CN105247043A - Scale drop disease (SDD) causative virus and derivatives thereof - Google Patents

Scale drop disease (SDD) causative virus and derivatives thereof Download PDF

Info

Publication number
CN105247043A
CN105247043A CN201480031056.1A CN201480031056A CN105247043A CN 105247043 A CN105247043 A CN 105247043A CN 201480031056 A CN201480031056 A CN 201480031056A CN 105247043 A CN105247043 A CN 105247043A
Authority
CN
China
Prior art keywords
virus
fish
seqidno
gene
vaccine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201480031056.1A
Other languages
Chinese (zh)
Inventor
L.古伊伦
A.格鲁夫德
C.C.施里尔
L.格里塞兹
S.F.昌
M.米亚塔
C.M.霍伊克范德
M.德伊斯
K.S.吴
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intervet International BV
Original Assignee
Intervet International BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Intervet International BV filed Critical Intervet International BV
Priority to CN201910622924.8A priority Critical patent/CN110438090B/en
Publication of CN105247043A publication Critical patent/CN105247043A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/00021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/00022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/00034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/00051—Methods of production or purification of viral material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/00061—Methods of inactivation or attenuation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/00061—Methods of inactivation or attenuation
    • C12N2710/00063—Methods of inactivation or attenuation by chemical treatment

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oncology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Communicable Diseases (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to an isolated virus causing Scale Drop Disease in fish, to cell cultures comprising said virus, to vaccines on the basis of said virus and methods for the preparation of such a vaccine, to antibodies reactive with said virus, to diagnostic test kits for the detection of that virus and to uses of said virus.

Description

Scale comes off disease (SDD) Causative virus and derivative thereof
The scale of fish that causes that the present invention relates to separation comes off the virus of disease, relate to the cell culture comprising described virus, relate to the preparation method of vaccine based on described virus and such vaccine, relate to the antibody reacted with described virus, relate to the diagnostic test reagent box for detecting this virus, and relate to the purposes of described virus.
In many decades in the past, the violent increase that the visible fish of worldwide consume.This is equally about the consumption of cold water fish (such as salmon, flatfish, halibut and cod) and tropical fish (such as Asia jewfish (barramundi), tilapia, bango, amberjack, amberjack, cabrilla and cabio).Therefore, see the number of fish farm and the increase of size, to meet the market demand day by day increased.
As known by such as livestock industry, a large amount of animals be closely living together are subject to various sickness influence, or even the disease known hardly or do not see, or or even disease unknown before the large-scale commercial applications cultivation phase.This is applicable equally for fish farming.
In recent years, cultivation Asia jewfish (perch ( latescalcarifer)) in found a kind of new disease syndrome.The most notable feature of this disease is that scale comes off, and is therefore often referred to as " scale come off syndrome " (SDS).This disease of reported first in the Asia jewfish that Malaysian Penang (Penang) cultivates.The outburst of this new disease of later discovery also occurs in Singapore 2002,2006 and 2009.Nearer case was reported from the fish farm of Indonesia Bantam with again from Singapore in 2010, and in 2011 also from the fish farm of StraitsofMalaka.The sickness rate of this disease is current to be increased.
Gibson-Kueh, S., wait people (JournalofFishDiseases35; 19-27 (2012)) describe this disease syndrome recently.
This disease sees at first to grow up and raises in cages in fish, and also sees in the fry in nursery.Mortality ratio be described to chronic, delay, and to change between initial 30% to overall 75%.
Suffer the Major Clinical sign of this syndromic fish to be first that scale as above comes off, the eyes of lethargic sleep behavior and enlargement sometimes.Fish also demonstrates neuroscience sign sometimes: some affected fishes demonstrate spiral swimming, and may be due to the blood vessel injury in brain, it causes many focuses encephalomalacia.
The blood vessel endothelium sex change (vasculitis) of major histological sign specifically in all vitals (comprising skin).This vasculitis causes tissue necrosis, and it also affects gastric gland, spleen, kidney and heart.Also, as described in Gibson-Kueh, the corium covering scale bed is often downright bad, and comes off relevant with scale.
But, do not find the origin cause of formation of this disease.Gibson-Kueh claims, histopathology in sick fish and the large sexangle virus particle observed in the tissue and much smaller sexangle virus particle may point out the possibility of viral aetiology, but her conclusion is, generally, the virus particle number in the tissue checked is lower.Based on size and geometric, some virus particle of observing are similar to irido virus, but use anti-red-sea bream iridovirus (RedSeabreamIridovirus, RSIV) monoclonal antibody M10 (Nakajima, K. wait people, FishPathology30:115-119 (1995)) immunohistochemistry give negative findings.
Use the PCR of the RSIV primer of the large-scale known irido virus of known target to test and give also negative findings.
By make fish tissues and blue Grunt ( haemulonsciurusshaw) (GF) cell and Asia jewfish cells contacting carry out trial (people such as Chong, S., the SingaporeVet.J.1 of isolated viral; 78-89 (1987)) also not success.
In view of the virus-like particle of the very low number observed, Gibson-Kueh points out, and this disease may be the result of the immune allergy to virus antigen, instead of is caused by virus.Such as, such reaction is pointed out to be the origin cause of formation of the strawberry disease of salmon (salmonid).
In addition, vasculitis and relevant necrosis (it is the mark of SDS) are not common for Iris diseases.
In addition, the pathology seen in SDS is different from the pathology seen in irido virus disease in several.
Although there is above-mentioned trial, do not find viral origin, and even do not find the evidence that virus involves in, Gibson-Kueh is guided to the following explanation of the existence of the different virus of low number by this fact: " virus-like particle is difficult to find relatively.In addition, general irido virus disease is now l.calcariferlocal epidemic disease in fish farm, so their existence can be chancing on of common pathogenic agent ".
Because these reasons, the pathogenic agent of this disease is still completely not clear up to now.
An object of the present invention is, provide the pathogenic agent of this disease and with the vaccine of defeating this disease to be target.In addition, an object of the present invention is, the device detecting and differentiate described pathogenic agent is provided.
Determine now, the pathogenic agent of this disease is the icosahedron viruses with about 140nm diameter.
Find that this virus belongs to double-stranded DNA virus, and determined the major part of the DNA sequence dna of this virus now.
The contrast of other sequence in the sequence of this new virus and genome database unexpectedly discloses, at nucleotide level, this virus and iris Viraceae ( iridoviridae) virus although there is specific low similarity level, described iris Viraceae has icosahedron shape, has the size between 120-350nm and has the Viraceae of double-stranded gene group.
Owing to having identified now the pathogenic agent of this disease, this disease has no longer been referred to as scale in the de-scription and has come off syndrome, but be referred to as scale come off disease (SDD) ( vide infra).
The representative of this virus is deposited in CollectionNationaledeCulturesdeMicroorganisms (CNCM) under accession number CNCMI-4754, InstitutPasteur, 25RueduDocteurRoux, F-75724ParisCedex15, France.
Based on alignment, can the gene of identifier number major capsid protein and the gene of ATP enzyme of this virus of coding, itself and known iris Viraceae have certain similarity.
The example of the DNA sequence dna of the gene of coding major capsid protein and the gene of coding ATP enzyme is described in SEQIDNO:1 and SEQIDNO:3 respectively.SEQIDNO:2 represents the aminoacid sequence of major capsid protein.SEQIDNO:4 represents the aminoacid sequence of ATP enzyme.
5 genus are comprised: Ranavirus (Ranaviruses), enlargement cell virus (Megalocytiviruses), Lymphocystivirus (Lymphocystiviruses), Chloriridovirus belong to (Chloriridoviruses) and iridescent virus (Iridoviruses) (JunKurita and KazuhiroNakajima, Viruses4 before iris virus subject; 521-538 (2012)).
The paper of Kurita and Nakajima specifically show 55 summaries (in addition, with the addition of 3 ascovirus homologues as outgroup) belonged to amounted in the genealogical tree of 20 known species belonged to.This genealogical tree gives the instruction of reciprocal relative relation/distance not of the same race, and makes why each in these viruses to be classified as 5 member's imagerys one of to belong to.
Based on according to the MCP of the newfound SDD pathogenic agent of the present invention and ATP enzyme DNA sequences encoding, the genealogical tree (based on adjacent method) made new advances can be done, and certain finding MCP and ATP display in encoding sequence and the genealogical tree of iris Viraceae mates.
Service routine MEGA, 5th edition, use standard configuration, make these tree (MEGA5:MolecularEvolutionaryGeneticsAnalysisUsingMaximumL ikelihood, EvolutionaryDistance, andMaximumParsimonyMethods. bright and beautiful carp chiroTamura, DanielPeterson, NicholasPeterson, GlenStecher, MasatoshiNei and SudhirKumar.Mol.Biol.Evol.28 (10): 2731-2739.2011doi:10.1093/molbev/msr121AdvanceAccesspubl ication, on May 4th, 2011).
Based on the Genome Size between the icosahedron shape of this new virus, 120-350nm and double-stranded gene group, and (use MEGA5 to obtain based on the adjacent tree of major capsid protein, it has the statistics support of the robustness of the branching pattern of instruction inference, as used bootstrapping testing evaluation), contriver thinks that this virus is a member of iris Viraceae.
Tree based on MCP sequence is described in fig. 8.Tree based on ATP enzyme sequence is described in fig .9.
Very surprisingly, based on the distance of it and 5 known genera, any one during the pathogenic agent of newfound SDD seems do not have coupling 5 to belong to, as can be readily seen that from Fig. 8.
Thus, based on its major capsid protein and the DNA sequences encoding of its ATP enzyme, can especially the known member of this virus and iris Viraceae be distinguished.
Verified, there is according to the major capsid protein of virus of the present invention and the immediate MCP in other kind of even iris Viraceae the sequence iden level of only 65%.
The immediate ATP enzyme of other kind of ATP enzyme and iris Viraceae has the sequence iden level of only 68%.
Use major capsid protein and ATP enzyme DNA sequences encoding, develop the primer to virus-specific according to the present invention.
SEQIDNO:1 shows the usual example of coding according to the nucleotide sequence of the gene of the major capsid protein of virus of the present invention.
Should be appreciated that, for the concrete albumen comprised herein, natural variation may reside between each representative of described pathogenic agent.The heritable variation of the subtle change in such as major capsid protein sequence is caused really to exist.This is same applicable for ATP enzyme.First, exist so-called " the second and the 3rd waving in base ", it explains Nucleotide change and may occur, and it is not noticeable in the aminoacid sequence of their codings: such as triplet TTA, TTG, TCA, TCT, TCG and TCC all encode leucine.In addition, the Minor variations between can seeing in aminoacid sequence according to the representative of SDD virus of the present invention.These variations can be reflected by the one or more amino acid differences in whole sequence, or by the one or more amino acid whose disappearance in described sequence, displacement, insertion, inversion or interpolation reflection.Described the amino-acid substitution that substantially can not change biological activity and immunologic competence, the people such as such as Neurath are in " TheProteins " AcademicPressNewYork (1979).Amino-acid substitution between relevant amino acid or in evolution frequently occur replacement especially Ser/Ala, Ser/Gly, Asp/Gly, Asp/Asn, Ile/Val (see Dayhof, M.D., Atlasofproteinsequenceandstructure, Nat.Biomed.Res.Found., WashingtonD.C., 1978,5th volume, supplementary issue 3).Other amino-acid substitution comprises Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Thr/Phe, Ala/Pro, Lys/Arg, Leu/Ile, Leu/Val and Ala/Glu.Based on this information, Lipman and Pearson develops a kind of for quick and sensitive albumen contrast (Science227,1435-1441,1985) and the method determining the functional similarity between homologous protein.This kind of amino-acid substitution of exemplary of the present invention and there is disappearance and/or the variation of inserting is within the scope of the present invention.
This explains why MCP and ATP enzyme (when being separated in time representing according to the difference of SDD virus of the present invention) may have significantly lower than 100% homology level, but still represent MCP or the ATP enzyme of the SDD virus pathogenic agent of disease (scale come off).
This is reflected in Fig. 4 of the paper of such as Kurita and Nakajima significantly, wherein show, even if in the lymphocyte virus genus that the lymphocyst disease virus (LCDV) by height correlation forms, all LCDV still have significantly different MCP aminoacid sequences.
Thus, first embodiment of the present invention relates to a kind of virus of separation, and it is a member of the iris Viraceae comprising MCP gene and ATP enzyme gene, it is characterized in that:
A) described virus is that the scale of fish comes off the pathogenic agent of disease, and
B) nucleotide sequence and the nucleotide sequence described in SEQIDNO:1 of MCP gene have the identity level of at least 80%.
With regard to object of the present invention, the sequence that identity level is interpreted as SEQIDNO:1 and the identity level of corresponding zone of major capsid protein of virus that its identity level must be determined.
For determining that the suitable procedure of identity level is the Nucleotide blast program (blastn) of NCBI ' sBasicLocalAlignmentSearchTool, its use " comparison 2 or more sequence " option and standard configuration (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
With regard to object of the present invention, separation refers to: depart from described virus at the adjoint tissue of occurring in nature.An example of the virus be separated is the virus be present in cell culture.
A kind of preferred form of this embodiment relates to the virus with major capsid protein (MCP) gene, the nucleotide sequence of the MCP shown in described major capsid protein (MCP) gene and SEQIDNO:1 has the identity level of at least 82%, more preferably 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100%, with this priority ranking.
Characterize the sequence relating to the ATP enzyme of described virus according to the another kind of optional manner of virus of the present invention.
SEQIDNO:3 shows a usual example of the nucleotide sequence of the ATP enzyme gene according to virus of the present invention.But, as explained above, found the natural variation of the subtle change causing ATP enzyme sequence.
Thus, the another kind of form of this embodiment of the present invention relates to a kind of virus of separation, and it is a member of the iris Viraceae comprising MCP gene and ATP enzyme gene, it is characterized in that:
A) described virus is that the scale of fish comes off the pathogenic agent of disease, and
B) nucleotide sequence and the nucleotide sequence described in SEQIDNO:3 of ATP enzyme gene have the identity level of at least 80%.
A kind of preferred form of this embodiment relates to a kind of virus with ATP enzyme gene, described ATP enzyme gene has the identity level of at least 82% with the nucleotide sequence of the ATP enzyme gene described in SEQIDNO:3, more preferably 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100%, with this priority ranking.
The one of this embodiment more preferably form relates to according to virus of the present invention, nucleotide sequence and the nucleotide sequence described in SEQIDNO:1 of wherein said MCP gene have the identity level of at least 80%, and the nucleotide sequence of described ATP enzyme gene has the identity level of at least 80% with the nucleotide sequence described in SEQIDNO:3.
Characterize and depend on that PCR tests according to the also another kind of optional manner of virus of the present invention, its use is to the major capsid protein gene sequence of virus according to the present invention or the specific primer set of ATP enzyme gene order.For they specificitys to described virus, have selected 3 different primer sets, its sequence is depicted in SEQIDNO:5-6, SEQIDNO:7-8 and SEQIDNO:9-10.
Use the PCR of the first primer set (SEQIDNO:5-6) reacted specifically with the major capsid protein gene of described virus to test and utilize two kinds of primer SDD-50-FW:CAGTGCATTACAAGAAAG and SDD-213-REV:GCTGAAACAACAATTTAG.
Use the PCR of the second primer set (SEQIDNO:7-8) also reacted specifically with the major capsid protein gene of described virus to test and utilize two kinds of primer SDD-MCP-277-FW:TCCTGTGCAGCTGTCTAAAC and SDD-MCP-1090-REV:ACTGGCAATGATGGGCGATG.
The PCR experiment of the three-primer set (SEQIDNO:9-10) of reacting with the ATP enzyme gene specific ground of described virus is used to utilize two kinds of primer SDD-ATP enzyme-65-FW:TCGGAGGGATGAAATTGG and SDD-ATP enzyme-618-REV:AGCGTTGTCGATGTAGAG.
The test described in more detail in embodiment part is Standard PC R test.
If the analysis of the PCR primer of the first primer set discloses the PCR primer of about 164 base pairs, if or the analysis of the PCR primer of the second primer set discloses the PCR primer of about 814 base pairs, if or the analysis of the PCR primer of three-primer set discloses the PCR primer of about 554 base pairs, and described virus is scale comes off the pathogenic agent of disease, so this confirms undoubtedly, and the virus analyzed belongs to according to virus of the present invention.
As just an example: the PCR primer of about 164 base pairs is the PCR primer of the length had between 164+10 and 164-10 base pair.The PCR primer of about 814 base pairs is the PCR primer of the length had between 814+10 and 814-10 base pair.
Therefore, the another kind of form of this embodiment of the present invention relates to a kind of virus of separation again, and it is a member of the iris Viraceae comprising MCP gene and ATP enzyme gene, it is characterized in that:
A) described virus is that the scale of fish comes off the pathogenic agent of disease, and
B) described viral DNA reacts the PCR primer to produce 164 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:5 and 6, or the PCR primer of reacting with the primer set described in SEQIDNO:7 and 8 in PCR reaction to produce 814 ± 10 base pairs, or in PCR reaction, react the PCR primer to produce 554 ± 10 base pairs with the primer set described in SEQIDNO:9 and 10.
A kind of preferred form of this embodiment relates to according to virus of the present invention, wherein said viral DNA reacts the PCR primer to produce 164 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:5 and 6, and the PCR primer of reacting with the primer set described in SEQIDNO:7 and 8 in PCR reaction to produce 814 ± 10 base pairs, and in PCR reaction, react the PCR primer to produce 554 ± 10 base pairs with the primer set described in SEQIDNO:9 and 10.
The one of this embodiment more preferably form relates to according to virus of the present invention, nucleotide sequence and the nucleotide sequence described in SEQIDNO:1 of wherein said MCP gene have the identity level of at least 80%, and the nucleotide sequence of described ATP enzyme gene has the identity level of at least 80% with the nucleotide sequence described in SEQIDNO:3, and wherein said viral DNA reacts the PCR primer to produce 164 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:5 and 6, and the PCR primer of reacting with the primer set described in SEQIDNO:7 and 8 in PCR reaction to produce 814 ± 10 base pairs, and the PCR primer of reacting with the primer set described in SEQIDNO:9 and 10 in PCR reaction to produce 554 ± 10 base pairs.
Can be form, the attenuated forms thereof of work or the form of deactivation of living according to virus of the present invention.
As noted above, the DNA sequence dna of the encode MCP of described virus and the gene of ATP enzyme has been characterized now.
The Chang Youyong's that discerns between right and wrong of these genes, because they can be used in DNA-vaccine now, for the expression of these albumen, with for diagnostic purpose, as explained widely below.
Therefore, another embodiment of the invention relates to the DNA fragmentation of the gene comprising coding major capsid protein, it is characterized in that, described gene has the identity level of at least 80% with the nucleotide sequence of the MCP gene described in SEQIDNO:1.
A kind of preferred form of this embodiment relates to such DNA fragmentation comprising gene, described gene has the identity level of at least 82% with the nucleotide sequence of the MCP described in SEQIDNO:1, more preferably 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100%, with this priority ranking.
Another embodiment of the invention relates to the DNA fragmentation of the gene comprising coding ATP enzyme, it is characterized in that, described gene has the identity level of at least 80% with the nucleotide sequence of the ATP enzyme gene described in SEQIDNO:3.
A kind of preferred form of this embodiment relates to such DNA fragmentation comprising gene, described gene has the identity level of at least 82% with the nucleotide sequence of the ATP enzyme described in SEQIDNO:3, more preferably 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100%, with this priority ranking.
Another embodiment of the invention relates to a kind of major capsid protein, it is characterized in that, this MCP is encoded according to the DNA fragmentation of coding major capsid protein of the present invention by coding.
This kind of MCP according to virus of the present invention is most suitable, because they are suitable in vaccine, and they make diagnostic test become possibility, as explained below.
A kind of preferred form of this embodiment relates to the MCP with the aminoacid sequence described in SEQIDNO:2.
Another embodiment more of the present invention relates to ATP enzyme, it is characterized in that, described ATP enzyme is encoded by the DNA fragmentation of coding ATP enzyme according to the present invention.
This kind of ATP enzyme according to virus of the present invention is most suitable, particularly because they make diagnostic test become possibility, as explained below.
A kind of preferred form of this embodiment relates to the ATP enzyme with the aminoacid sequence described in SEQIDNO:4.
A kind of preferred form of this embodiment relates to the ATP enzyme with the aminoacid sequence described in SEQIDNO:4.
Authenticated several fry cell system of copying that can support according to virus of the present invention now.
May be used for the clone that cultivation is the brain cell deriving from Asia jewfish according to an example of the clone of virus of the present invention.The people such as Hasoon have specifically described the method being separated such clone in InVitroCell.Dev.Biol.-Animal47:16-25 (2011).
May be used for cultivating and under accession number CNCMI-4755, be deposited in CollectionNationaledeCulturesdeMicroorganisms (CNCM) according to another example of the clone of virus of the present invention, InstitutPasteur, 25RueduDocteurRoux, F-75724ParisCedex15, France.
Thus, another embodiment more of the present invention relates to the cell culture comprising virus, and wherein said cell culture comprises according to virus of the present invention.
Since had been found that the origin cause of formation of this disease and can confirm that there is viral origin, this disease can be induced wittingly and in fact can induce the usual sign of above-mentioned disease in healthy fish, as detail display in embodiment part.
Still, described pathogenic agent is now known to one of advantage of the present invention, and the exploitation of vaccine has become feasible.
Thus, another embodiment of the invention relates to for defeating the scale of fish to come off the vaccine of disease, and wherein such vaccine comprises according to virus of the present invention and pharmaceutically acceptable carrier.
Defeat and should explain in a broad sense in this respect: think and defeat the scale disease that comes off to comprise to prevent this disease and vaccination, in order to reduce the sign of this disease and vaccination, and after diagnosing out this disease vaccine therapy vaccine.
With regard to vaccine object, preferably in serology, anti-SDD virus antisera reacts or reacts with the antiserum(antisera) that the virus for preservation produces described virus with covalescent.
Serological reaction should be explained in a broad sense: think that serological reaction is the reaction in standard serological test (such as ELISA test).
The example being suitable for use in the pharmaceutically acceptable carrier in vaccine used according to the invention is sterilized water, salt solution, aqueous buffer solution such as PBS etc.In addition, other additive as described below can be comprised according to vaccine of the present invention, such as adjuvant, stablizer, antioxidant and other.
Can comprise in attenuated live form according to vaccine of the present invention or deactivated form according to virus of the present invention.
The live-virus vaccine of attenuation, namely comprises the vaccine according to virus of the present invention of attenuated forms thereof alive, has the following advantages compared with inactivated vaccine: they imitate natural infection approach best.In addition, their replication allows inoculation virus in a small amount; Their number will automatically increase, until it reaches immune activation levels.From this moment, immunity system will be triggered and finally eliminate virus.
But a minor drawback of the application of attenuated virus of living may be remain the virulence of certain level inherently.This is real shortcoming not necessarily, as long as virulence level is acceptable, as long as namely vaccine at least stops fish dead.Certainly, the residue virulence of attenuated vaccine of living is lower, in vaccination/and impact that later vaccine inoculation increases weight is less.
Attenuated virus of living is the virus of the virulence level compared with the virus be separated from field with reduction.As mentioned above, the virulence being separated the virus from field is relatively high; Mortality ratio exceedes 30% of all infected fishes usually.The virus with the virulence level of reduction is considered the virus that only induced disorders reaches the degree of the mortality ratio being no more than 10%, and 90% in all infected fishes or more lives through infection.
Therefore, a kind of preferred form of this embodiment of the present invention relates to the vaccine comprised according to virus of the present invention, and wherein said virus is in attenuated forms thereof of living.
Attenuated virus can such as pass through to obtain as follows: cultivate according to virus of the present invention under having mutagenic compound to exist, and selects the virus demonstrating the decline of offspring's level and/or the decline of reproduction speed subsequently.Much such reagent is known in the art.
The another kind of method very often used is continuous subculture in vitro separately.Virus has adapted to the clone for continuous passage subsequently, makes them have the performance of attenuation when being again transferred to natural host as vaccine.
The also another kind of mode obtaining attenuated virus is, at the temperature of Natural habitat temperature departing from them, make them grow.The system of selection of temperature-sensitive mutant (Ts-mutant) is well-known in the art.Such method has been included under mutagenic compound exist and has cultivated virus, cultivate subsequently, titration progeny virus on cellular layer, and vision selects those plaques of growing more slowly in optimum temps at suboptimal temperatures with in optimum temps.That little plaque like this comprises slowly growth and thus expect attenuated virus alive.
Compared with their attenuation homologue alive, inactivated vaccine is safe inherently, because its residual residue virulence.Although in fact they often comprise the virus of a little more high dosage compared with the attenuated vaccine that lives, they can be such as the preferred forms of the vaccine suffered in the fish of Other diseases.The fish be maintained under Second Optimal Condition (such as incomplete nutrition or suboptimal temperatures) also can benefit from inactivated vaccine.
Therefore, the another kind of preferred form of this embodiment relates to the vaccine comprised according to virus of the present invention, and wherein said virus is in deactivated form.
Many physics and chemistry methods by inactivation of virus are known in the art now.The example of physical deactivation is uv-radiation, x-ray radiation, γ-radiation and heating.The example of deactivation chemical substance is-propiolactone, glutaraldehyde, ethyleneimine and formaldehyde.Technician knows how to apply these methods.
Preferably, use-propiolactone, glutaraldehyde, ethyleneimine or formalin-inactivated virus.Obviously, other is also comprised in the present invention by the mode of inactivation of virus.
In principle, the standard method preparing the vaccine of the irido virus based on deactivation is equally applicable to according to virus of the present invention.As just an example: the people such as ZhengliangOu-yang have specifically described the method for preparation based on the vaccine of the complete Singapore grouper irido virus of deactivation in DevelopmentalandComparativeImmunology38:254-261 (2012).
In addition, in embodiment part below, the embodiment of preparation based on the method for the vaccine of inactivation of viruses according to the present invention is presented.
Another method of SDD is defeated to be use subunit vaccine.Such vaccine does not comprise totivirus, but only comprises one or more antigen components of virus.
Subunit vaccine has the following advantages: for their preparation, does not need to cultivate virus.By the DNA of this subunit of clones coding in expression system, be enough to express the subunit selected.
Find according to the MCP of virus of the present invention it is a kind of very relevant immunogenic protein.
Its known member obviously and in iris Viraceae has this feature.QiWeiQin (J.VirologicalMethods106:89-96 (2002)) confirms the immunogenicity cognation of the MCP of the ocean irido virus from cabrilla.In recent years; the people such as XiaozheFu confirm the protective immunity for irido virus disease in mandarin fish (mandarinfish), and it induces (FishandShellfishImmunology33:880-885 (2012)) by the restructuring MCP of infectious spleen and kidney necrosis virus.The people such as ZhengliangOu-yang (VeterinaryImmunologyandImmunopathology149:38-45 (2012)) describe based on intestinal bacteria ( e.coli) in the vaccine inoculation of MCP expressed.They use restructuring MCP albumen (50 micrograms of protein) to be protected significantly.
The people such as YutakaTamaru (Biotechn.Prog.22:949-953 (2006)) are specifically described for the Orally administered vaccine based on MCP of fish.Which describe the expression of MCP in yeast cell surface of porgy (RedSeaBream) irido virus, the basis that the oral vaccine for irido virus as fish is inoculated.
In addition, in many textbooks, give the more general guide in field of protein expression.The handbook provided about the extensive information of the expression in bacterial expression system is such as: RichardH.Baltz (chief editor), ArnoldL.Demain (chief editor), JulianE.Davies (chief editor), manualofIndustrialMicrobiologyandBiotechnology, the 3rd edition, ISBN:978-1-55581-512-7, PeterE.Vaillancourt, e.coligeneexpressionprotocols, see MethodsinMolecularBiology205ISBN:1-58829-008-5, S.J.Higgins and B.D.Hames, proteinexpression:apracticalapproach, ISBN:0-19-963624-9, Fran oisBaneyx, proteinexpressiontechnologies:currentstatusandfuturetren ds, 2004, O ' Reilly, the people such as D, baculovirusexpressionvectors; Alaboratorymanual, OxfordUniversityPress1994, ISBN0-19-509131-0, and GerdGellissen, productionofrecombinantproteins:novelmicrobialandeukaryo ticexpressionsystems, ISBN:3-527-31036-3.
Thus, the third preferred form of this embodiment of the present invention relates to for defeating the scale of fish to come off the vaccine of disease, and wherein said vaccine comprises according to major capsid protein of the present invention and pharmaceutically acceptable carrier.
Finally, confirm that the DNA fragmentation comprising MCP gene order of the present invention is suitable for use in DNA vaccination very much.
ZhengliangOu-yang (VeterinaryImmunologyandImmunopathology149:38-45 (2012)) is specifically described such DNA fragmentation, and it is included in the DNA of the MCP-gene of the Singapore's grouper irido virus in carrier for expression of eukaryon.They realize the protection infected for Singapore's grouper irido virus together with the initiation-strengthening scheme of the vaccine inoculation by 30 micrograms of DNA.
The people such as Caipang, C.M.A. (FishandShellfishImmunology21:130-138 (2006)) confirm and use DNA vaccination for red-sea bream iridovirus to the sane protection of porgy.They use DNA vaccination, its be included in cytomegalovirus immediately/early stage enhanser promotor control under the MHC-gene of RSIV.
Thus, 4th kind of preferred form of this embodiment of the present invention relates to for defeating the scale of fish to come off the vaccine of disease, wherein said vaccine comprises DNA fragmentation and pharmaceutically acceptable carrier, and described DNA fragmentation comprises the gene of coding according to major capsid protein of the present invention.
If virus according to the present invention is used as the vaccine component of Orally administered (such as by dipping or balneation), often do not need to use adjuvant.
But if enter in fish by vaccine product direct injection, the application of adjuvant is optional.
Especially, when the virus component in vaccinate is in deactivated form, the interpolation of adjuvant may be preferred.
Generally speaking, in order to reinforced immunological response, described vaccine can comprise multiple adjuvant, especially when described preparation is intended for injection.
Adjuvant is the immunostimulation material strengthening the immunne response of host in nonspecific mode.Described adjuvant can be hydrophilic adjuvant, such as aluminium hydroxide or aluminum phosphate, or hydrophobic adjuvant, such as, based on the adjuvant of mineral oil.The oligonucleotide of adjuvant such as Romurtide, avidin, aluminium hydroxide, aluminum phosphate, oil, oil-emulsion, saponin(e, T 500, dextran, cytokine, segmented copolymer, immunostimulating and other adjuvant known in the art can be mixed together with virus according to the present invention.Romurtide, lipopolysaccharides, several dextran and glycan and Carbopol (a kind of homopolymer) through being commonly used in the example of the adjuvant in fish vaccine.Suitable adjuvant is the two emulsion of such as water-in-oil (w/o) emulsion, o/w emulsion and w/o/w.The oily adjuvant be suitable for use in w/o emulsion is such as mineral oil or metabolizable oil.Mineral oil is such as Bayol, Marcol and Drakeol; Metabolizable oil is such as vegetables oil, such as peanut oil and soybean oil, or animal oil such as fish oil, squalane and squalene.Alternatively, EP382 can be used advantageously in, vitamin-E (tocopherol) Solubilizates (solubilisate) described in 271.Most suitable o/w emulsion such as obtains from 5-50%w/w aqueous phase and 95-50%w/w oil adjuvant, more preferably uses 20-50%w/w aqueous phase and 80-50%w/w oil adjuvant.The character that the amount of the adjuvant added depends on adjuvant itself and the information about such amount will provided by manufacturer.
Another example of non-mineral oil adjuvant is such as Montanide-ISA-763-A.
An example based on the nano particle adjuvant of water is such as Montanide-IMS-2212.
The extensive overview ot of the adjuvant being suitable for fish and shellfish vaccine is given in the review paper of JanRaa (ReviewsinFisheriesScience4 (3): 229-288 (1996)).
Thus, relate to according to a kind of preferred form of vaccine of the present invention the vaccine comprising adjuvant.
Especially, when it comprises attenuated virus alive, vaccine according to the present invention comprises stablizer in addition.Stablizer can be added according in vaccine of the present invention, such as, to protect it to avoid degraded, to increase the shelf-life, or to improve lyophilize efficiency.Useful stablizer is the SPGA (people such as Bovarnik specifically, 1950, J.Bacteriology, 59th volume, 509th page), skimmed milk, gelatin, bovine serum albumin, carbohydrate such as sorbyl alcohol, N.F,USP MANNITOL, trehalose, starch, sucrose, dextran or glucose, lactose, albumen such as albumin or casein or its degraded product and buffer reagent, such as alkali metal phosphate.In order to reconstruct cryodesiccated composition, it is suspended in physiologically acceptable thinner.Such thinner can be such as simple as the sterilized water or physiological salt solution.In more complicated form, can cryodesiccated vaccine be suspended in emulsion, such as, as at EP1,140, described in 152.
Microbiotic such as Liu Suanyan NEOMYCIN SULPHATE and Streptomycin sulphate can be added to stop the potential growth of bacterium (germ).
In addition, described vaccine can comprise one or more suitable surface active cpd or emulsifying agents, such as Span or tween.Described vaccine also can comprise so-called " vehicle ".Vehicle is the compound accompanying by virus of the present invention, and not covalently in conjunction with it.Such vehicle is bio-microcapsule, micro--alginates, liposome and macromolecular complex (macrosol) specifically, is all known in the art.Vectorial a kind of special shape is like this ISCOM.Self-evident, other stablizer, carrier, thinner, emulsion etc. are mixed also within the scope of the present invention with vaccine according to the present invention.Such additive is such as described in well-known handbook, such as: " Remington:thescienceandpracticeofpharmacy " (2000, Lippincot, USA, ISBN:683306472), and: " Veterinaryvaccinology " (people such as P.Pastoret compiles, 1997, Elsevier, Amsterdam, ISBN:0444819681).
For by vaccine administration according to the present invention to the dosage regimen of target organism being the application of single or multiple dosage, it can or use successively simultaneously, in the mode compatible with preparation with dosage and with by amount effectively such in immunology.
Form effect and the target organism of depending on expectation according to the amount of " the immunogenicity significant quantity " of vaccine of the present invention, described vaccine is based on virus according to the present invention (or the subunit of such as described virus, such as DNA vaccination of MCP or coding MCP).Term used herein " immunogenicity significant quantity " to refer to that in fish induce immune response is necessary according to immunogenic virus of the present invention (or the subunit of such as described virus, such as MCP or coding MCP DNA vaccination) amount, described immunne response reaches it and alleviates the degree being infected the pathology effect caused by wild-type SDD virus (SDDV), described in alleviate be infect relative to wild-type SDDV in non-immune fish the pathology effect caused.
Determine whether treat is the ability that " effective in immunology " belongs to technician completely, such as, use Experimental challenge by giving vaccinated animal to infect, next the Disease Clinical sign of target animals, serology parameter is determined, or by measuring the separation again of pathogenic agent, subsequently these are found with the fish infected in the wild in observe those find to contrast.
The amount of the virus used will depend on the existence of route of administration, adjuvant and use opportunity.
Such as Tissue Culture Infective Dose (TCID50) is expressed as according to the preferred amounts of the living vaccine of virus of the present invention by comprising.Such as, for live virus, 1-10 can be used advantageously in 10dosage range between TCID50/ animal dosage; Preferably use 10 2-10 6scope between TCID50.
Can apply many methods of application, be all known in the art.Preferably by injection (intramuscular or via intraperitoneal routes), dipping (immersion), immerse (dipping) or oral will vaccine administration according to the present invention to fish.According to standard vaccine inoculation practice, application program can be optimized.
If vaccine comprises according to inactivation of viruses of the present invention, dosage can be expressed as the number of the virion that will use.Compared with the using of live virus particle, described dosage is often slightly high, reaches to a certain degree because live virus particle copied before being removed by immunity system in target animals.For the vaccine based on inactivation of viruses, about 10 4-10 9the amount of the virion in individual granulometric range is often suitable, depends on the adjuvant of use.
If vaccine comprises subunit, such as, according to MCP of the present invention, dosage will be expressed with micrograms of protein.For the vaccine based on subunit, suitable dosage is often in the scope between 5-500 micrograms of protein, depends on the adjuvant of use.
If vaccine comprises the DNA fragmentation of the gene containing coding major capsid protein, dosage will be expressed with micrograms of DNA.For the vaccine based on subunit, suitable dosage is often in the scope between 5-500 micrograms of DNA, depends on the efficiency of the expression plasmid of use particularly.In many cases, the amount between every bar fish 20-50 g plasmid is enough for effective vaccine inoculation.
Can in any form met the following conditions according to vaccine of the present invention: be suitable for using under the background of aquaculture, and the route of administration expected of coupling and intended effect.The mode commonly used by technician is prepared according to vaccine of the present invention.
Preferably, prepare according to vaccine of the present invention with the form (such as suspension, solution, dispersion, emulsion etc.) being suitable for injecting or flooding vaccine inoculation.
When using inactivated virus vaccine or subunit vaccine, it is a kind of attractive method of application that intraperitoneal is used.Particularly when intraperitoneal is used, the existence of adjuvant will be preferred.But this vaccination approach is more manually more intensive than such as impregnating route of administration.
In order to easily use vaccine, oral and dipping vaccination approach is preferred.
For Orally administered, preferably by vaccine be used for Orally administered suitable carrier and mix, the difference oil of described carrier and Mierocrystalline cellulose, food or metabolizable material such as alpha-cellulose or plant or animal origin.Also have a kind of attractive method to be that vaccine administration is biological to the living feed of high density, subsequently living feed biology is fed to fish.That can to encapsulate the living feed of vaccine biological for oral delivery according to the particularly preferred food carrier of vaccine of the present invention.Suitable living feed biology comprises the nonselective filter feeder of planktonic organism sample (filterfeeder), preferred wheel animalcule, halogen worm ( artemia), copepodite, algae etc. member.
The age wanting vaccinated fish is not vital, but obviously, people wish at stage (namely before may being exposed to pathogenic agent) vaccination of fish vaccine as far as possible early in case SDD virus infection.
Dipping vaccine inoculation is the vaccine inoculation of candidate, particularly when fish is still less, such as, lower than 5 grams.If necessary or expect, also can by means of being administered to 5 grams and above fish vaccination.
In addition, in those skilled in the art's information that can provide in above mentioned reference and below, (particularly in an embodiment) finds enough guidances.
Survey article about fish vaccine and their preparation is disclosed in particularly: Sommerset, I., Kross y, B., Biering, E. and Frost, P. expertReviewofVaccines4:89-101 (2005), Buchmann, K., Lindenstr m, T. and Bresciani, j.ActaParasitologica46:71-81 (2001), Vinitnantharat, S., Gravningen, K. and Greger, E. advancesinveterinarymedicine41:539-550 (1999), and Anderson, D.P. developmentsinBiologicalStandardization90:257-265 (1997).
In addition, skilled practitioner can find sufficient guidance in the following embodiments.
Obviously, SDD virus is far from unique fish disease substance: commercially important warm water fish disease pathogenic micro-organism and virus example be Vibrio anguillarum ( vibrioanguillarum), Mermaid luminous bacillus ( photobacteriumdamsela) kill fish subspecies, tenacibaculummaritimum, Flavobacterium kind ( flavobacteriumsp.), Flexibacter kind ( flexibactersp.), streptococcus kind ( streptococcussp.), Lactococcus garvieae ( lactococcusgarvieae), Edwardsiella tarda ( edwardsiellatarda), Edwardsiella ictaluri ( e.ictaluri), viral nervous necrosis poison, except virus according to the present invention, have irido virus and the Koi herpesvirus of many features with iris Viraceae.
Thus; it is advantageous that vaccine according to the present invention and other fish disease pathogenic micro-organism of at least one or virus and/or at least one immunogenic components and/or the genetic material of other immunogenic components described in this other fish disease pathogenic micro-organism or virus of encoding combines: once then independent vaccine inoculation can protect the infection avoiding SDD virus infection and this other fish disease pathogenic micro-organism or virus.
Therefore, a kind of preferred form of this embodiment relates to according to vaccine of the present invention, wherein this vaccine comprise at least one other immunogenic components and/or the genetic material of other immunogenic components described of antigen or coding fish disease pathogenic micro-organism or virus.
Preferably, described fish disease pathogenic micro-organism or fish pathogenic virus are selected from Vibrio anguillarum, Mermaid luminous bacillus kills fish subspecies, tenacibaculummaritimum, Flavobacterium kind, Flexibacter kind, streptococcus kind, Lactococcus garvieae, Edwardsiella tarda, Edwardsiella ictaluri, viral nervous necrosis poison, except virus according to the present invention, have irido virus and the Koi herpesvirus of many features with iris Viraceae.
Also another embodiment relates to a kind of method for the preparation of vaccine according to the present invention, wherein said method comprises, and mixes according to the DNA fragmentation of MCP of the present invention by virus according to the present invention and/or according to MCP of the present invention and/or coding with pharmaceutically acceptable carrier.
Another embodiment more of the present invention relate to for use in vaccine according to virus of the present invention and/or according to MCP of the present invention and/or coding according to the DNA fragmentation of MCP of the present invention.
As mentioned above, the lethality rate that SDD virus infection is later easily up to 30%, and easily can reach 75%.In addition, disease attacks (strike) with relatively high speed.Thus, in order to protection avoids disease effectively, SDD fast and correct diagnosis is important.
Therefore, another object of the present invention is, provides the diagnostic tool being suitable for detecting SDD and SDD virus.
Depend on to these tools sections the operability of the antibody for virus.Such antibody can such as be used in the diagnostic test of SDD and SDD virus.
The source most suitable for of antibody of virus according to the present invention is such as by the blood of the jewfish of virus infection according to the present invention or serum.
By giving such as pig, poultry or such as rabbit inoculation vaccine by virus according to the present invention (in such as water-in-oil suspension), also the antibody for virus according to the present invention or antiserum(antisera) can be obtained rapidly and easily, subsequently after about 4 weeks, blood drawing, the centrifugal blood solidified, and decant serum.Such method is well-known in the art.
Other method for the preparation of antibody is well-known in the art, and described antibody can be polyclonal antibody, Mono-specific antibodies or monoclonal antibody (or derivatives thereof).If polyclonal antibody expects, well-known (such as Mayer and Walter in this area recent decades for the production of the technology with processing polyclonal serum, compile .ImmunochemicalMethodsinCellandMolecularBiology, AcademicPress, London, 1987).
By being also the known for a long time technology (Kohler and Milstein, Nature, 256,495-497,1975) in this area, by the inbrde mouse of immunity, the monoclonal antibody can reacted with virus according to the present invention can be prepared.
Thus, another embodiment of the invention relates to the antibody or antiserum(antisera) that react with virus according to the present invention.
Diagnostic test reagent box (it is based on the antigen-like material detected according to virus of the present invention or this virus, and is therefore suitable for detecting SDD virus infection) such as can comprise the ELISA test of standard.In an example of such experiment, with the antibody bag for this virus by the wall in the hole of elisa plate.Together with the material that will test after incubation, the antibody of the mark that can react with this virus adds in hand-hole.If the material tested comprises SDD virus really, combination is wrapped by the antibody in the hole to ELISA by this virus.The antibody adding the mark that can react with this virus in hand-hole subsequently again can in conjunction with this virus, and then color reaction discloses the existence of the antigen-like material of this virus.
Therefore, also another embodiment of the present invention relates to the diagnostic test reagent box for detecting the antigen-like material according to virus of the present invention or this virus, its comprise can with virus according to the present invention or the antibody that can react with its antigen-like material.The antigen-like material of described virus should be explained in a broad sense.It can be the virus of such as decomposed form, or comprises the peplos material of viral envelope proteins.As long as the material of described virus reacts with the antiserum(antisera) produced for this virus, so described material is considered antigen-like material.
The ELISA that diagnostic test reagent box (therefore it based on detecting in serum the antibody that can react with the antigen-like material of virus according to the present invention or this virus, and be suitable for detecting SDD virus infection) also such as can comprise standard tests.In such test, can such as with virus according to the present invention or its antigen-like material bag by the wall in the hole of elisa plate.Together with the material that will test (such as doubtful by the serum of the fish of SDD virus infection) after incubation, the antibody of the mark that can react with virus according to the present invention adds in hand-hole.If anti-SDD antiviral antibody is present in the serum of test, combination is wrapped by the virus in the hole to ELISA by these antibody.As a result, the antibody of the mark that can react with this virus later added can not be in conjunction with, and can not find color reaction.Thus the shortage of color reaction discloses the existence of the antibody that can react with virus according to the present invention.
Therefore, also another embodiment of the present invention relates to the diagnostic test reagent box for detecting antibody, described antibody can react with virus according to the present invention or can react with the antigen-like material of described virus, and the antigen-like material of described virus comprises according to virus of the present invention or its antigen-like material.
The design of immunoassay can change.Such as, described immunoassay can based on competing reaction or direct reaction.In addition, scheme can use solid support, maybe can use cell material.The detection of Antibody-antigen complex can comprise the antibody of applying marking; Described mark can be, such as, and enzyme, fluorescence molecule, chemiluminescent molecule, Geigers or dye molecule.
Except above-mentioned ELISA, the appropriate method for detecting the antibody that can react with the virus according to the present invention in sample comprises immunofluorescence and tests (IFT) and western blot analysis.
But be optionally that PCR as above tests fast with easy diagnostic test for diagnosing a kind of according to the presence or absence of virus of the present invention, it comprises the PCR primer set can reacted with the specific region of the MCP of such as SDD virus or ATP enzyme gene.Within this context, specific refer to such as SDD virus MCP or ATP enzyme gene specific to, be not namely present in other member of iris Viraceae.
Preferably, such test will use: use the primer set (SEQIDNO:5-6) of two kinds of primer SDD-50-FW:CAGTGCATTACAAGAAAG and SDD-213-REV:GCTGAAACAACAATTTAG, and the major capsid protein of itself and described virus reacts specifically; Or using the primer set (SEQIDNO:7-8) of two kinds of primer SDD-MCP-277-FW:TCCTGTGCAGCTGTCTAAAC and SDD-MCP-1090-REV:ACTGGCAATGATGGGCGATG, it also reacts specifically with the major capsid protein of described virus; Or using the primer set (SEQIDNO:9-10) of two kinds of primer SDD-ATP enzyme-65-FW:TCGGAGGGATGAAATTGG and SDD-ATP enzyme-618-REV:AGCGTTGTCGATGTAGAG, the ATP enzyme of itself and described virus is reacted specifically.
Self-evident, primer more more than the primer of above-mentioned qualification can be used.The present invention provides the MCP of SDD virus and the unique sequences of ATP enzyme gene first.This allows technician will select other optionally primer without the need to any other effort.By the known MCP of other member or the simple computers analysis of ATP enzyme gene order of MCP provided by the invention or ATP enzyme gene order and iris Viraceae, technician can develop other specific PCR-primer for diagnostic test, and described diagnostic test is for detecting SDD virus and/or SDD virus being distinguished with other viral (fish) pathogenic agent.
With the MCP of SDD virus or ATP enzyme gene specific the PCR-primer that reacts be understood to such primer: its only with MCP or the ATP enzyme Gene response of SDD virus, and not with the MCP Gene response of another kind of (fish) pathogenic virus or one group of (fish) pathogenic virus.
Thus, another embodiment relates to the diagnostic test reagent box for detecting according to virus of the present invention, it is characterized in that, described test kit comprises the PCR primer set can reacted with the specific region of the MCP of SDD virus or ATP enzyme gene.
A kind of preferred form of this embodiment relates to the diagnostic test reagent box for detecting according to virus of the present invention, it is characterized in that, described test pack is contained in the primer set described in SEQIDNO:5-6 or the primer set described in SEQIDNO:7-8 or the primer set described in SEQIDNO:9-10.
embodiment:
the separation of embodiment 1:SDD virus and vitro culture
For separating of collection, pcr analysis and the external virus culture of the serum of virus, heart, spleen and kidney sample
experiment 1:
In Singapore fish farm from have usual scale come off signs of disease fish and do not have scale come off disease symptom fish collect sample.Described sample is by the heart, two spleens that derive from infected animal.Three kidneys and four serum sample compositions.In addition, two spleens, four kidneys and two serum samples are collected from healthy jewfish.
experiment 2:
In this experiment, serum, kidney and spleen sample is collected from the three groups of fishes deriving from Indonesia fish farm.Group 1 forms by from not having fish to present come off 3 of the cage contrast fishes of symptom of disease (SDD) of scale.Group 2 is made up of 5 fishes from the cage with SDD commitment, and wherein death just starts.Group 3 is made up of 5 fishes from the cage with serious SDD sign, and wherein mortality ratio peaks.
experiment 3:
In this experiment, serum sample is collected from the two groups of fishes deriving from Indonesia fish farm.Group 1 forms by from 3 the contrast fishes not having fish to present the cage of SDD symptom.Group 2 forms by breaking out from SDD 20 fishes being in the cage of starting stage.Described fish does not show symptom or shows small symptom.
Sample preparation/tissue homogenate is separated with DNA
Use granulated glass sphere in 0,01MPBS by tissue sample (spleen, kidney and heart) homogenization to 10% (w/v) homogenate.
Obtain serum as follows: collect blood by caudal vein puncture art, make its condense (cloth), and collect serum after being made by Standard centrifugal hemocyte precipitate.
Use the specification sheets of manufacturer, use QiagenDNeasyBlood & Tissue test kit, from fish serum and the fish tissues sample separation DNA homogenized.
Following processing sample:
for serum: 50 μ l serum are added in the 20 μ l proteolytic ferment K (QiagenDNeasyBlood & Tissue test kit proteolytic ferment K " 600mAU/ml solution (or 40mAU/mg albumen) ") in 1.5mLEppendorf test tube, and mix.To in this mixture, add 150 μ l phosphate buffered salt solutions (PBS) and mix.To in this mixture, add 20 μ lRNA enzymes A (20mg/mL), mix, and incubation at room temperature 2 minutes.After this, the specification sheets of manufacturer is followed.
for the tissue sample of homogenization: 50 μ l tissue homogenate things are added in 20 μ l proteolytic ferment K in 1.5mLEppendorf test tube, and mix.To in this mixture, add the ATL solution (Qiagen) of 130 μ l, mix, and incubation at room temperature 60 minutes.To in this mixture, add 20 μ lRNA enzymes A (20mg/mL), mix, and incubation at room temperature 2 minutes.After this, the specification sheets of manufacturer is followed.
Use VIDISCA-454 and PCR to detect virus and use the load of qPCR quantitate virus
Use VIDISCA-454 virus discovery technique (DeVries deng people (2011) PLoSONE6 (1): e16118), the serum sample of analysis design mothod 1, it to come off the Asia jewfish of disease symptom derived from having and do not have scale.Obtain the doubtful multiple sequences being derived from new fish disease substance.These sequences are used to derive PCR primer (see table 1) for Standard PCR and qPCR.The order-checking (Blasting) of described new sequence discloses, suffer scale come off disease fish in the virus of the pathogenic agent that detects and iris Viraceae there is similarity to a certain degree.
To use the primer of SDD virus-specific in extraction from the enterprising performing PCR of the DNA of heart, spleen, kidney and serum sample, described sample collection to come off the fish (experiment 1) of disease symptom from having and do not have scale.In addition, use PCR is carried out to the specific primer set of another member's red-sea bream iridovirus (table 1 and SEQIDNO:12 and 13) of iris Viraceae.Use standard method to carry out PCR, annealing temperature is 50 DEG C for SDD virus primer set, is 57 DEG C for red-sea bream iridovirus primer set.Swimming PCR sample on sepharose.PCR primer is cut off from agarose, uses QIAquickGelExtractionKit (Qiagen) purifying, and check order.
As finding in FIG, exclusively derive from have scale come off disease fish, containing the sample of DNA in create SDD virus PCR product.In only serum sample deriving from infected animal (scale come off serum 3), can not increase SDD viral DNA.Sample derived from healthy animal does not all produce PCR primer.The order-checking of these PCR primer confirms, they are derived from SDD virus.Use the primer set for SDD virus, do not produce the PCR primer (Fig. 1) of red-sea bream iridovirus.In addition, red-sea bream iridovirus primer set does not show and the cross reactivity of SDD virus (Fig. 2).
In addition, for SDD virus qPCR devises probe (table 1 and SEQIDNO:11).Application standard method and with SDD virus primer set jointly use probe, carry out qPCR the annealing temperatures of 50 DEG C.Use Bio-RadCFXManager2.0 software analysis data.In pCR4-TOPO (Invitrogen), typical curve is served as in the duplicate measurement of the dilution series of the SDD virus PCR product of clone.The positive or negative of sample is classified and in each sample, the determination of the original vol of SDD viral genome material is based on the threshold cycle relative to typical curve.The Monitoring lower-cut of this qPCR is about 10 2individual copy/μ l (Fig. 3).As shown in Table 2, qPCR result and PCR result are completely corresponding (see arranging " result PCR " and arranging " result Q-PCR ").
Similarly, use qPCR to determine the initial amount of the SDD viral genome copies in serum sample, described serum sample derived from do not have scale come off symptom, there is early stage and late stage scale to come off the fish (experiment 2) (table 3) of symptom.Except fish 8, all serum samples deriving from the fish with early stage and late stage disease are positive, and all samples deriving from the fish with healthy appearance are negative.
In addition, the serum sample deriving from experiment 3 is analyzed by qPCR.At 20 from 17 serum sample that the fish suffering scale to come off disease derives, virus genome sequence detected.The serum sample collected from healthy fish is not SDD virus-positive.
In a word, 40 are analyzed from having the serum and tissue sample that the slight fish to severe symptom that scale comes off disease collects.SDD virus genome sequence is detected in 35 in these samples.Form sharp contrast, derive from the sample of healthy animal at 14 and virus do not detected.
In the cell cultures of Bluegillfry (BF-2) clone that MSDAH sets up
Clone BF-2 at first derived from the merging tail region of the trunk of 1 years old small fish of trypsin treatment suspension (Bluegillfry, lepomismacrochirus, see Science1966; 151:1004, JVirol1968; 2:393, JInfectDis1968; 11:253, InVitroCellDev.Biol1992; 28A:385.This clone is commercially available by ATCC and ECACC, but the MSDAH that ties up to being used for following experiment was cultivated for+70 generations.
The E-MEM that BF-2 cell culture medium supplements 2mML-glutamine and 110mg/L Sodium.alpha.-ketopropionate, 100mlFCS (10%) and 1mL Liu Suanyan NEOMYCIN SULPHATE polymyxin antibiotic solution 1000 times of stostes by 899ml forms.At 28 DEG C and 5%CO in moisturizing incubator 2under culturing cell routinely.
Before beginning the culture, substratum is remained on 4 DEG C.The freezing stoste BF-2 of 1 ampoule is used to start to cultivate.By the fast melt in 20-28 DEG C of water of the cell from liquid nitrogen.Cell suspension is moved in 15mL test tube, and dilute lentamente with 7mL substratum.Subsequently, counting cells.Suspension substratum is diluted further, until DMSO is diluted to few 50 times.Subsequently, suspension is dispensed to suitable culturing bottle or roller bottle, and at 28 DEG C and 5%CO 2middle incubation.After 6-24 hour or cell adhere to completely, substratum is upgraded to remove remaining DMSO (freezing substratum is made up of 80% substratum and 20%DMSO).By further for cell incubation 3-7 days or until reach and converge.For roller bottle, need the roller speed of 0.2-0.5rpm.Regularly under inverted microscope, check cell.
Converge once reach, by passage.Can often within 3-4 days, go down to posterity, initial inoculum density is 2.0x10 4individual cell/cm 2.Alternatively, by reaching 4.0x10 4individual cell/cm 2higher density inoculating cell, shorter interval of going down to posterity can be obtained.The reagent (substratum, PBS, trypsinase/EDTA) being used for passage is warmed to 28 DEG C in advance.Abandon substratum, and the PBS of the individual layer proper volume (for T25,3mL) converged is washed 1 time.Abandon PBS subsequently, and by cell supplementing in the PBS of the 2%EDTA solution of 2.5% trypsin solution and 1% (vol/vol) of 1% (vol/vol) 28 DEG C of incubations 15 minutes in same volume.Add the fresh culture of same volume, and by cell settling flux and counting.New flask is assembled with volume of culture suitable for culturing bottle or roller bottle at the cell density expected.
In order to frozen cell, before the procedure substratum and freezing substratum (80% (vol/vol) substratum+20% (vol/vol) DMSO) are remained on 4 DEG C.The cell culture that process described above converges, until and comprise tryptic digestion.By cell settling flux, counting, further settling flux in the substratum of appropriate amount, and dropwise adds 2 times of freezing substratum of equal volume while stirring suspension.The ampoule 5x10 of liquid nitrogen storage will be used for 6individual cell/ampoule (to start T175) or use 7.5x10 5individual cell/ampoule (to start T25) is filled.
To BF-2 cell inoculation SDD virus
Before setting up inoculation experiments, will go down to posterity at least 1 time from liquid nitrogen storage thing cultured cells.Passage is cultivated 24 hours, then in the T25 culturing bottle with 5.0x10 4individual cell/cm 2inoculation.Inoculum is made up of (being used for setting up viral cultures by the combining anteserum sample of the fish 4-7 of experiment 2) the serum 1:10 dilution in the medium deriving from the animal affected by SDD.From flask removing substratum.Subsequently at 28 DEG C/5%CO 2to flask inoculation 0.5ml inoculum/T25 minimally 30min.
The freeze thawing cutting of the thing that previously goes down to posterity (in the cell diluted in the medium) of SDD virus may be inoculated equally to cell.
Subsequently, removing inoculum (although this is not sine qua non), adds fresh culture, and cell cultures is reached 10 days or until use inverted light microscope to observe complete CPE.By 1-3 freeze-thaw cycle (-70 DEG C to 4 DEG C) results virus, and subsequently by 4 DEG C centrifugal 5 minutes of 1000xg from cell debris clarified harvest thing.Copying of virus can be confirmed with the titration of qPCR analysis and/or cutting.DNA sequencing technology is used to confirm the identity of virus.
Use the specification sheets of manufacturer, use QiagenDNeasyBlood & Tissue test kit, be separated the DNA being used for qPCR from tissue culture medium (TCM) with the cell harvesting thing of freeze thawing.
for substratum cutting: 200 μ l substratum cuttings are added in 20 μ l proteolytic ferment K in 1.5mLEppendorf test tube, and mix.To in this mixture, add 20 μ lRNA enzymes A (20mg/mL), mix, and incubation at room temperature 2 minutes.After this, the specification sheets of manufacturer is followed.
for cell lysate: 50 μ l cell lysates are added in 20 μ l proteolytic ferment K in 1.5mLEppendorf test tube, and mix.To in this mixture, add the ATL solution (Qiagen) of 130 μ l, mix, and incubation at room temperature 60 minutes.To in this mixture, add 20 μ lRNA enzymes A (20mg/mL), mix, and incubation at room temperature 2 minutes.After this, the specification sheets of manufacturer is followed.
The serum sample that do not have virus never to have fish that scale comes off disease symptom derives is cultivated.
The deactivation of SDD virus
(1 part of formalin is added 9 parts of H by adding 10 times of prediluted formalin 2in O), by the deactivation of virus harvest thing.1000 times of final volume dilutions of formalin are effective for SDD inactivation of virus, so added by 10 of 1 volume times of prediluted formalin in the cutting (final formaldehyde content 0.037%) of 99 volumes.The content of container is stirred gently at 4 DEG C.Add formalin and after stirring, directly whole mixture is transferred to new container to guarantee that all virus contacts with formalin.But the content of container is stirred 3 days continuously lightly, subsequently incubation 11 days under not stirring.In the whole deactivation stage of 14 days, mixture is remained on 4 DEG C.
Concentrating of inactivation of viruses
Application transverse stream filtering is to obtain the inactivation of viruses concentrated.Use GEHealthcareFilter56-4100-92, UFP-100-E-H22LA, 38cm2,100.000NMWC, the virus of concentrated deactivation.By strainer milli-Q water, and with the formlinata aquae concentratac sterilizing of 2% (vol/vol).Subsequently, strainer PBS is rinsed, and rinse with EMEM substratum.Inactivation of viruses batch of material is added strainer and is concentrated into 1/10 of initial volume.
Titration SDD virus on BF-2 cell
Cultivation BF-2 cell described above.1 day before testing, preparation BF-2 cell suspension, it contained the 3x10 in cold (2-8 DEG C) substratum 4individual cell/ml.This cell suspension in 100 μ l/ holes is inoculated to 96 of microwell plate holes.By plate in wet atmosphere at 28 DEG C/5%CO 2incubation 24 hours.After this incubation period, individual layer should converge by about 30-50%.
Testing the same day, 10 times of serial dilution things of each viral sample of following preparation are until 10 -8: 0.5ml sample is transferred to the test tube containing cold (0-20 DEG C) titration substratum (not containing the substratum of FBS) of 4.5ml, mixing, and 0.5ml is transferred to next containing in the test tube of 4.5ml titration substratum, carry out careful mixing, transfer etc. subsequently.1st and 12 row and the capable negative controls that serve as of A and H, and inoculate the fresh titration substratum in 100 μ l/ holes.The viral dilution liquid in 100 μ l/ holes is inoculated, by 10 to microwell plate -3, 10 -4, 10 -5, 10 -6, 10 -7, 10 -8be seeded in B to G capable (10 holes/extent of dilution).In operation, the temperature of viral dilution liquid is remained between 0 DEG C to 20 DEG C.By plate at 28 DEG C/5%CO 2incubation 7 days.After 7 days viral incubation periods, with the CPE screen plate of inverted light microscope for SDD virus-specific.The feature of the CPE of SDD virus-specific is the gathering of the cell in individual layer, succeeded by cell detachment.The phenomenon departed from after can being clear that this cell aggregation in the diagram.Fig. 5 shows the individual layer of the compared with control cells do not infected.Hole in BF-2 individual layer is surrounded by round cell.Be the positive by each hole scoring of the CPE of display SDD virus-specific.The method described according to Reed and Muench, Am.J.Epidemiol. (1938) 27 (3): 493-497 and calculating, determine TCID 50.The qPCR being separated the DNA sample in the positive hole in titration determination analyzes the existence confirming virus.
The sequence of SDD virus major capsid protein and ATP enzyme and Phylogenetic analysis
Fig. 6 and 7 respectively illustrates full length DNA and the protein sequence of SDD virus major capsid protein (MCP) and ATP enzyme.
SDD virus MCP and ATP enzyme DNA sequence dna is used to set up genealogical tree (Fig. 8 and 9).Use adjacent method and application standard to arrange, set up tree with MEGA5 software.The DNA sequence dna of the continuous ORF that encodes only is comprised in comparison.Carry out bootstrap analyses (2000 copies), and specify bootstrapping to support per-cent at Nodes.Distance bar indicates the number of the nucleotide subsitution in each site.
By the irido virus MCPDNA sequence alignment that SDD virus MCPDNA sequence comprises with the Phylogenetic analysis described in Kurita and Nakajima (Viruses2012,4:521-538).As shown in FIG. 8, SDD virus can be regarded as the single member of the single genus in Iridoviridae.The MCP sequence of the member that SDD virus MCP sequence and Megalocytivirus belong to is the most closely related.But, compared with the most closely-related MCP sequence (red-sea bream iridovirus MCPORF), pairing distance (ratio in replaced site) remain 49% (blast contrast discloses 65% homology with RSIVMCP, with the difference of 49% " pairing distance " mainly due to repair replace such as from the sudden change of such as Nucleotide A to G and return back to second of A and suddenly change).
Fig. 9 depicts the Phylogenetic analysis of the DNA sequence dna of coding SDD virus ATP enzyme.Confirm compared with other irido virus ATP enzyme sequence comprised in this analysis, SDD virus ATP enzyme sequence is a remote outlier.
Table 1: for SDD virus and the primer sequence of RSIVPCR
Primer: Sequence (5 '-3 '):
SDD-50-FW CAG TGC ATT ACA AGA AAG
SDD-143-probe 6FAM-ATG CCG TCA TTG TAA CAC TG-BHQ1
SDD-213-REV GCT GAA ACA ACA ATT TAG
IRIDO-FW-5 CGT GAG ACC GTG CGT AGT
IDIDO-REV-5 AGG GTG ACG GTC GAT ATG
SDD-ATP enzyme-65-FW TCGGAGGGATGAAATTGG
SDD-ATP enzyme-618-REV AGCGTTGTCGATGTAGAG
SDD-MCP-277-FW TCC TGT GCA GCT GTC TAA AC
SDD-MCP-1090-REV ACT GGC AAT GAT GGG CGA TG
Table 2:SDD virus qPCR and PCR result (experiment 1).
Sample Threshold cycle (Cq) Initial amount (copy/μ l) Result Q-PCR Result PCR
Scale comes off spleen 1 25.55 3.06E+04 POS POS
Scale comes off spleen 2 22.50 2.91E+05 POS POS
Healthy spleen 1 N/A N/A NEG NEG
Healthy spleen 2 N/A N/A NEG NEG
Scale comes off serum 1 23.97 9.81E+04 POS POS
Scale comes off serum 2 22.95 2.09E+05 POS POS
Scale comes off serum 3 N/A N/A NEG NEG
Scale comes off serum 4 27.12 9.57E+03 POS POS
Healthy serum 1 N/A N/A NEG NEG
Healthy serum 2 N/A N/A NEG NEG
Scale comes off heart 23.42 1.47E+05 POS POS
Scale comes off kidney 1 23.26 1.65E+05 POS POS
Scale comes off kidney 2 23.81 1.11E+05 POS POS
Scale comes off kidney 3 21.60 5.65E+05 POS POS
Healthy kidney 1 N/A N/A NEG NEG
Healthy kidney 2 N/A N/A NEG NEG
Healthy kidney 3 N/A N/A NEG NEG
Healthy kidney 4 N/A N/A NEG NEG
N/A: can not detect
POS: positive
NEG: negative
^。
Table 6: doubtful by SDD the virus fish affected and SDD virus qPCR and PCR result (experiment 2) contrasted in fish
Fish NC/ is early stage/late period Initial amount (copy/μ l) Result q-PCR
Fish 1 NC N/A NEG
Fish 2 NC N/A NEG
Fish 3 NC N/A NEG
Fish 4 In early days 1,50E+04 POS
Fish 5 In early days 5,13E+04 POS
Fish 6 In early days 7,53E+04 POS
Fish 7 In early days 1,23E+05 POS
Fish 8 In early days N/A NEG
Fish 9 Late period 9,08E+04 POS
Fish 10 Late period 6,45E+02 POS
Fish 11 Late period 2,01E+04 POS
Fish 12 Late period 1,27E+04 POS
Fish 13 Late period 4,83E+04 POS
NC: negative control
N/A: can not detect
POS: positive
NEG: negative.
Embodiment 2: the SDD viral challenge in fish
experimental scheme is concise and to the point:
(abbreviation of use: IM: intramuscular, IP: intraperitoneal, ppt: every thousand parts)
This experiment is carried out by the SDD virus of cell culture breeding.Use 460 (460) Asia jewfish (20g) in this study.
Following attack 95 (95) bar fish: 1) high dosage intraperitoneal (IP) injection, 2) low dosage IP injects, 3) low dosage intramuscular (IM) injection, and 4) high dosage IP and the low dosage IM combination of injecting.In order to sample contrast object, other 80 fishes do not attacked are remained negative control.
Attack latter 1st, 3,7,10 and 14 day at time point, results ten five (15) bar fishes, every bar is from 5 groups.Observe remaining 15 articles of fishes until the 28th day, to evaluate the mortality ratio from often kind of attack method.
At each sampling time point, the kidney of the fish of results is individually sampled, and by group, serum is merged.Sample for reference is used for Viral Quantification, to limit the time period of the highest virus titer in fish serum or kidney.
attack material
Use the SDD virus of cell culture breeding as attacking material.Described viral initial separation is also bred in vitro from Indonesian Asia jewfish.Use the titration method determination virus titer described in embodiment 1.
attack material thinner
Standard vaccine dilution buffer: PBS+1.5%NaCl is used as to attack material thinner.
animal
Species: Asia jewfish ( latescalcarifer)
Weight in average during arrival: about 2 grams/fish (on average)
Weight in average when testing beginning: 20g
The number of fish: totally 460 fishes.
cultivation
Water: the seawater (30ppt) attacking latter 28 DEG C ± 2 DEG C
Feed: fish of arbitrarily feeding from the same day after attack.
Tank: fish is housed in 4 250L tanks.In each tank, vertical web is installed, to be based upon the separation at 1/3 place of tank.This of tank 1/3 separates the fish observed for mortality ratio of maintenance 15.Other 2/3 tank keeps 80 for the fish (see table 3) of time-histories results.The contrast fish do not attacked is housed in the half of 500L tank.The water temp of the tank of contrast fish is alignd with the tank attacking fish.
grouping and administration:
the distribution of animal
This experiment needs 460 jewfish altogether.When they are in one's hands, select the fish in expectation size (20g) randomly.
attack:
Fish prepares and fish measured body weight
By fish hunger at least 36 hours before attack.Before attack, 20 are weighed together the mean body weight often organized from the fish often organized.
Tank observed by table 3.
* 1the undiluted SDD virus of high dosage=0.1ml/ fish.
* 2the SDD virus of 10 times of dilutions of low dosage=0.1ml/ fish.
* 3fish is got from sealing chamber in each time period.
iP attack (high dosage and low dosage)
Before attack operation, AQUI-S is used to be anaesthetized by all fishes.Inject 0.1ml to fish at veutro IP and attack material.Apply two kinds of different Prerequisites: 1) undiluted attack material (high dosage: 5.5x10 6tCID50/ fish), and 2) the attack thing (low dosages: 5.5x10 of 10 times of SVDB material dilutions 5tCID50/ fish).After attack, the distribution tank immediately fish being transferred back to them is recovered.The details following (also see table 3) of each process.
iM attacks (low dosage)
Material for IM attack is 10 times of dilution (low dosages: 5.5x10 of SVDB 5tCID50/ fish), and 0.1ml is attacked material and be intramuscularly injected in every bar fish.Before IM attacks, AQUI-S is used to be anaesthetized by all fishes.
iP attack (high dosage)+IM attacks (low dosage)
Attacked by IP (high dosage) first and attack with IM (low dosage) subsequently, carry out combination attacks.After double injection, fish is housed in their distribution tank from anesthesia recovery.
sampling
After attack the 1st, 3,7,10 and 14 day, be collected into many 15 fishes (table 4,5) from 5 fish groups.First by the fish bloodletting of all results.After this, the nephridial tissue deriving from every bar fish is individually sampled in sterile test tube.
Table 4. plan sample time
Table 5. samples plan and sample tube ID
With AQUI-S, all fishes are anaesthetized, and by tail venipuncture blood collection.The blood deriving from identical fish group is collected in 1 test tube and also allow to condense in room temperature.On the same day or process blood next day with separation of serum.By by blood at 3,700rpm centrifugal 20 minutes, separation of serum.By the serum transfers that obtains to sterile test tube and <-50 DEG C of storage.
observe and after death check
In the attack process of latter 5 days or within, not there is death.
After attack, every day is recorded in the fish mortality ratio of observing in tank 3F01B, 3F02A, 3F03B and 3F04A (15 fish/every half tank).Observe mortality ratio 28 days.
In the fish attacked, observe scale to come off the characteristic symptom of disease, comprise fin corrosion and scale comes off.In addition, in the fish group (IP (height) or IP (height)+IM (low)) accepting high challenge dose, within latter 5 days, death is observed from attack.The Animal performance accepting IP low dosage or the attack of IM low dosage goes out the dead delay a little occurred.In different groups, mortality ratio adds up to be 60% (IP (height)), 47% (IP (height)+IM (low)), 20% (IP (low)) and 13% (IM (low)).Death (Figure 10) is not observed in the contrast fish do not attacked.
About the existence of SDD viral DNA sequences, analyzed the serum sample (collecting from 15 animals often organized for 1,3,7,10 and 14 day after attack) collected by qPCR.As shown in Figure 11, except the control group do not attacked, in all groups, SDD viral DNA detected.From latter 10 days of attack, the amount of viral DNA copies increased, reaches peak value and decline.In the serum collected from the group accepting high challenge dose (IP (height) or IP (height)+IM (low)), the highest viral DNA levels is detected at the 10th day.Also most high mortality level (being 60% and 47% respectively) is observed in these groups.
Finally, the serum inoculation BF2 cell of positive fish is used.Observe CPE, and qPCR confirms the existence of SDD viral DNA, it confirms that SDD virus causes scale to come off the pathogenic agent of disease.
Thus can draw to draw a conclusion:
First supposition of Koch is claimed, described microorganism must detect in by the animal of this sickness influence, but is not taken in healthy animal and finds.This supposition is realize for SDDV, because VIDISCA-454 and qPCR only detects SDDVDNA in the fish of SDS impact.In addition, in PCR, the DNA of enlargement cell virus RSIV do not detected.
Also achieve second supposition, it claims that microorganism/virus must be separated from ill organism and cultivate (preferably) in clone.After the serum giving the BF-2 clone inoculation SDDV-positive, observe cytopathicity effect.Virus titer increases in time, shows that virus copies on these cells.VIDISCA-454 and qPCR subsequently analyzes and confirms, the virus copied is SDDV really.When titration, differential centrifugation and freezing-transmission electron microscopy confirm existing of infectious virus particle, complete separation.3 the go down to posterity maintenances of serum on BF-2 cell of SDDV-feminine gender do not have CPE, and this confirms, described virus is not present in healthy animal really.Described virus can from cell culture results and purifying.
When contriver confirms primary signs (scale comes off) of SDDV virus induction death and the SDD cultivated after barramundi infects, achieve the 3rd supposition of Koch.It should be pointed out that the sample do not collected from 15 fishes on the same day at 5 can produce the DNA amount of such measurement: it is the low valuation of the DNA content of overall colony.This may be because dead fish is not included in this sampling, and these can be the most affected fish with arguing and thus may have the highest virus titer.
Finally, BF-2 cell is separated SDDV again that derive from serum sample, achieve last supposition of Koch, described serum sample derives from wherein this virus and has induced the fish of SDD.
Contriver thinks, the detection of SDDV be separated successful especially because for the selection (corresponding to prior art) that very specificity is selected, blood serum substituting illing tissue originates as pathogenic agent of the cell of cultivating pathogenic agent, the selection avoiding the selection of use 0.22 micron filter (corresponding to prior art) and originate as pathogenic agent the fish of the very commitment of disease in the step from sick fish serum isolated viral.
accompanying drawing illustrates:
Fig. 1: the result (experiment 1) of the SDD virus PCR on the fish and contrast fish of SDD virus suspected infection
Fig. 2: the result (experiment 1) of the red-sea bream iridovirus PCR on the fish and contrast fish of SDD virus suspected infection
Fig. 3: SDD virus qPCR typical curve (experiment 1).
Fig. 4: the 5th day CPE in BF-2 cell monolayer after infection.Notice the cell of gathering.Scale bar 100 μm
Fig. 5: the BF-2 individual layer (contrast) of the 5th day after infection.Scale bar 100 μm
Fig. 6: SDD virus major capsid protein DNA (a) and albumen (b) sequence.
Fig. 7: SDD virus ATP enzyme DNA (a) and albumen (b) sequence.
Fig. 8: the genealogical tree of irido virus major capsid protein ORF.For each sequence, show kind of a title, genus and accession number.The per-cent bootstrapping specifying 2000 copies at Nodes is supported.Distance bar indicates the number of the nucleotide subsitution in each site.
The germline of Fig. 9: irido virus ATP enzyme ORF occurs.For each sequence, show kind of title and accession number.The per-cent bootstrapping specifying 2000 copies at Nodes is supported.Distance bar indicates the number of the nucleotide subsitution in each site.
Figure 10: the cumulative mortality (%) after the SDD virus attack observed in different groups.Each tank contains 15 fishes, and described fish is injected the SDD virus of the cell culture breeding of (IP and/or IM) various dose.
Figure 11: the SDD viral DNA copies after attacking in jewfish serum.Often organize collecting in serum (sampling in the 1st, 3,7,10 and 14 day) of 15 articles of fishes and measure SDD viral DNA copies/μ l by qPCR deriving from.
Figure 12: the SDDV derived from tissue culture go down to posterity 3 concentrating cells and substratum cutting freezing-TEM image.

Claims (24)

1. the virus be separated, it, for comprising a member of the iris Viraceae of major capsid protein (MCP) gene and ATP enzyme gene, is characterized in that:
A) described virus is that the scale of fish comes off the pathogenic agent of disease, and
B) nucleotide sequence and the nucleotide sequence described in SEQIDNO:1 of described MCP gene have the identity level of at least 80%, or the nucleotide sequence of described ATP enzyme gene has the identity level of at least 80% with the nucleotide sequence described in SEQIDNO:3.
2. the virus of separation according to claim 1, it is characterized in that, nucleotide sequence and the nucleotide sequence described in SEQIDNO:1 of described MCP gene have the identity level of at least 80%, and the nucleotide sequence of described ATP enzyme gene has the identity level of at least 80% with the nucleotide sequence described in SEQIDNO:3.
3. the virus be separated, it is the member of the iris Viraceae comprising MCP gene and ATP enzyme gene, it is characterized in that:
A) described virus is that the scale of fish comes off the pathogenic agent of disease, and
B) described MCP gene reacts the PCR primer to produce 164 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:5 and 6, or the PCR primer of reacting with the primer set described in SEQIDNO:7 and 8 in PCR reaction to produce 814 ± 10 base pairs, or described ATP enzyme gene reacts the PCR primer to produce 554 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:9 and 10.
4. the virus of separation according to claim 3, it is characterized in that, described MCP gene reacts the PCR primer to produce 164 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:5 and 6, and the PCR primer of reacting with the primer set described in SEQIDNO:7 and 8 in PCR reaction to produce 814 ± 10 base pairs, and described ATP enzyme gene reacts the PCR primer to produce 554 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:9 and 10.
5. the virus of the separation according to any one in claim 1-4, it is characterized in that, nucleotide sequence and the nucleotide sequence described in SEQIDNO:1 of described MCP gene have the identity level of at least 80%, and the nucleotide sequence of described ATP enzyme gene has the identity level of at least 80% with the nucleotide sequence described in SEQIDNO:3, and be characterised in that, described viral DNA reacts the PCR primer to produce 164 ± 10 base pairs in PCR reaction with the primer set described in SEQIDNO:5 and 6, and the PCR primer of reacting with the primer set described in SEQIDNO:7 and 8 in PCR reaction to produce 814 ± 10 base pairs, and the PCR primer of reacting with the primer set described in SEQIDNO:9 and 10 in PCR reaction to produce 554 ± 10 base pairs.
6. comprise a cell culture for virus, it is characterized in that, described culture comprises the virus according to any one in claim 1-5.
7. a DNA fragmentation, it comprises the gene of coding major capsid protein, it is characterized in that, described gene has the identity level of at least 80% with the nucleotide sequence of the MCP gene described in SEQIDNO:1.
8. a major capsid protein, is characterized in that, described MCP is encoded by DNA fragmentation according to claim 7.
9. a DNA fragmentation, it comprises the gene of coding ATP enzyme, it is characterized in that, described gene has the identity level of at least 80% with the nucleotide sequence of the ATP enzyme gene described in SEQIDNO:3.
10. an ATP enzyme, is characterized in that, described ATP enzyme is encoded by DNA fragmentation according to claim 9.
11. 1 kinds to come off the vaccine of disease for defeating the scale of fish, it is characterized in that, described vaccine comprises virus according to any one in claim 1-5 and pharmaceutically acceptable carrier.
12. vaccines according to claim 11, is characterized in that, described virus is in attenuated forms thereof of living.
13. vaccines according to claim 11, is characterized in that, described virus is in deactivated form.
14. 1 kinds to come off the vaccine of disease for defeating the scale of fish, and it is characterized in that, described vaccine comprises major capsid protein according to claim 8 and pharmaceutically acceptable carrier.
15. 1 kinds to come off the vaccine of disease for defeating the scale of fish, and it is characterized in that, described vaccine comprises the DNA fragmentation of the gene containing coding major capsid protein according to claim 7 and pharmaceutically acceptable carrier.
16. vaccines according to any one in claim 11-15, it is characterized in that, described vaccine comprise at least one other fish disease pathogenic micro-organism or fish pathogenic virus and/or at least one other immunogenic components and/or the genetic material of other immunogenic components described of encode described fish disease pathogenic micro-organism or fish pathogenic virus.
17. vaccines according to claim 16, is characterized in that, described fish pathogenic virus or fish disease pathogenic micro-organism be selected from Vibrio anguillarum ( vibrioanguillarum), Mermaid luminous bacillus ( photobacteriumdamsela) kill fish subspecies, seawater Characters of Flexibacter Strains ( tenacibaculummaritimum), Flavobacterium kind ( flavobacteriumsp.), Flexibacter kind ( flexibactersp.), streptococcus kind ( streptococcussp.), Lactococcus garvieae ( lactococcusgarvieae), Edwardsiella tarda ( edwardsiellatarda), Edwardsiella ictaluri ( e.ictaluri), viral nervous necrosis poison, irido virus except the virus according to any one in claim 1-5 and Koi herpesvirus.
18. vaccines according to any one in claim 11-17, it is characterized in that, described vaccine comprises adjuvant.
19. antibody that can react with the virus according to any one in claim 1-5 or antiserum(antisera)s.
20. are used in for defeating the scale of fish to come off the virus according to any one in claim 1-5 in the vaccine of disease and/or major capsid protein according to claim 8 and/or DNA fragmentation according to claim 7.
21. 1 kinds for the preparation of the vaccine according to any one in claim 11-18 method, it is characterized in that, described method comprises and the virus according to any one in claim 1-5 and/or major capsid protein according to claim 8 and/or DNA fragmentation according to claim 7 being mixed with pharmaceutically acceptable carrier.
22. 1 kinds of diagnostic test reagent boxes, its for detect can with the virus according to any one in claim 1-5 or the antibody reacted with its antigen-like material, it is characterized in that, described test kit comprises virus according to any one in claim 1-5 or its antigen-like material.
23. 1 kinds of diagnostic test reagent boxes, it is for detecting virus according to any one in claim 1-5 or its antigen-like material, it is characterized in that, described test kit comprise can with the virus according to any one in claim 1-5 or the antibody reacted with its antigen-like material.
24. 1 kinds of diagnostic test reagent boxes, it, for detecting the virus according to any one in claim 1-5, is characterized in that, described test kit comprises the PCR primer set can reacted with the specific region of the MCP of SDD virus or ATP enzyme gene.
CN201480031056.1A 2013-05-31 2014-05-28 Scale drop disease (SDD) causative virus and derivatives thereof Pending CN105247043A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910622924.8A CN110438090B (en) 2013-05-31 2014-05-28 Scale shedding disease (SDD) pathogenic virus and derivatives thereof

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP13170063.5 2013-05-31
EP13170063 2013-05-31
PCT/EP2014/061014 WO2014191445A1 (en) 2013-05-31 2014-05-28 Scale drop disease (sdd) causative virus and derivatives thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201910622924.8A Division CN110438090B (en) 2013-05-31 2014-05-28 Scale shedding disease (SDD) pathogenic virus and derivatives thereof

Publications (1)

Publication Number Publication Date
CN105247043A true CN105247043A (en) 2016-01-13

Family

ID=48536728

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201480031056.1A Pending CN105247043A (en) 2013-05-31 2014-05-28 Scale drop disease (SDD) causative virus and derivatives thereof
CN201910622924.8A Active CN110438090B (en) 2013-05-31 2014-05-28 Scale shedding disease (SDD) pathogenic virus and derivatives thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201910622924.8A Active CN110438090B (en) 2013-05-31 2014-05-28 Scale shedding disease (SDD) pathogenic virus and derivatives thereof

Country Status (5)

Country Link
CN (2) CN105247043A (en)
AU (1) AU2014273183B2 (en)
MY (1) MY181007A (en)
SG (1) SG11201509830UA (en)
WO (1) WO2014191445A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108315487A (en) * 2018-04-16 2018-07-24 福建省农业科学院生物技术研究所 A kind of primer sets, kit and its application of detection common eel herpesviral
CN109890409A (en) * 2016-08-11 2019-06-14 英特维特国际股份有限公司 Novel fish Causative virus
CN111621550A (en) * 2020-06-18 2020-09-04 中国水产科学研究院黄海水产研究所 RPA reaction system suitable for rapid detection of mermaid subspecies of mermaid photobacterium
CN116121197A (en) * 2022-09-28 2023-05-16 华南农业大学 Monoclonal antibody of anti-iridovirus SDDV isolate of yellow-fin sea bream and application thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114106112B (en) * 2021-11-30 2023-07-07 西北农林科技大学 Truncated expressed Mandarin infectious spleen and kidney necrosis virus main capsid protein and application thereof
CN116004483B (en) * 2023-03-09 2023-06-02 四川厌氧生物科技有限责任公司 Lactococcus garvieae for preventing or treating diarrhea and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0195792A (en) * 1987-10-07 1989-04-13 Sapporo Breweries Ltd Novel substance 46nw-04a, production thereof and antiviral pharmaceutical containing said substance as active ingredient
WO1998042204A1 (en) * 1997-03-21 1998-10-01 Kabushiki Kaisha Yakult Honsha Infectious disease preventive/remedy for fishes and shellfishes
CN101507774A (en) * 2009-03-20 2009-08-19 宫玉泰 Traditional Chinese medicine for treating ichthyosis
WO2012130723A1 (en) * 2011-03-25 2012-10-04 Intervet International B.V. Salmonid alphavirus vaccine

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE115862T1 (en) 1989-02-04 1995-01-15 Akzo Nobel Nv TOCOLE AS A VACCINE ADJUVANT.
JP2002532559A (en) 1998-12-21 2002-10-02 アクゾ・ノベル・エヌ・ベー Method for producing inactivated W / O emulsion adjuvanted vaccine
EP1366169A2 (en) * 2000-09-15 2003-12-03 Akzo Nobel N.V. Antigenic proteins of shrimp white spot syndrome virus and uses thereof
US8343505B2 (en) * 2007-12-04 2013-01-01 Schweitzer Co., Ltd. Subunit vaccine for aquaculture

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0195792A (en) * 1987-10-07 1989-04-13 Sapporo Breweries Ltd Novel substance 46nw-04a, production thereof and antiviral pharmaceutical containing said substance as active ingredient
WO1998042204A1 (en) * 1997-03-21 1998-10-01 Kabushiki Kaisha Yakult Honsha Infectious disease preventive/remedy for fishes and shellfishes
CN101507774A (en) * 2009-03-20 2009-08-19 宫玉泰 Traditional Chinese medicine for treating ichthyosis
WO2012130723A1 (en) * 2011-03-25 2012-10-04 Intervet International B.V. Salmonid alphavirus vaccine

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
JAMES K.JANCOVICH等: "Evidence for Multiple Recent Host Species Shifts among the Ranaviruses (Family Iridoviridae)", 《JOURNAL OF VIROLOGY》 *
JUN KURITA等: "Megalocytiviruses", 《VIRUSES》 *
KETUT MAHARDIKA等: "Electron Microscopic Features of Cultured Grunt Fin Cells Infected with Megalocytivirus", 《AQUACULTURE SCI》 *
Q.W.QIN等: "Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina", 《DISEASES OF AQUATIC ORGANISMS》 *
江育林等: "患病中国大鲵中分离到一株虹彩病毒及其特性的研究", 《病毒学报》 *
萧枫等: "水生动物虹彩病毒的分子生物学", 《水生生物学报》 *
邓敏等: "鳜鱼传染性脾肾坏死病毒（ISKNV）PCR检测方法的建立及虹彩病毒新证据", 《病毒学报》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109890409A (en) * 2016-08-11 2019-06-14 英特维特国际股份有限公司 Novel fish Causative virus
CN108315487A (en) * 2018-04-16 2018-07-24 福建省农业科学院生物技术研究所 A kind of primer sets, kit and its application of detection common eel herpesviral
CN108315487B (en) * 2018-04-16 2021-06-22 福建省农业科学院生物技术研究所 Primer group and kit for detecting eel herpesvirus and application of primer group and kit
CN111621550A (en) * 2020-06-18 2020-09-04 中国水产科学研究院黄海水产研究所 RPA reaction system suitable for rapid detection of mermaid subspecies of mermaid photobacterium
CN116121197A (en) * 2022-09-28 2023-05-16 华南农业大学 Monoclonal antibody of anti-iridovirus SDDV isolate of yellow-fin sea bream and application thereof
CN116121197B (en) * 2022-09-28 2023-10-20 华南农业大学 Monoclonal antibody of anti-iridovirus SDDV isolate of yellow-fin sea bream and application thereof

Also Published As

Publication number Publication date
SG11201509830UA (en) 2015-12-30
AU2014273183B2 (en) 2017-01-19
WO2014191445A1 (en) 2014-12-04
CN110438090B (en) 2023-12-05
CN110438090A (en) 2019-11-12
AU2014273183A1 (en) 2015-11-19
MY181007A (en) 2020-12-15

Similar Documents

Publication Publication Date Title
CN105247043A (en) Scale drop disease (SDD) causative virus and derivatives thereof
CN102066407A (en) Novel avian astrovirus
CN110872578B (en) Variant infectious bursal disease virus, subunit vaccine, preparation method and application thereof
JP2015144605A (en) Infectious bronchitis vaccines derived from ib-qx-like strains
CN113943714A (en) Cat calicivirus strain and application thereof
CN111876391A (en) Feline panleukopenia virus FPV BJ05 strain and application thereof
CN105733987A (en) Mycoplasma synoviae
CN113186170B (en) Porcine rotavirus strain and inactivated vaccine prepared from same and application of porcine rotavirus strain
DK201870842A1 (en) Fish virus
CN109207436B (en) Group I type 4 avian adenovirus strain and application thereof
CN107158369B (en) Vaccine prepared by using constructed gene VII type newcastle disease virus attenuated strain
CN112574958B (en) H9 subtype avian influenza virus isolate and application thereof
RU2701808C2 (en) Broad-spectrum vaccine against avian reovirus
KR101715159B1 (en) Mycoplasma gallisepticum formulation
US20200129614A1 (en) H52 ibv vaccine with heterologous spike protein
CN107653231B (en) Duck-origin coronavirus low-virulent strain IBVDCV35 and application thereof
CN107058244B (en) Gene VII type newcastle disease virus low virulent strain constructed by P protein mutation
WO2009143332A2 (en) Poultry viral materials and methods related thereto
CN115322971A (en) Fish circovirus and application thereof
KR101757752B1 (en) Infectious bronchitis virus k40/09 strain, and vaccine for infectious bronchitis using same
CN109195624A (en) HEV vaccine
CN109439687B (en) Newcastle disease virus vector vaccine strain for expressing avian influenza H9N2 virus HA protein
KR101073991B1 (en) Avian metapneumovirus type B SC1509 strain isolated from chicken in Korea and the use thereof
CN112063596A (en) Pigeon paramyxovirus type 1 PPMV-1/BJ-C strain and application thereof
KR20200061508A (en) An attenuated avian metapneumovirus and a vaccine composition including the same

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20160113