised in that described enteric
Preparation is prepared by the method comprised the following steps:
1) recombinant bacterium to described Bivalent DNA Vaccine carries out amplification cultivation and obtains culture；
2) by step 1) in the culture that obtains centrifugal after carry out lyophilizing and obtain lyophilized powder；
3) in step 2) lyophilized powder that obtains is mixed into quantitative adjuvant and grinds and uniformly obtain grounds travel；
4) step 3 is weighed) grounds travel that obtains carries out quantitative tabletting, it is ensured that and every tablet preparation contains the recombinant bacterium of essentially identical amount；
5) by step 4) the tablet enteric coating agents that obtains is coated.
6. as claimed in claim 5 for preventing the enteric coated preparation of human or animal's giardiasis, it is characterised in that described enteric
Preparation is prepared by the method comprised the following steps:
1) amplification cultivation: the recombinant bacterium of described Bivalent DNA Vaccine is carried out amplification cultivation and obtains the culture through amplification；
2) lyophilizing: be centrifuged by described culture, adds freeze drying protectant, lyophilizing 24h in centrifugation, obtains lyophilized powder, institute
State freeze drying protectant and comprise 5% defatted milk powder and 2.5% sucrose；
3) grind: in described lyophilized powder, be mixed into quantitative adjuvant, grind well and obtain grounds travel, described adjuvant selected from microcrystalline Cellulose,
Starch, differential dissipate silica gel, carboxymethyl starch sodium and magnesium stearate；
4) tabletting: weigh quantitative grounds travel, carries out quantitative tabletting according to antibacterial recombinant bacterium viability examination result, it is ensured that every contains
0.2～5 × 105Individual recombinant bacterium；
5) coating: weigh appropriate Opadry, adds in distilled water under high-speed stirred, makes the suspension that concentration is 20%, continues
Stirring 2h, obtains coating solution, and seed-coating machine revolution is adjusted to 40-50r/min, adds the tablet prepared, and regulates spray gun liquid-gas ratio
Example, coating to tablet increases weight 6-8%；
6) packaging.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410783255.XA CN104587458B (en) | 2014-12-04 | 2014-12-16 | The Bivalent DNA Vaccine of prevention giardiasis and enteric coated preparation thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410750945 | 2014-12-04 | ||
| CN2014107509455 | 2014-12-04 | ||
| CN201410783255.XA CN104587458B (en) | 2014-12-04 | 2014-12-16 | The Bivalent DNA Vaccine of prevention giardiasis and enteric coated preparation thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104587458A CN104587458A (en) | 2015-05-06 |
| CN104587458B true CN104587458B (en) | 2017-01-04 |
Family
ID=53113729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410783255.XA Expired - Fee Related CN104587458B (en) | 2014-12-04 | 2014-12-16 | The Bivalent DNA Vaccine of prevention giardiasis and enteric coated preparation thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104587458B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU3191495A (en) * | 1994-08-09 | 1996-03-07 | Nisshin Oil Mills, Ltd., The | Peroral immunogen composition and process for producing the same |
| CN101397571A (en) * | 2008-11-03 | 2009-04-01 | 济南登益得科贸有限公司 | Preparation of double promoter DNA anti-caries vaccine pCN-SSIE |
| WO2011079282A1 (en) * | 2009-12-23 | 2011-06-30 | Vaxgene Corporation | Immunoprotection by oral administration of recombinant lactococcus lactis mini-capsules |
| CN102512674B (en) * | 2011-12-20 | 2013-07-03 | 福州大学 | Fish broad-spectrum vibrio subunit vaccine and preparation method |
| CA3008794C (en) * | 2012-03-29 | 2021-03-16 | Therabiome, Llc | Gastrointestinal site-specific oral vaccination formulations active on the ileum and appendix |
-
2014
- 2014-12-16 CN CN201410783255.XA patent/CN104587458B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104587458A (en) | 2015-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gast et al. | Salmonella infections | |
| US8198067B2 (en) | Delivery of disease control in aquaculture and agriculture using microbes containing bioactive proteins | |
| CN105163752B (en) | Clay-ware and application thereof | |
| US7351527B2 (en) | Immunizing fish against viral infection | |
| TW201010717A (en) | Coccidiosis vaccines | |
| CN106011084B (en) | Porcine epidemic diarrhea virus place variant and its application | |
| CN105247043A (en) | Scale drop disease (SDD) causative virus and derivatives thereof | |
| CN105198989A (en) | Shewanella-smarisflavi-resistant egg yolk antibody and preparation method thereof | |
| CN106496325A (en) | A kind of microcapsule is coated the preparation method and application of anti-main pathogen of bovine mastitis yolk antibody IgY | |
| CN100412092C (en) | Bacillus coli resisting chicken yolk antibody, its preparation and use | |
| Dawood et al. | Brucellae as resilient intracellular pathogens: Epidemiology, host–pathogen interaction, recent genomics and proteomics approaches, and future perspectives | |
| CN109400705A (en) | A kind of anti-helicobacter pylori duck Yolk antibody and preparation method thereof | |
| KR20220167577A (en) | Vaccine composition for preventing or treating fowl typhoid and salmonellosis simultaneously comprising Salmonella gallinarum mutant expressing FliC-FimA-CD40L fusion antigen as effective component | |
| CN101269218A (en) | Fortifier, special bait, injection for bleeding disease immunity of Chinese idle and novel immunity method | |
| EP2113511A1 (en) | Dna vaccines for fish | |
| CN104587458B (en) | The Bivalent DNA Vaccine of prevention giardiasis and enteric coated preparation thereof | |
| Afifah et al. | Protective effects of immersion immunization of koi with Escherichia coli DH5α carrying DNA vaccine against koi herpesvirus | |
| CN109608541A (en) | A kind of anti-pig enterotoxigenic escherichia coli Yolk antibody and preparation method thereof | |
| CN106397602B (en) | A kind of reinforced chicken Marek's disease protein engineering vaccine of molecule adjuvant | |
| US20210252148A1 (en) | Composition and Methods for Preventing and Treating African Swine Fever in Wild and Domestic Swine | |
| CN103421729B (en) | Gene recombined swine cholera salmonella choleraesuis vaccine for blue-ear disease and application thereof | |
| KR101411995B1 (en) | Antibody composition of bovine colostrum for treating or preventing porcine wasting diseases | |
| KR101085667B1 (en) | Producing Method For Yolk Powder Having A Immuneantibody Of Duck Disease and Yolk Powder Using The Same | |
| CN104248761A (en) | Vaccine composition, and preparation method and application thereof | |
| Barbour et al. | Immunopotentiation of a developed Salmonella enterica serotype enteritidis vaccine by thymulin and zinc in meat chicken breeders |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170104 Termination date: 20201216 |