CN109890409A - Novel fish Causative virus - Google Patents

Abstract

The present invention relates to a kind of Novel fish Causative virus for causing the disease in fish for being temporarily known as barramundi herpesviral (LCHV), the DNA fragmentation and corresponding protein of cell culture comprising the virus, the virus, the vaccine and the antibody reacted with the virus based on the virus, DNA and/or protein and the diagnostic test kits for detecting the virus.

Description

Novel fish Causative virus

Invention field

The present invention relates to a kind of Novel fish Causative virus of disease for causing fish, the cell culture comprising the virus, The DNA fragmentation and corresponding protein of the virus, based on the virus, DNA and/or protein vaccine and with the disease The antibody of poison reaction and the diagnostic test kits for detecting the virus.

General background

In nearest many decades, the swift and violent increase that fish consume in world wide is observed.This for cold water fish (such as Salmon, turbot, halibut and gadus) and tropical fish (such as Asia jewfish (barramunda), Tilapia mossambica, milk fish, Amberjack, amberjack, grouper and cobio) consumption, be impartial.Thus, it is seen that fish farm is number and size of Increase, to meet ever-increasing market demand.It is as a large amount of dynamic in what is known to such as animal husbandry, be densely living together Object easily sends out disease all types of, even almost never knows before the large-scale commercial applications pastoral age or sees or even not The disease known.The case where fish culture, is same.

In 2015, Asia jewfish (barramundi (Lates is reported in fish farm (especially in Vietnam and Singapore) Calcarifer a kind of outburst of new disease in)).Observe that fish undergoes desquamation disease-sample symptom.Desquamation disease (Scale Drop Disease) be as separate recently and the virus of the Iridoviridae described in WO2014/191445 caused by.However, using The test of desquamation disease viral DNA Specific PCR primers, these cases are that desquamation disease is negative.When field (such as in fish farm, because This is not in controlled laboratory environment) discovery when, Major Clinical sign usually relevant to this new disease (not necessarily exists These all these symptoms are seen in the fish of each illness) can be described as it is as follows.

There are the disease incidence of the clinical sign of acute attack and high percentage, many fish illness, and in clinical body It levys and makees the death rate in 4-7 days and be up to 60% (usually 30-70%).These clinical signs can be described as follows: the fishing gear of illness There are systemic cutaneous lesions, become drowsiness, and shows apparent loss of appetite.With the progress of disease, cutaneous lesions become It is more serious, lead to pale patch and the erosion of skin darkening and fin and tail, makes fish that spooky appearance be presented.Eyes become Obtain swelling and slightly muddiness.The inside sign for the disease being frequently found is spleen and kidney enlargement.Kidney becomes frangible and easy In removing.Some pale livers can be frequently observed.With the progress of disease, the gill becomes pale.

Goal of the invention

The object of the present invention is to provide the pathogen of this disease.This makes it possible to provide the inspection for being intended to fight the disease Survey method and vaccine.

Summary of the invention

It has been found that the pathogen of disease as described above is herpesviral and different herpetoviridae (Alloherpesviridae) member.It is the icosahedron viruses for belonging to double-stranded DNA virus.The virus and different blister sore The virus of malicious section has certain but low-level similitude, and the different herpetoviridae is that have to cause a disease to fish or amphibian One herpetoviridae of property.The virus of different herpetoviridae has coating, and arrives the several of multiform with icosahedron and spherical shape What shape.Their diameter is about 150-200nm.Genome is linear and non-segmentation, and length is about 100-250kbp.

Virus of the invention has the genome of about 130kbp.Fig. 1 display system tree indicates known different herpesviral Relationship between newfound virus.The new virus is referred to as barramundi herpesviral (Lates in the tree Calcarifer Herpes Virus, LCHV).The tree is made using MEGA program the 5th edition and using standard setting. (MEGA5:MolecularEvolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods.Koichiro Tamura, DanielPeterson, Nicholas Peterson, Glen Stecher, Masatoshi Nei and Sudhir Kumar.Mol.Biol.Evol.28 (10): 2731-2739.2011doi.10.1093/molbev/msr121Advance Access discloses on May 4th, 2011).

In Hanson, different herpesviral is outlined in the review paper of L et al. (Viruses 3:2160-2191,2011) Section, more particularly, in the different herpetoviridae found in fish.Herpesviral according to the present invention is at Asia jewfish (barramundi) Middle discovery.Up to the present, not yet description has pathogenic herpesviral to Asia jewfish.The virus be can not rule out to other (Asia) tropic fishes also have pathogenic.In known different 1 (Ictalurid of herpetoviridae Zhong , Channel-catfish fish herpetovirus Herpesvirus 1, IHV1) the known section member that is closest to.This virus is to channel catfish (channel catfish) It is pathogenic.However, Bing Du according to the present invention is Yu the overall sequence between Channel-catfish fish herpetovirus 1 on nucleotide level is same Property be far below 60%.To farther apart from relevant sea eel herpesviral (Anguilid Herpesvirus, AHV) and fancy carp bleb The sequence identity of viral (Koi Herpesvirus, KHV) is lower.Table 1 show identified in new herpesviral it is several Gene is compared between the homologous gene in IHV1.The table shows the most important ORF (left column) of identification, and condition is that have Be not used in sequence number less than the ORF of the identification of 300 base-pairs (in order to the table purpose but simply neglected Slightly), it is had shown that in table on DNA (for a representative example of virus, be deposited in Institute Pasteur, see below) Position, the corresponding ORF in IHV1 and with these known to ORF level of sequence identity of the sequence on amino acid levels.

The representative example of the virus has been deposited in national Culture Collection (Collection Nationale de Cultures de Microorganisms (CNCM), Institute Pasteur, 25Rue du Docteur Roux, F-75724Paris Cedex 15, France), deposit number is CNCM I-5118 (barramundi herpesviral).

Table 1: novel herpesviral is compared between IHV1

The explanation of table 1

Open reading frame (number) in ORF:LCHV

Frame: on genome reading frame (1,2,3, negative refer to opposite strand)

Length: the length of the LCHV ORF in terms of base-pair

AA length: the length that amino acid is hit in blast search

Percent amino acid identity between IHV Id.:LCHV ORF and corresponding IHV ORF

IHV-1: Channel-catfish fish herpetovirus -1

Homologue: based on the homology with known protein, by the estimation function of the LHCV ORF protein encoded.

Definition

It, such as can be from illness fish, particularly Asia when the wild-type form of provirus is the virus with replication capacity form It separates, and can be induced in the healthy fish of the kind of the fish for the virus for isolating its wild-type form identical in the jewfish of continent Disease.According to definition, the wild-type virus after inactivation or attenuation can induce disease with its wild-type form.

Isolated virus is such virus, and the virus is usually related to the virus from the diseased host of nature Tissue in discharge, and be transferred to container, such as ware, flask or biological respinse in the case where other viruses and bacteriums In device.The example of the virus of separation is the virus being present in bioreactor in the cell culture of specific cell line.

Isolated DNA fragmentation be from be such as present in corresponding, the naturally occurring biology that can be replicated it is natural (complete It is whole) DNA fragmentation that takes out in DNA.Such DNA fragmentation can so be present in stabilizing solution, or can recombinate and be transferred to separately In a kind of DNA of biology.In each case, DNA fragmentation is still separation in the sense of the present invention.

Isolated protein be from its natural surroundings take out protein, that is, be detached from its with it is corresponding it is naturally occurring can The natural combination of the biology of duplication.

Vaccine is pharmaceutical composition, is safe to host animal application, and can induce and be directed in the animal The protective immunity of pathogenic microorganisms induces successful prophylactic treatment.In the sense that, successful prophylactic treatment is Such treatment, help prevent or mitigate the pathogen infection or caused by the infection, by the treatment of disease-producing pathogens after Illness caused by attacking especially is reducing its load in host after such attack, and is optionally helping to prevent or subtract Gently one or more clinical manifestations as caused by the treatment postoperative infection of pathogen.

Open reading frame (ORF) is that have a part of the reading frame of potentiality of coding protein or peptide.ORF is continuous One section of codon is free of terminator codon.

Embodiment

In the first embodiment, which is characterized in that isolated herpesviral, the herpesviral are The member of different herpetoviridae, and it causes the disease in the jewfish of Asia with wild-type form, the genius morbi be with Lower sign (with after attack in the viral peritonaeum in laboratory environment): there is clinical sign within 3 days or so after attack, lead to skin Skin blackening and the erosion of pale asphyxia patch and fin systemic cutaneous lesions (occur with the case of significant quantity, usually more than 50%), It is drowsiness and observe forfeiture swimming balance (" observing " mean it can be seen that but not in all cases, only occur in In extremely drowsiness fish), (almost) loss of appetite, gill cover respiratory rate increases, and appearance in about 2 weeks is dead after attack.

In another embodiment, the virus has DNA, corresponds to the sequence according to SEQ ID NO:1 DNA.In practice it means that the level of sequence identity in the DNA overall length is more than 70%, preferably greater than 71,72,73,74, 75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98%, surpass Cross 99% or even as high as 100%.It is worth noting that, it is now recognized that (in 130k base-pair) near 80,000, institute Stating virus has internal repeat.Based on the homology with other herpesvirals, therefore, the virus may be with four kinds of genomes Isomers exists (as Mahiet et al. middle is explained in following: Structural variability of the Herpes Simplex Virus 1 genome In Vitro and In Vivo；Journal of Virology, in August, 2012, Volume 86, Number 16, pp 8592-8601).Except the repetition near bp 80,000, new virus may have There are one or more additional inside to repeat.But this is determined not yet.SEQ ID NO:1 corresponds to the possibility of new virus One of genome isomers.In the another embodiment of virus, in its DNA, at least 95% open reading frame is (especially The ORF comprising at least 300 base-pairs), for example, at least 96%, 97%, 98%, 99% or 100%, with have according to SEQ The corresponding open reading frame of the DNA of the sequence of ID NO:1 have at least 80% sequence identity, for example, at least 81,82,83, 84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99% or even as high as 100% identity.

It is worth noting that, in order to limit the purpose of the present invention, for determining that the suitable procedure of level of sequence identity is NCBI Basic Local Alignment Search Tool (Basic Local Alignment Search Tool) nucleotide blast program (blastn), " comparing 2 or more (Align two or more sequences) " option and standard setting are used (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

In another embodiment, the member as different herpetoviridae, isolated herpesviral, which has, is deposited in method State's Paris Institute Pasteur, national Culture Collection (CNCM), the virus that deposit number is CNCM I-5118 is extremely A kind of few identification mark.This means that the novel different herpesviral that the virus can be accredited as according to the present invention, i.e. point kiss Perch herpesviral.In another embodiment, identification mark is selected from: 1) virus has such DNA sequence dna, the DNA sequence Column over the entire length thereof with according to the sequence of SEQ ID NO:1 have at least 70% (or at least 71,72,73,74,75,76,77, 78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99% or 100%) Identity, and it is subsidiary above-mentioned about internal duplicate condition；Or 2) virus in its wild-type form is drawn in the jewfish of Asia Disease is played, the genius morbi is following sign: clinical sign occur within 3 days or so after attack, leads to skin darkening and pale Color spot block and the systemic cutaneous lesions of fin erosion (occur with the case of significant quantity, it is usually more than 50%), drowsiness and observe Losing swimming balance, (" observing " means it can be seen that but being not in all cases, to only occur in extremely drowsiness fish In), (almost) loss of appetite, gill cover respiratory rate increases, and about 2 weeks after attack dead generation occur；Or it is 3) sick Poison includes main envelope protein (MEP) gene, and the gene has at least with nucleotide sequence shown in SEQ ID NO:2 80% level of sequence identity；Or 4) virus includes dUTP enzyme gene, the dUTP enzyme gene and core shown in SEQ ID NO:4 Nucleotide sequence has at least 80% level of sequence identity；Or virus is comprising terminating enzyme gene, the termination enzyme gene and SEQ ID Nucleotide sequence shown in NO:6 has at least 80% level of sequence identity；Or virus includes pol gene, the polymerization Enzyme gene has at least 80% level of sequence identity with nucleotide sequence shown in SEQ ID NO:8.

In novel herpesviral, (it is the member of different herpetoviridae, and is drawn in the jewfish of Asia with its wild-type form Play disease) still another embodiment in, the virus is characterized in that the virus has DNA, corresponding to basis The DNA of the sequence of SEQ ID NO:1.This means that virus has such DNA, the DNA is over the entire length thereof and according to SEQ The DNA of ID No.1 has at least 70% identity (subsidiary above-mentioned about internal duplicate condition).Level of sequence identity can be more Height, for example, 71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93, 94,95,96,97,98,99% or even 100%.

In novel herpesviral, (it is the member of different herpetoviridae, and is drawn in the jewfish of Asia with its wild-type form Play disease) again in another embodiment, the virus is characterized by having DNA, wherein at least 95% open reading The frame ORF of at least 300 base-pairs (especially include), for example, at least 96%, 97%, 98%, 99% or 100% and have There is at least 80% sequence identity according to the corresponding open reading frame of the DNA of the sequence of SEQ ID NO:1, for example, at least 81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99% or even as high as 100% it is same One property.

In other embodiments, the coding DNA based on its main envelope protein (ORF28) and its dUTP enzyme (ORF 1) Sequence can distinguish the known member of new virus and different herpetoviridae.Facts proved that the main coating of the virus The even immediate MEP of other kinds of albumen and different herpetoviridae only has 30% sequence identity horizontal.DUTP enzyme Only have 45% sequence identity horizontal with the immediate dUTP enzyme of other kinds of different herpetoviridae.Encode MEP and The representative instance of the DNA sequence dna of dUTP enzyme is respectively displayed in SEQ ID NO:2 and 4.Their own amino acid sequence, i.e., by According to the protein of the DNA fragmentation of SEQ ID NO:2 and NO:4 coding, (term " by ... coding " is not excluded for other DNA and causes Identical protein, or in other words: " by specific DNA sequence encoding " means that protein can be synthesized based on particular sequence, It is also possible to by using another sequent synthesis ") it is shown in SEQ ID NO:3 and 5.It should be appreciated that being covered for this paper Specific protein, pathogen individual represent between natural variation may be present.Cause in for example main envelope protein sequence The hereditary variation of minor change is implicitly present in.It is also such for dUTP enzyme.Firstly, there are so-called " second and third bases In wave ", thus explain may occur nucleotide variation, it is described variation they encode amino acid sequence in keep not It is noted: for example, triplet TTA, TTG, TCA, TCT, TCG and TCC encode leucine.Furthermore, it is possible in amino acid sequence The Minor variations between the representative of new virus according to the present invention are seen in column.These variations can pass through one in entire sequence A or multiple amino acid of differences, or by the missing of one or more amino acid in the sequence, substitution, insertion, inversion or Addition is to reflect.For example, Neurath et al. in " The Proteins " Academic Press New York (1979) Through describing the amino acid substitution of no material change's biology and immunologic competence.Amino acid between related amino acid replaces Change, or in evolution it is recurrent replacement especially Ser/Ala, Ser/Gly, Asp/Gly, Asp/Asn, Ile/Val (referring to Dayhof, M.D., Atlas of protein sequence and structure, Nat.Biomed.Res.Found., Washington D.C., 1978, vol.5, suppl.3).Other amino acid substitutions include Asp/Glu, Thr/Ser, Ala/ Gly, Ala/Thr, Ser/Asn, Ala/Val, Thr/Phe, Ala/Pro, Lys/Arg, Leu/Ile, Leu/Val and Ala/Glu. Based on these information, Lipman and Pearson develop it is a kind of for quickly and sensitive protein compare (Science 227, 1435-1441,1985) and the method that determines the functional similarity between homologous protein.Illustrative embodiments of the invention This amino acid substitution, and the variation with missing and/or insertion are within.Why for example this explains When separating in the different representatives from virus according to the present invention, MEP and dUTP enzyme can have substantially less than 100% homology Level, while still representing MEP the or dUTP enzyme of virus according to the present invention.Usually as MEP according to the present invention or dUTP The protein of enzyme has at least 70% sequence identity with the amino acid sequence of SEQ ID NO:3 and SEQ ID NO:5 respectively, Therefore with these sequences have 70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88, 89,90,91,92,93,94,95,96,97,98,99% or even 100% sequence identity.

Therefore, the embodiment (A-G) for being related to these protein (i.e. MEP and dUTP enzyme) is specific as follows:

A: including the isolated herpesviral of main envelope protein (MEP) gene, it is characterised in that the virus is different bleb The member of Viraceae, the virus cause the disease in the jewfish of Asia, and the nucleotide sequence of MEP gene and SEQ ID NO:2 Shown in nucleotide sequence have at least 80% (such as 81,82,83,84,85,86,87,88,89,90,91,92,93,94, 95,96,97,98,99% or level of sequence identity 100%).

B: the isolated herpesviral comprising dUTP enzyme gene, it is characterised in that the virus be different herpetoviridae at Member, the virus cause the disease in the jewfish of Asia, and the nucleotide sequence of dUTP enzyme gene with as shown in SEQ ID NO:4 Nucleotide sequence have at least 80% (such as 81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96, 97,98,99% or level of sequence identity 100%).

C: the isolated herpesviral with both MEP gene and dUTP enzyme gene, which is characterized in that the core of MEP gene Nucleotide sequence and the nucleotide sequence as shown in SEQ ID NO:2 have at least 80% level of sequence identity, and dUTP enzyme The nucleotide sequence of gene and the nucleotide sequence such as SEQ ID NO:4 shown in at least 80% (such as 81,82,83, 84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99% or level of sequence identity 100%).

D: including the isolated herpesviral of main envelope protein (MEP) gene, it is characterised in that the virus is different bleb The member of Viraceae, which causes the disease in the jewfish of Asia, and MEP gene is in PCR reaction and such as SEQ ID NO: Primer sets shown in 21 and 22 are reacted to generate the PCR product of 277+/- 10 base-pair.

E: the isolated herpesviral comprising dUTP enzyme gene, it is characterised in that the virus be different herpetoviridae at Member, which causes the disease in the jewfish of Asia, and dUTP enzyme gene is in PCR reaction and as in SEQ ID NO:23 and 24 Shown in primer sets reaction to generate the PCR product of 346+/- 10 base-pair.

F: the isolated herpesviral comprising MEP gene and dUTP enzyme gene, it is characterised in that MEP gene is reacted in PCR In reacted with the primer sets as shown in SEQ ID NO:21 and 22 to generate the PCR product of 277+/- 10 base-pair, and DUTP enzyme gene is reacted in PCR reaction with the primer sets as shown in SEQ ID NO:23 and 24 to generate 346+/- 10 alkali The PCR product of base pair.

G: isolated herpesviral, it is characterised in that the nucleotide sequence of MEP gene with as shown in SEQ ID NO:2 Nucleotide sequence have at least 80% (or at least 81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96, 97,98,99% or level of sequence identity 100%), and the nucleotide sequence of dUTP enzyme gene with such as institute in SEQ ID NO:4 The nucleotide sequence shown have at least 80% (or at least 81,82,83,84,85,86,87,88,89,90,91,92,93,94, 95,96,97,98,99% or level of sequence identity 100%), and it is characterized in that viral DNA in PCR reaction and such as SEQ ID Primer sets shown in NO:21 and 22 are reacted to generate the PCR product of 277+/- 10 base-pair, and in PCR reaction and such as Primer sets shown in SEQ ID NO:23 and 24 are reacted to generate the PCR product of 346+/- 10 base-pair.

Embodiment D to G is tested using PCR-, and the PCR- test utilizes the main packet for virus according to the present invention The primer sets of membrane protein gene sequence or dUTP enzyme gene sequence.Two different primer sets are selected, sequence description is in SEQ ID NO:21-22 and SEQ ID NO:23-24.Use the first primer group (SEQ reacted with the main envelope protein gene of virus ID NO:21-22) PCR- test using two primer LCHV MEP FW and LCHV MEP REV (referring in embodiment part Table 2b).Two are used using the PCR- test for reacting the second primer sets (SEQ ID NO:23-24) with the dUTP enzyme gene of virus A primer LCHV dUTP FW and LCHV dUTP REV (referring to the table 2c in embodiment part).In embodiment part more in detail The test carefully described is standard PCR test.If to the PCR product of the first primer group analysis shows that about 277 base-pairs PCR product, or if the PCR product of the second primer sets analysis shows that the PCR product of about 346 base-pairs, and Virus is the member of different herpetoviridae and causes disease in the jewfish of Asia, then this clearly confirms that analyzed virus is root According to virus of the invention.For purposes of the present invention, the PCR product of about 277 base-pairs is with 277+10 and 277-10 The PCR product of length between a base-pair.The PCR product of about 346 base-pairs is with 346+10 and 346-10 alkali The PCR product of length between base pair.

It is related to other embodiments (H-K) to other protein (i.e. termination enzyme and polymerase) of new virus specificity It is specific as follows:

H: comprising terminate enzyme gene isolated herpesviral, it is characterised in that the virus be different herpetoviridae at Member, the virus cause the disease in the jewfish of Asia, and terminate enzyme gene in PCR reaction and as in SEQ ID NO:25 and 26 Shown in primer sets reaction to generate the PCR product of 585+/- 10 base-pair.

I: the isolated herpesviral comprising pol gene, it is characterised in that the virus be different herpetoviridae at Member, which causes the disease in the jewfish of Asia, and pol gene is in PCR reaction and as in SEQ ID NO:27 and 28 Shown in primer sets reaction to generate the PCR product of 314+/- 10 base-pair.

J: the isolated herpesviral comprising terminating enzyme gene and pol gene, it is characterised in that terminate enzyme gene and exist It is reacted with the primer sets as shown in SEQ ID NO:25 and 26 in PCR reaction to generate the PCR of 585+/- 10 base-pair production Object, and pol gene reacts in PCR reaction with the primer sets as shown in SEQ ID NO:27 and 28 to generate 314 The PCR product of +/- 10 base-pairs.

K: isolated herpesviral, it is characterised in that terminate the nucleotide sequence of enzyme gene and such as institute in SEQ ID NO:6 The nucleotide sequence shown have at least 80% (or at least 81,82,83,84,85,86,87,88,89,90,91,92,93,94, 95,96,97,98,99% or level of sequence identity 100%), and the nucleotide sequence of pol gene with such as SEQ ID NO: Nucleotide sequence shown in 8 have at least 80% (or at least 81,82,83,84,85,86,87,88,89,90,91,92,93, 94,95,96,97,98,99% or level of sequence identity 100%), and it is characterized in that viral DNA in PCR reaction and such as SEQ The reaction of primer sets shown in ID NO:25 and 26 to generate the PCR product of 585+/- 10 base-pair, and in PCR reaction with The primer sets as shown in SEQ ID NO:27 and 28 are reacted to generate the PCR product of 314+/- 10 base-pair.

Embodiment H to K is tested using PCR-, and the PCR- test utilizes the termination enzyme for virus according to the present invention The primer sets of gene order or polymerase gene sequence.Two different primer sets are selected, sequence description is in SEQ ID NO: 25-26 and SEQ ID NO:27-28.Use the first primer group (the SEQ ID NO:25- reacted with the end enzyme gene of virus 26) PCR- test uses two primer LCHV TER FW and LCHV TER REV (referring to the table 2d in embodiment part).Make Two primer LCHV are used with the PCR- test for reacting the second primer sets (SEQ IDNO:27-28) with the pol gene of virus POL FW and LCHV POLREV (referring to the table 2e in embodiment part).Test is in greater detail in embodiment part Standard PCR test.If to the PCR product of the first primer group analysis shows that the PCR product of about 585 base-pairs, or If the PCR product of the second primer sets analysis shows that the PCR product of about 314 base-pairs, and virus is different blister sore The member of malicious section simultaneously causes disease in the jewfish of Asia, then this clearly confirms that analyzed virus is disease according to the present invention Poison.

The DNA encoding sequence of main envelope protein and dUTP enzyme based on above-mentioned new virus, additionally provides of the invention Following embodiments L-O:

L: (separation) DNA fragmentation comprising encoding the gene of main envelope protein, it is characterised in that the gene with such as The nucleotide sequence of MEP gene shown in SEQ ID NO:2 have at least 80% (or at least 81,82,83,84,85,86, 87,88,89,90,91,92,93,94,95,96,97,98,99% or level of sequence identity 100%), and

M: (separation) the main envelope protein encoded by the DNA fragmentation.

N: (separation) DNA fragmentation comprising encoding the gene of dUTP enzyme, it is characterised in that the gene and such as SEQ ID The nucleotide sequence of dUTP enzyme gene shown in NO:4 have at least 80% (or at least 81,82,83,84,85,86,87,88, 89,90,91,92,93,94,95,96,97,98,99% or level of sequence identity 100%), and

O: (separation) the dUTP enzyme encoded by the DNA fragmentation.

It is now recognized that other several genes can also be used for identifying new virus according to the present invention.These genes first is that Corresponding to the gene of ORF224 (SEQ ID NO:10), encode film (sugar) albumen (SEQ ID NO:11).Still another gene The gene of Shi Yu Channel-catfish fish herpetovirus 1 (IHV1) TK (thymidine kinase) DNA homolog.In IHV-1, which corresponds to ORF5 (Hanson etc., Virology.1994Aug 1；202 (2): 659-64).The new virus has " deoxyribonucleoside kinase " Conserved domain has 33% identity with the ORF5 of IHV-1 on amino acid levels.For identifying the another of new virus One gene (SEQ ID NO:12) is the gene comprising ORF206, is encoded major capsid protein (SEQ ID NO:13).

It is the open reading frame of at least 100 nucleotide that still another embodiment according to the present invention, which is related to having length, Any (separation) DNA fragmentation, wherein the DNA and the open reading frame with the DNA according to the sequence of SEQ ID NO:1 With at least 80% (or at least 81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99% Or 100%) sequence identity.Although it have been found that the length of 30-40 nucleotide is enough to distinguish viral DNA of the invention and appoint The DNA of what public's known viruse, but practical relevant length, particularly for the corresponding subunit vaccine based on corresponding protein Practical correlation length be at least 100 nucleotide (or at least 150,200,250 or even at least 300 nucleotide), with right Ying Yu has the correlation of the related immune munogenic epitopes corresponding to virus protein and the protein of distinctiveness 3D consistency.Therefore, In another embodiment, the invention further relates to (separation) protein encoded by this DNA fragmentation.

In one embodiment, the invention further relates to cell cultures (that is, limiting the number in artificial culture vessel Type cell (also referred to as cell line) artificial culture；Also describe controlled condition of the cell except its natural environment The process of lower growth), it includes the new virus according to the present invention for capableing of replication form.Several fry cell systems may be available in Support the duplication of virus according to the present invention.The example that can be used for growing the cell line of virus according to the present invention is from Asia The cell line of jewfish brain cell.The method for separating this cell line has especially been described in the In Vitro of Hasoon et al. Cell.Dev.Biol.-Animal 47:16-25 (2011).Another may be available in the reality for the cell line for supporting virus replication Example is open by Chi et al.: " Persistent infection of betanodavirus in a novel cell line Derived from the brain tissue of barramundi Lates calcarifer ", Chi SC, Wu YC, Cheng TM, Dis Aquat Organ.2005Jun；65 (2): 91-8.PMID:16060261.It has also been determined that using routine The primary cell culture from jewfish fin of method can be used for supporting the duplication of virus.May be available in growth virus other Cell line be from skin, brain, heart, i.e. wherein virus can reproducible organ cell.

In another embodiment again, the present invention relates to the vaccines for fighting the herpesvirus disease in fish, wherein The vaccine includes herpesviral according to the present invention or immunogenic protein as described above and pharmaceutically acceptable Carrier.This carrier can be simple as water, as long as it is suitable for connect with clinically relevant amount application material without causing The side effect received.Typical carrier is the lotion of oil and water, insoluble adjuvant (usually aluminium salt or other salt or big immune Stimulate polymer molecule) suspension in water or soluble adjuvant (such as saponin(e, PAMP, carbomer or other immunostimulations point Son) solution.In general, carrier includes stabilizer and preservative well known in the art.In a further embodiment, vaccine packet Containing with attenuation (can replicate, but be no longer able to induce a full set of symptom as induced by origin wild type pathogen) living or going out The herpesviral according to the present invention of form living.

With the experimental vaccine of different Technology design herpes simplex virus.Vaccine is made up of: peptide, (recombination) disease Toxalbumin, the mixture of virus protein, complete and classification kill virus (see, for example, Yasumoto, S. et al. is in Fish Pathology 41:141-145 (2006), which depict comprising capturing the complete fancy carp bleb in the indoor inactivation in liposome area Virus), replication-defective virus and attenuation duplicating virus (such as by Koelle, D.M. and L.Corey.2003:Recent Progress in Herpes Simplex Virus Immunobiology and Vaccine Research.Clin Microbiol Rev.16 (1): 96-113 is summarized).Every kind of method has specific merits and demerits, by Stanberry Discussed in 2000 (Stanberry, L.R., A.L.Cunningham, A.Mindel, L.L.Scott, S.L.Spruance, F.Y.Aoki and C.J.Lacey.2000:Prospects for control of herpes simplex virus Disease through immunization.Clin.Infect.Dis.30:549-566.).

The serial passages in vitro of known toxicity herpes virus strains in cell culture causes to generate attenuation offspring, or In other words, it generates and causes non-toxic science strain of the protective immune response without causing Disease Clinical symptom.For example, right Become nontoxic realize as serial passages in vitro virulent virus isolate obtained by marek's disease virus (MDV) to subtract Poison, and obtain entitled Rispens or CVI988 protectiveness vaccine (Rispens BH, Vloten H, Mastenbroek N, Maas HJ, Schat KA.1972:Control of Marek ' s disease inthe Netherlands.1.Isolation of an avirulent Marek′s disease virus(strainCVI988) And its use in laboratory vaccination trials.Avian Dis.16:108-125).Correspondingly, it retouches It has stated multiple genes usually in the approach for being related to DNA replication dna and transcriptional regulatory and has participated in the attenuation again of MDV, and be future MD Rational design with therefore corresponding herpesvirus vaccine provides target.Fish herpetovirus has already been described and passes through continuous passage To be attenuated (referring particularly to Noga, E.J. et al., Can.J.Fish.Aquat.Sci.38:925-929,1981).

As it is generally known, virus attenuation can be spontaneous, or drug-induced (mutagenesis or other classes can be passed through Type, such as UV light；See, for example, Mutation Research 768,2016,53-67andJ.gen.Virol, 1985, 66,2271-2277).

Attenuation behind potential genetic mechanism usually still know little about it, but in viral genome heredity variation (mutation, Missing etc.) and/or its accumulation be herpes virus strains attenuation basis.Mutation may relate to a variety of Virus mechanisms, including duplication Ability, viral transmission etc..It may be for duplication culture not for certain molecular pathways necessary to virus replication and In vivo infection It is required, and those of participates in this classpath gene may be more likely to be genetically changed in long-term cultivation.

It is right if characterizing this random mutation and missing in genome, and with the development of next-generation sequencing technologies The whole gene group of big virus such as herpesviral, which carries out sequencing, becomes relatively easy, this makes it possible to reasonable design attenuation. From the document being attenuated about herpesviral, multiple genes have been used as possible target to occur, and wherein gene function obstacle causes The functional attenuation of virus.Roizman and Knipe gave in 2001 to be occurred in attenuated herpes simplex vaccine living Detailed overview (Roizman, B. and the D.M.Knipe:Herpes simplex of the gene of the participation virus replication of mutation Viruses and their replication, p.2399-2459. in D.M.Knipe, P.M.Howley, and D.E.Griffin (editor), Fields virology, 4th ed., vol.2.Lippincott, Philadelphia, Pa).

In addition, this mutation can be used for establishing the vaccine approach with discontinuous replication virus.The virus of mutation is in gene It is grown in engineered cell lines, the cell line is with not mutated gene needed for trans- offer.For example, when the advanced stage of missing coding gH When the herpes simplex infections incomplementarity cell of gene UL22, progeny virus particle may exit off cell but cannot infect secondary Cell (Koelle and Corey, 2003, as referenced above).

Here is the list of hsv gene, it has been described that the gene function obstacle or missing lead to fancy carp bleb The functional attenuation of viral, different herpesviral or other herpesvirals.These genes are for herpesviral according to the present invention Attenuation target gene:

1) thymidine kinase (TK) gene of Koi herpesvirus.Also retouched in channel catfish herpesviral (CCV) TK gene is stated, CCV is virus (the Hanson LA, Kousoulas relatively closely related with virus described in the present invention KG, and RL Thune.1994:Channel catfish herpesvirus (CCV) encodes a functional Thymidine kinase gene:elucidation of a point mutation that confers resistance To Ara-T.Virology 202 (2): 659-64).

2) the d-UTP enzyme gene of Koi herpesvirus.

3) gene for encoding Koi herpesvirus ORF57, as provided in Genbank accession number NC_009127, wherein ORF57 starting and terminator codon be located at position 99382 and 100803 (Boutier M, Ronsmans M, Ouyang P, Fournier G, Reschner A, et al. (2015): Rational Development of an Attenuated Recombinant CyprinidHerpesvirus 3Vaccine Using Prokaryotic Mutagenesis and In VivoBioluminescent Imaging.PLoS Pathog 11 (2): e1004690).

4) gD (the EHV en such as found in bovine herpes virus, horse herpes virus and Pseudorabies virus (pseudoabies) BHV)/gp50 (PRV) gene.Gene coding can generate the glycoprotein of neutralizing antibody for it.

The invention further relates to (be used to treat animal corresponding to prevent with vaccine prevention as described above treatment animal Wild type pathogen treat postoperative infection) method comprising by vaccine systemic administration in animal.Systemic administration vaccine is Refer to and apply the vaccine, so that it reaches the circulatory system (it includes cardiovascular and lymphatic systems) of body, to influence entire Body rather than privileged site such as gastrointestinal tract.Systemic administration can carry out as follows: for example apply antigen into musculature In (intramuscular), (intradermal) in corium, (subcutaneous) below skin, (intravenous), body cavity (under mucous membrane), in vein below mucous membrane Interior (in peritonaeum) etc..

Invention be also embodied in the antibody or antiserum that react with virus according to the present invention, and for detection and basis The diagnostic test reagent box of virus of the invention or the antibody of its antigenic substance reaction, wherein the test kit includes basis Virus of the invention or its antigenic substance.Invention be also embodied in for detecting herpesviral according to the present invention or its antigen object The diagnostic test reagent box of matter, wherein the test kit includes to react with virus according to the present invention or its antigenic substance Antibody or PCR primer group as described above.

To now it use following embodiment that the present invention is explained further.

Embodiment

Embodiment 1: discovery barramundi herpesviral

Serum and tissue sample are collected to separate infectant

Illness fish is observed in Asia jewfish (barramundi) fish farm of Singapore.Illness fish occur clinical symptoms for Seem (Gibson-Kueh et al., J Fish Dis.2012Jan similar to desquamation disease for fisherman；35 (1): 19-27.doi: 10.1111/j.1365-2761.2011.01319.x.PMID:22103767；De Groof et al., PLoS Pathog.2015Aug 7；11 (8): e1005074.doi:10.1371/journal.ppat.1005074.PMID: 26252390)。

However, when more closely study of disease symptom, it appears that illness fish shows infection (3-10 days of more extra urgaent dispatch Rather than more than 15 days) and there is higher disease incidence.Compared with desquamation disease, cutaneous lesions seriousness is lower, but more whole body Property.Skin injury is hurt with desquamation disease damage the difference is that whole fish becomes darker and more blunt, and has pale asphyxia The patch of mucus.Observe that some scales are lost, but this is not significant, nor main clinical sign.This is different from by taking off Scale caused by squama disease virus is lost, and with locality, patchy damage, the damage is more seriously by downright bad shadow It rings and there is serious scale to lose.Desquamation disease virus can generally also cause more chronic outburst.Based on the difference observed And desquamation disease virus PCR the fact that provide negative findings, suspect that there are different based on the clinical observation to impacted fish farm The infectious virus factor.It determines that carrying out purpose is the follow-up study of virus purification, and finds a kind of new virus.

Other than scale is lost, to illness fish other observation is that drowsiness, serious loss of appetite, eyes it is muddy/ The acute attack of swelling and high mortality (the illness fish of up to 30-70%).(serum, kidney, spleen) is sampled from illness fish.It will close And blood serum sample -70 DEG C save, until further analysis.Combined kidney samples A is maintained at+4 DEG C until second day even Slurry.

The tissue of tissue sample is homogenized for separating infectant

By in the SVDB (standard vaccine dilution buffer=PBS) using homogenate stick hand-ground by kidney sample homogenization, And finally sample is diluted in SVDB with 1: 9 (w/v), and is then pre-processed 1 hour in gentamicin.By the sample of homogenate Product are centrifuged 10 minutes at 5,500rpm ,+4 DEG C, and then collect cell-free supernatants.

In the previous day of inoculation single layer, by jewfish brain (SBB) cell with 2 × 10⁴A cell/cm²It is inoculated in T75 flask EMEM+10%FBS+ gentamicin+anphotericin in.For the experiment, cell is grown in the medium, in the culture medium It is additionally added HEPES and sodium bicarbonate, and optimizes cell in no CO₂These under the conditions of grow.Second day, by culture medium (15mL) is changed to fresh culture, and the undiluted cell-free supernatants of 0.1mL or 0.3mL are added in Xiang Suoshu culture medium.It will Flask is incubated at 28 DEG C.It is added in the flask of undiluted cell-free supernatants (both 0.1 and 0.3mL) and sees wherein after 3 days CPE is observed, and in the 5th day harvest (1st generation).The infectant that will assume is named as V511.According to above scheme, will cause The factor of CPE passes on 3 times again on SBB cell.The factor of CPE is caused to be named as V511/SBB_4P.

To the viral diagnosis of the culture supernatant for the factor for causing CPE in the cell and serum of illness fish

It is analyzed using the VIDISCA-454 technology described by De Vries et al. (2011) PLoS ONE 6 (1): e16118 The culture supernatants of the blood serum sample of illness fish and the 4th generation cutting V511/SBB_4P of the factor for causing CPE.At two kinds In the sample of type, the sequence suspected and be originated from Novel fish pathogen is all obtained.These sequences are used for derivative and are used for Standard PCR With the PCR primer of quantitative PCR (referring to table 2a-e).BLAST is carried out to new sequence to show to cause CPE's in culture supernatant The infectant suspected in the factor and serum shows the homology with the certain level of the virus of different herpetoviridae.It is this new Virus therefore referred to as barramundi herpesviral (LCHV).

Genome sequencing

By Virus culture supernatant samples with 10,000 × g is centrifuged 10 minutes, and uses TurboDNase as described (Thermofisher) processing (de Vries M, et al. PLoS One.2011；6 (1): e16118.doi.10.1371/ Journal.pone.0016118), later by Boom extraction method extract nucleic acid (Boom R, et al. J Clin Microbiol.1990；28 (3): 495-503).Use dsDNA fragmentation enzyme (New England Biolabs) shear sample. The sample of shearing is with AMPure XP bead (agencourt AMPure XP PCR, Beckman Coulter) with 1: 1.8 ratio Example (sample: bead) purifying is to remove enzyme.After purification, with DNA polymerase i, big (Klenow) segment (New England Biolabs sample) is subjected to end reparation.With AMPure XP bead (agencourt AMPure XP PCR, Beckman Coulter) then the sample repaired with 1: 1.8 ratio (sample: bead) purifying end uses Klenow segment to remove enzyme Sample is added A tail by (3 ', 5 ' Exo-) (New England Biolabs).With AMPure XP bead (agencourt AMPure XP PCR, Beckman Coulter) with ratio (sample: bead) purification of samples of 1:1.8 to remove polymerase.By using T4 ligase (Thermofisher) will come from NEBNext Multiplex Oligos for Illumina (New England Biolabs) blister adapter (Bubble adaptors) be connected to plus A tail sample on.By using AMPure XP bead (agencourt AMPure XP PCR, Beckman Coulter) carry out size selection, wherein first with 1: 0.5 ratio (sample: bead), to ensure that most of sizes are more than that the segment of 400bp is removed, then by will be other AMPure XP bead (agencourt AMPure XP PCR, Beckman Coulter) is added to supernatant and reaches 1: 0.85 The final ratio of (sample: bead), to combine the DNA fragmentation between 200-400bp and remove the segment less than 200bp.Big After small selection, by using from NEBNext Multiplex Oligos for Illumina (New England Biolabs USER enzyme) opens blister adapter.Next, with NEBNext Multiplex Oligos for is come from The adapter specific primer and Q5 thermal starting main mixture (New England of Illumina (New England Biolabs) Biolabs the PCR of 28 circulations) is carried out；30 seconds 98 DEG C and 10 seconds 98 DEG C and 75 seconds 65 DEG C of circulations, are then 5 minutes 65 ℃.After PCR, by using AMPure XP bead (agencourt AMPure XP PCR, Beckman Coulter), with 1: 0.5 ratio (sample: bead) carries out size selection to sample, to remove the segment that size is more than 400bp, and to supernatant The other AMPure XP bead (agencourt AMPure XP PCR, Beckman Coulter) of middle addition is to reach 1: 0.85 final ratio (sample: bead) is to combine the DNA fragmentation between 200-400bp and remove the segment less than 200bp.It connects Get off, DNA concentration is measured by Qubit dsDNA HS assay kit (Thermofisher), with highly sensitive DNA analysis Kit checks size on biological analyser.DNA is diluted to the concentration of 2.49ng/ μ l.By using paired end sequencing With v2 kit (Illumina), they are sequenced using MiSeq (Illumina).

Phylogenetic analysis

The DNA of 208bp of the initial system evolutionary analysis based on the barramundi herpesviral found in outbreak of disease sample Segment (SEQ ID NO:14).The segment be shown in Shang the nucleotide level of translation Yu Channel-catfish fish herpetovirus 1NP_041153.2 and The homology of the ORF62 of other fish virus.Using BLAST basic Local Alignment Search Tool (http: // Blast.ncbi.nlm.nih.gov/Blast.cgi) and Multiple Sequence Alignment tool ClustalW generates nucleotide and protein sequence Column compare.Systematic evolution tree is created using adjacent method with MEGA5 software, in the case where notch or insertion there is part to delete (MEGA5:Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods.Koichiro Tamura, Daniel Peterson, Nicholas Peterson, Glen Stecher.Masatoshi Nei and Sudhir Kumar.Mol.Biol.Evol.2011 28 (10): 2731-2739.2011 doi:10.1093/molbev/msr121).It should The result of phylogenetic analysis is as shown in Figure 1, which depict the homologous of 208bp DNA fragmentation and IHV1 ORF62 based on LCHV Property analysis LCHV systematic evolution tree.Phylogenetic analysis confirms that LCHV is the newfound virus in different herpetoviridae.

Embodiment 2: PCR, qPCR analysis detection barramundi herpesviral are used

Design of primers

PCR primer is designed on the DNA fragmentation of the 208bp of the barramundi herpesviral found in outbreak of disease sample.It should Segment is shown in the homology of the ORF62 of Yu Channel-catfish fish herpetovirus 1NP_041153.2 Shang the nucleotide level of translation.Also exist MEP, dUTP enzyme terminate design primer on enzyme and pol gene.

Table 2a: the primer designed on the 208bp DNA fragmentation of barramundi herpesviral

Table 2b: the primer designed on the MEP of barramundi herpesviral

Table 2c: the primer designed on barramundi herpesviral dUTP enzyme

Table 2d: the primer designed on enzyme is terminated in barramundi herpesviral

Table 2e: the primer designed on barramundi herpesviral polymerase

PCR and gel electrophoresis

Standard PCR is carried out using 96 hole thermal cycler of Veriti (Applied Biosystems).Preparation includes 1x Supertaq buffer, 0.02U/ μ l Supertaq enzyme, 0.2mM deoxyribonucleoside triphosphate (dNTP), 1 μM of forward direction and 1 μM The main mixture of reverse primer.For each sample, 2.0 μ l DNA profilings are added in 48 μ l PCR mixtures, 2 μ L are sterile Water is used as negative control.It PCR program is designed, is initialized and is started with 95 DEG C for 60 seconds, then the Tm at 95 DEG C, based on primer respectively It is denaturalized, annealed and extended at primer group-specific annealing temperature and 72 DEG C, repeated 40 times.The program is finally to prolong at 72 DEG C Stretching 10 minutes terminates.Sample is loaded in 1.5% Ago-Gel and 1x TAE buffer together with 1x ethidium bromide, with 115 volts continue 60 minutes.

QPCR analysis

Quantitative polyase chain reaction is carried out using 96 system of BioRad CFX.Using Probe Fast Master Mix and Sequence-specific probes carry out qPCR experiment.There are 18 μ l main mixtures for each reaction, contain 1x Probe Fast q-PCR Master Mix (KAPA), 200nM forward primer, 200nM reverse primer and 200nM probe.Primer pair 2 is analyzed for qPCR, And the Tm of optimization is 60.7 DEG C.DNA probe sequence is CGCGGGATGACCTCTTCTCG (SEQ ID NO:31), the label used It is 5 ' 6FAM and 3 ' TAMRA.2 μ l DNA profilings are added into 18 μ l main mixtures.Each reaction is duplicate to be carried out, and institute There is plate to be centrifuged under 2,200 × g 4 minutes, is inserted into CFX system.It is expanded using following procedure, continues 3 with 95.0 DEG C Minute start, it is then for 3 seconds at 95.0 DEG C and continue 30 seconds at 60.7 DEG C, it repeats 40 times.

Normal line

By containing there is barramundi herpesviral-identity-sequence construct pUC57 carrier (to close by GenScript At [synthesize 208bp segment as described above and be cloned in plasmid vector]) dilution series be used as positive control, be used for efficiency With accuracy and for the indicant of sample amounts.Carrier is dissolved and is diluted in water, range is each qPCR reaction 1.0 ×10¹Copy/2 μ L to 1.0 × 10⁹Copy/2 μ L.Dilution series are included in all qPCR experiments and are stored in -20 DEG C.Pass through It supports software (CFX-Manager version 3 .1), complete quantifying for the barramundi herpes virus DNA in sample, which uses next Normal line is created from the acquisition data of dilution series.All qPCR experiment display efficiency carried out is in 98.0% and 100.2% Between, and accuracy highlights the robustness of the qPCR method designed for quantitative LCHV DNA between 0.997 and 0.999.

Embodiment 3: the experimental infection of novel infectant in the jewfish of Asia

The experimental infection of V511/SBB_4P in Asia jewfish (barramundi)

In this experiment, it is carried out in the peritonaeum of fish with V511 and commensalism is infected, to study whether V511 is that field disease is quick-fried The reason of hair.Different Organs are sampled to determine course of infection in different time points after infection.

Table 3: processing group and sink distribution

Sink	Group	Dosage (IP)	Fish number
				1A	V511/SBB_4P- is not incorporated into	0.3mL	25
1B	Commensalism	-	25

One group of 25 Asia jewfish injects what 0.3mL was grown on SBB cell line V511/SBB_4P by (IP) in peritonaeum Undiluted V511 cell-free supernatants (CFS) are attacked.The virus titer of CSF is 3.2 × 10⁶ TCID₅₀(the titration side /mL Case sees below).The commensalism (table 3) in the same sink separated by net of second group of 25 fish.The net allows two sink half portions Between water move freely and allow close, but do not allow directly to contact between the fishes of two processing groups.Start in experiment When, the average weight of fish is 18 grams.

By fish starvation about 24 hours before attack, to ensure to empty gastrointestinal tract to reduce risk of injury.Before attack according to Standardization program anaesthetizes fish with Aqui-S calmness.Fishnet in IP attack group is caught, it is calm and in the base portion and point of abdomeinal fin Middle line between end carries out IP injection.After attack, fish is put into specified sink and restores and observe.The commensalism fish quilt being uninfected by Introduce the adjacent sink subregion separated by net.

Record the death rate and clinical sign.The 4th day, the 7th day, the 11st day, the 14th day and the 18th day after attack, by commensalism 3 fish grab sample in group simultaneously perform an autopsy on sb. to collect fish tissues for further test.Sampling includes spleen, the heart, brain, blood Clearly, liver, intestines, the gill, skin and kidney pass through the metainfective course of infection of natural way to be best understood from the new factor.

The 4th day, the 7th day, the 11st day and the 14th day after attack, 3 fishes in grab sample IP infected group simultaneously carry out corpse Inspection is to collect nephridial tissue for further testing.At the 17th day, spleen, the heart, brain, serum, liver are obtained from the fish of 3 experimental infections Dirty, intestines, the gill, skin and kidney samples A.The 18th day after attack, all fishes are sampled or have died of infection (being shown in Table 6).Sample Collection is summarised in table 4 and table 5.

Table 4: the sampling of fish tissues in experiment IP infected group

The metainfective number of days of IP	IP infection.Combined organ (3 fish/consolidated materials)
		4、7、11、14	Kidney
17	Kidney, spleen, heart and brain, serum, liver, intestines, the gill, skin

Table 5: the sampling of fish tissues in commensalism group

The clinical sign observed in processing group is attacked in table 6:IP and commensalism

The IP as the result is shown provided in table 6 and commensalism attack approach can be generated to be observed in mark Asia jewfish fish farm To those of similar clinical sign.The overall clinical sign observed is drowsiness, loss of appetite, skin, fin and Eye disease, It is also similarly observed in the illness cultured fishes in mark fish farm.

This shows in controlled laboratory environment (when compared with field conditions such as fish farm, wherein other are not present Pathogen and there are less stressors), the classical symptom after (IP) attack is 1) 3 days or so clinical signs breaking-out after attack, 2) whole skin lesion, may cause skin darkening and rotten to the corn with pale asphyxia patch and fin, and 3) it is lost due to extremely drowsiness Go swimming balance, 4) almost loss of appetite, 5) gill cover respiratory rate increases and occurs within about 2 weeks after 6) attacking the generation of death. Eyes swelling and muddiness can be observed in some fishes.The death rate and percentage cumulative mortality record are shown in table 7.

Table 7: daily mortality and percentage cumulative mortality record *

It * does not include the fish sampled for collecting tissue.

V511/SBB_4P vial supernatant propagates to originally from the fish of IP attackCommensalism fish.Two groups are all undergone Similar clinical symptoms.Clinical symptoms those of are also observed to mark fish farm (first outburst) similar.Compared with commensalism group, IP Infected group undergoes more acute and serious disease, wherein there are disease signs in 3 days after infection.In contrast, commensalism is attacked Fish shows primary clinical sign on the 7th day after infection.

Use the infectious material for the tissue samples collected during the leisure field morbidity survey of source, and then external Object is passed on, we can be replicated in the clinical symptoms that burst period is observed by IP and commensalism route of infection.Have also demonstrated disease Disease travels to the originally fish of the commensalism in same waters from the fish that IP infects, it is thus identified that the infectiousness of this pathogen.

Embodiment 4: sample preparation, the tissue homogenate, DNA points for the tissue sample collected during infection experiment (embodiment 3) From

The homogenate of organ samples

Using 24 homogenizer instrument of Precellys, the fish organ samples collected in above-mentioned experiment (table 4,5) is homogenized. Using there are two programs recycled 6,500rpm 20 seconds and be spaced 10 seconds, prepare 10% in phosphate buffered saline (PBS) (PBS) Organ homogenate.The homogenate of the heart, spleen, kidney, brain, intestines and liver specimens is completed in a cycle, by skin and gill sample homogenization Twice.All samples are kept on ice in homogenization process and are stored in -80 DEG C.

DNA is extracted

DNA extraction is carried out using 96 system of MagNA Pure and MagNA Pure 96DNA and Viral NA kit. In order to extract, 250 μ l MagNAPure, 96 outside lysis buffer is added in 200 μ l samples.With preassembled outside Cracking scheme separates DNA, and elutes in 50 μ l Milli-Q water.DNA is saved at -20 DEG C, until further using.

Embodiment 5: Virus culture and titration of virus

The foundation and culture of jewfish brain (SBB) cell line:

Cell line SBB is initially in Intervet Norbio Singapore Pte Ltd (a part of MSD AH) source From the suspension of the trypsin digestion of Asia jewfish brain cell.Via Hasoon et al. in In Vitro Cell.Dev.Biol.-Animal 47:16-25 (2011) and by Chi et al., Dis Aquat Organ.2005Jun；65 (2): 91-8 describes the derivative program of jewfish brain cell.

SBB culture medium is supplemented with E-MEM, 100ml of 2mM L-Glutamine and 110mg/L Sodium Pyruvate by 899ml FCS (10%) and (optional) 1mL neomycin polymyxins antibiotic solution 1000x liquid storage composition.Cell is usually at 28 DEG C and 5% CO₂Lower growth.

Culture medium is maintained at 4 DEG C before culture starting.Start to cultivate using an ampoule cryogenic liquid storage SBB.By Ampoule is warmed in 28 DEG C of water carrys out cell of the quick-thawing from liquid nitrogen.Cell suspending liquid is added in pipe and with the training of 9 volumes Feeding base slowly dilutes.Then, cell is counted.Suspension is assigned in suitable culture bottle or roller bottle, and at 28 DEG C and 5% CO₂Lower incubation.Inoculum density in flask or roller bottle is about 3 × 10⁴A cell/cm².Adhere to completely 6-24 hours or cell Afterwards, update culture medium to remove remaining DMSO (freezing culture medium is made of 90% culture medium and 10%DMSO).By cell into One step is incubated for 3-7 days or converges until reaching.For roller bottle, the roller revolving speed of 0.2-0.5rpm is needed.Roller bottle can have 480,960 And 1750cm²Different surfaces product.

Converge once reaching, cell is passed on.It can once be passed on every 3-4 days, and Initial seeding density is 3.0×10⁴A cell/cm².Alternatively, when with 1.0 × 10⁴A cell/cm²Density bed board when, can once be passed with every 7 days Generation.The reagent (culture medium, PBS, trypsase/EDTA) for being used for cell passage is preheated to 28 DEG C.Discard culture medium, and with suitable When the single layer that PBS (3mL is used for T25 flask) washing of volume converges is primary.PBS then is discarded, and by cell in same volume PBS in be incubated for 15 minutes at 28 DEG C, the PBS is supplemented with 2.5% trypsin solution and 1% of 1% (vol/vol) (vol/vol) 2%EDTA solution.After disengaging, the fresh culture of same volume is added, and cell is resuspended and counts.Suitable In the volume of culture for closing culture bottle or roller bottle, new flask is set with required cell density.

For frozen cell, before the procedure, (80% (vol/vo1) is trained the freezing culture medium that culture medium and 2x are concentrated Feeding base adds 20% (vol/vol) DMSO) it is maintained at 4 DEG C.Processing converges cell culture until and including tryptose as described above Enzymic digestion.Cell is resuspended, counts, is further resuspended in suitable culture medium, and isometric 2 × freezing training is added dropwise Support base, while the suspension that is vortexed.Ampoule per ampoule 5.25 × 10 for liquid nitrogen storage⁶The filling of a cell with start T175 or With 2.25 × 10⁶A cell filling is to start T75.

SBB cell is inoculated with barramundi herpesviral

Before establishing inoculation experiments, it will be passed at least once from the cell of liquid nitrogen storage culture.With 3.0 × 10⁴It is a Cell/cm²Before being seeded in tissue culture flasks, cell is passed on and is cultivated 24 hours.Inoculum is by from the first forward pass of virus For fresh or freeze thawing culture the undiluted supernatant composition of object.Culture medium is taken out from flask.By flask then at 28 DEG C Lower inoculation at least 60 minutes.

When using the cutting inoculating cell of previous passage object of LCHV virus in the medium, it is preferable to use every cell 0.001-0.01TCID₅₀MOI.

It removes after inoculum (after sixty minutes, although this is not absolutely to require), fresh culture is added and to cultivate cell straight Observe complete CPE to using inverted light microscope (usually after 2-4 days).By collecting culture supernatant harvest virus, By the culture supernatant with 800 × g centrifugation 5 minutes to remove fragment.Alternatively, supernatant can be made to clarify by filtering.It will Clear supernatant is freezed for subsequent passage or PCR/DNA/EM analysis or at -70 DEG C.(quantitative) PCR analysis can be used And/or cutting titrates the duplication to confirm virus.DNA sequencing technology is used to confirm the feature and EM of virus.

Using 96 system of MagNA Pure and MagNA Pure 96DNA and Viral NA kit (embodiment 4) from group Knit the DNA that separation in culture medium is used for (quantitative) PCR.

Virus is titrated on SBB cell

Culture SBB cell as described above.It one day before testing, prepares in culture medium (EMEM+10%FCS+L-Glu+ NaPyr contain 6.0 × 10 in)⁴The SBB cell suspending liquid of a cell/mL.Microtitration is inoculated with 100 μ L cell suspending liquids 96 holes of plate.By plate in 28 DEG C and 5%CO₂It is lower to be incubated for 24 hours.After the incubation period, single layer is about 50% to converge.

On the day of test, by it is following prepare each viral sample until 10^-710 times of serial dilutions: by 0.5mL Sample is transferred to containing ice-cold (0-20 DEG C) titration culture medium (culture medium with reduced FCS of 4.5mL；50%EMEM+L- Glu+NaPyr+50% culture medium) pipe in, mix and shift 0.5mL containing 4.5mL titration culture medium next pipe in, Then carefully mixing, transfer etc..1st column and the 12nd column and A and H row are used as negative control, and with the 100 fresh titration in the hole μ L/ Culture medium inoculated.With the viral dilution (10 in 100 holes μ L/^-2、10^-3、10^-4、10^-5、10^-6、10^-7) B to G row (10 holes/ Dilution) inoculation microtiter plate.During processing, the temperature of viral dilution is maintained between 0 DEG C to 20 DEG C.By plate 28 DEG C and 5%CO₂It is lower to be incubated for 6 days.After 6 days virus incubation phases, with the LCHV specificity of inverted light microscope screening flat board CPE.CPE is characterized in that gathering for cell, followed by cell detachment/cracking (Fig. 2).Show each of LCHV specific C PE Hole is cited as the positive.TCID_5oIt is measured according to by methods as described below and calculating: Reed and Muench, Am.J.Epidemiol. (1938) 27 (3): 493-497.QPCR points of the DNA sample separated in titration determination from positive hole Analysis confirms the presence and duplication of virus.

As a result

By tissue culture flasks with 3.0x 10⁴A cell/cm²It is inoculated with and cultivates 24 hours.After 24 hours, disappear in trypsase The cell in a flask is counted after change to determine practical cell number present in flask.It is taken from other flasks being then inoculated with Culture medium out.It will be by the not dilute of the previous passage object (viral passage number is between 4-8) from LCHV virus in the medium The 0.001TCID for the culture supernatant composition released_5oThe inoculum of/cell is applied to single layer, and is incubated for 60 minutes.Remove inoculation Object, and fresh culture is added in Tissue Culture Flask.Culture cell using inverted light microscope until observed completely CPE.By collecting culture supernatant harvest virus, by the culture supernatant with 800 × g centrifugation 5 minutes to remove fragment.Sample Product are derived from (1) for infecting undiluted inoculum, (2) 1 hour harvest after replacing inoculum with fresh culture of single layer The culture supernatant of culture bottle, the single layer of (3) 50%CPE and the single layer of (4) 100%CPE.To sample (1), (3) and (4) into Row titration, and qPCR analysis is carried out to sample (1), (2), (3) and (4).As a result it is shown in Table 8.It is fallen using Olympus CKX41 It sets optical microscopy and photo is shot with 40x magnifying power.These are shown in Fig. 2.Fig. 2A shows the 90% SBB cell converged (p18) form and Fig. 2 B is shown in the form of the SBB cell (p18) of 50%CPE in culture bottle.

Table 8: the detailed results that LCHV is grown on SBB cell

* it NA: does not analyze

Embodiment 6: electron microscopy

Electron microscopy

The 400 mesh copper mesh with pure carbon film are exposed to the glow discharge in air 20 seconds, so that film surface be made to become parent Water.Viral sample is placed on carbon-coated grid, volume is 10 μ l, and places incubation about 2 minutes.It is sucked with filter paper excessive Sample, and 10 μ l water are placed on grid and are removed again immediately by blotting.Then 1% uranyl acetate of 10 μ l is placed on For dyeing on grid.After 30 seconds, excessive dyestuff is removed by blotting, and sample is placed to dry a few minutes, then existed Observed under electron microscope.Sample is observed in 1011 transmission electron microscope of JEOL run with 80kV.Use SIS Veleta 2kx2k camera record image.

Using the photo of 1011 transmission electron microscope of JEOL capture LCHV culture samples, with the virus of identification It is herpesviral and the presence for excluding any other virus.With 0.01 MOI LCHV the 5th pickup kind SBB (p9) cell.Harvest Afterwards, virus is saved in -80 DEG C of culture medium, and obtaining titre is 10^4.43TCID_5o/mL.1 μ l sample is prepared for electronics Microscopy, wherein two pictures are shown in Fig. 3.In figure A, the dim spot that two approximate diameters are 100nm can be observed, Match with the average diameter (115-130nm) of common herpesviral capsid.Figure B shows enlarged drawing, wherein can be clearly Observe the icosahedron profile of the particle.Do not have to find the virus of coating in sample.

Fig. 3 shows the LCHV virus captured with electron microscope.In figure 3 a, two kinds of herpesvirals (dim spot) are can to know It is other.Scale bar is 500nm.Fig. 3 B shows the enlarged drawing of one of described spot, clearly demonstrates icosahedron profile.

Above embodiment described detect and separate new pathogen from illness fish.It is infected with isolated pathogen experiment After healthy fish, identical disease symptoms can be reproduced.The disease of the infectant and initial separation that are separated from the fish of experimental infection Substance is identical.This proves above-mentioned disease symptoms due merely to the pathogen found, i.e. barramundi herpesviral.

Embodiment 7: primary cell culture jewfish fin cell

It establishes and comes fromJewfishThe primary cell culture of fin cell (SBF).Cell is cultivated at least 5 in culture Generation.

Culture is established as follows.Fish is anaesthetized.Trim tail fin (tail portion) and in PBS+ gentamicin 0.3%+ Enrofloxacin It is washed three times in 0.002%+ anphotericin 0.5%.Fin is cut into fragment of tissue using knife blade.By fragment be transferred to containing The 25cm of L15 culture medium²In tissue culture flasks, the L15 culture medium is supplemented with 20%FCS and gentamicin 0.3%+ En Nuosha Star 0.002%+ anphotericin 0.5%.By flask in the incubator of humidification (no CO at 28 DEG C₂) in be incubated for.Based on there are broken Piece and pH replace culture medium (L15) as needed.It is passed on carefully with 0.125% trypsase by trypsin digestion in PBS Born of the same parents depend on cell density up to cell detachment, are separated with 1: 1-3 low ratio.During initial passage, cell is existed It is supplemented in the L15 culture medium of 20%FCS and cultivates.In subsequent passage, FCS percentage is reduced to 10%.

The inoculation of barramundi herpesviral is carried out using program as described in example 5 above.It observes within the 4th day after infection 100%CPE.

Embodiment 8: the additional strain of new virus

Sick fish sample observes barramundi herpesvirus infection from the fish farm for being different from mark fish farm in the fish farm Clinical symptoms.However, using PCR points of primer sets 2 described in embodiment 2 (SEQ ID NO:17 and SEQ ID NO:18) Analysis produces negative PCR results.As an alternative, based on polymerase (ORF21) and enzyme (ORF37) sequence will be terminated (with it His different herpetoviridae compares the ORF of the conservation of amino acids with relative high levels) primer sets of design are used for PCR.For The primer of PCR is presented in table 2d and 2e.

These PCR generate positive findings.It is sequenced to enzyme PCR fragment is terminated, and shown in display and SEQ ID NO:1 Barramundi herpesviral sequence 97% identity.SEQ ID NO:29 is presented as shown in SEQ ID NO:1 The PCR product of the termination enzyme PCR of LCHV.SEQ ID NO:30 shows the LCHV's obtained from the fish farm for being different from Tagging fish field Terminate the PCR product of enzyme PCR.Conclusion is that the outburst of disease is caused by another strain of LCHV.

PCT

Only used by Receiving Office

Only used by international office

Claims (27)

1. isolated herpesviral is the member of different herpetoviridae, and caused in the jewfish of Asia with its wild-type form Disease, the disease is characterized in that following sign: clinical sign breaking-out in 3 days or so after attack leads to skin darkening and companion There is the whole skin lesion of pale asphyxia patch and fin erosion, it is drowsiness to lose swimming balance, loss of appetite, the gill cover with what is observed Respiratory rate increases, and generation in about 2 weeks is dead after attack.

2. isolated herpesviral according to claim 1, which is characterized in that it is described virus have DNA, over the entire length thereof with There is at least 70% identity with the DNA according to the sequence of SEQ ID NO:1.

3. isolated herpesviral according to claim 2, which is characterized in that in the DNA of the virus, at least 95% is opened Put the sequence identity that reading frame has at least 80% to the corresponding open reading frame of the DNA of the sequence with SEQ ID NO:1.

4. isolated herpesviral is the member of different herpetoviridae, the virus has with deposit number CNCM I-5118 guarantor Paris, FRA Institute Pasteur is ensconced, at least one identification of the virus of national Culture Collection (CNCM) is special Sign.

5. isolated herpesviral according to claim 4, which is characterized in that the identification mark is selected from:

It is described virus have DNA sequence dna, over the entire length thereof with according to the sequence of SEQ ID NO:1 at least 70% it is same One property；

The virus causes the disease in the jewfish of Asia with its wild-type form, and the genius morbi is following sign: after attack Clinical sign breaking-out in 3 days or so, leads to skin darkening and with the whole skin lesion of pale asphyxia patch and fin erosion, drowsiness companion There is that observes to lose swimming balance, loss of appetite, gill cover respiratory rate increases, and generation in about 2 weeks is dead after attack；

The virus includes main envelope protein (MEP) gene, is had with the nucleotide sequence as shown in SEQ ID NO:2 There is at least 80% level of sequence identity；

The virus includes dUTP enzyme gene, with the nucleotide sequence as shown in SEQ ID NO:4 at least 80% Level of sequence identity；

The virus is comprising terminating enzyme gene, with the nucleotide sequence as shown in SEQ ID NO:6 at least 80% Level of sequence identity；

The virus includes pol gene, with the nucleotide sequence as shown in SEQ ID NO:8 at least 80% Level of sequence identity.

6. isolated herpesviral is the member of different herpetoviridae and is caused in the jewfish of Asia with its wild-type form Disease, which is characterized in that the virus has DNA, over the entire length thereof with there is the DNA according to the sequence of SEQ ID NO:1 With at least 70% identity.

7. isolated herpesviral is the member of different herpetoviridae and is caused in the jewfish of Asia with its wild-type form Disease, which is characterized in that the virus is with DNA, wherein at least 95% open reading frame and with according to SEQ ID NO:1 Sequence DNA corresponding open reading frame have at least 80% sequence identity.

8. isolated herpesviral, it includes main envelope protein (MEP) genes, it is characterised in that:

A) virus is the member of different herpetoviridae；

B) virus causes the disease in the jewfish of Asia；

C) nucleotide sequence of the MEP gene and the nucleotide sequence as shown in SEQ ID NO:2 are at least 80% Level of sequence identity.

9. isolated herpesviral, it includes dUTP enzyme genes, it is characterised in that:

A) virus is the member of different herpetoviridae；

B) virus causes the disease in the jewfish of Asia；

C) nucleotide sequence of the dUTP enzyme gene and the nucleotide sequence as shown in SEQ ID NO:4 have at least 80% Level of sequence identity.

10. according to the isolated herpesviral of claim 8 or 9, wherein the virus comprising main envelope protein gene and DUTP enzyme gene, which is characterized in that the nucleotide sequence of the MEP gene and the nucleotides sequence as shown in SEQ ID NO:2 Arrange have at least 80% level of sequence identity, and the nucleotide sequence of the dUTP enzyme gene with such as institute in SEQ ID NO:4 The nucleotide sequence shown has at least 80% level of sequence identity.

11. isolated herpesviral, it includes main envelope protein (MEP) genes, it is characterised in that:

A) virus is the member of different herpetoviridae；

B) virus causes the disease in the jewfish of Asia；

C) the MEP gene reacts in PCR reaction with the primer sets as shown in SEQ ID NO:21 and 22 to generate 277 The PCR product of +/- 10 base-pairs.

12. isolated herpesviral, it includes dUTP enzyme genes, it is characterised in that:

A) virus is the member of different herpetoviridae；

B) virus causes the disease in the jewfish of Asia；

C) the dUTP enzyme gene is reacted in PCR reaction with the primer sets as shown in SEQ ID NO:23 and 24 to generate The PCR product of 346+/- 10 base-pair.

13. isolated herpesviral, it includes terminate enzyme gene, it is characterised in that:

A) virus is the member of different herpetoviridae；

B) virus causes the disease in the jewfish of Asia；

C) the termination enzyme gene is reacted in PCR reaction with the primer sets as shown in SEQ ID NO:25 and 26 to generate The PCR product of 585+/- 10 base-pair.

14. isolated herpesviral, it includes pol genes, it is characterised in that:

A) virus is the member of different herpetoviridae；

B) virus causes the disease in the jewfish of Asia；

C) pol gene reacts in PCR reaction with the primer sets as shown in SEQ ID NO:27 and 28 to generate The PCR product of 314+/- 10 base-pair.

15.DNA segment, it includes the genes for encoding main envelope protein, which is characterized in that the gene and such as SEQ ID NO: The nucleotide sequence of MEP gene shown in 2 has at least 80% level of sequence identity.

16. main envelope protein, which is characterized in that the MEP with the amino acid sequence of SEQ ID NO:3 have at least The amino acid sequence of 70% identity.

17.DNA segment, it includes coding dUTP enzyme gene, which is characterized in that the gene with such as institute in SEQ ID NO:4 The nucleotide sequence for the dUTP enzyme gene shown has at least 80% level of sequence identity.

18.dUTP enzyme, which is characterized in that the dUTP enzyme with the amino acid sequence of SEQ ID NO:5 have at least 70% The amino acid sequence of identity.

19. the DNA fragmentation with open reading frame, the open reading frame has the length of at least 100 nucleotide, wherein institute State DNA with have according to the open reading frame of the DNA of the sequence of SEQ ID No.1 at least 80% sequence identity.

20. the protein encoded by the DNA fragmentation of claim 19.

21. including the cell culture of duplicating virus, which is characterized in that the culture includes any in claim 1-14 The herpesviral of item.

22. the vaccine for fighting the herpesvirus disease in fish, which is characterized in that the vaccine includes in claim 1-14 The herpesviral of any one or the protein and pharmaceutically acceptable carrier of any one of claim 16,18 and 20.

23. vaccine according to claim 22, wherein the vaccine includes the herpesviral of any one of claim 1-14, It is characterized in that, the herpesviral is in attenuation living or deactivated form.

24. the method for treating animal with the vaccine prevention of claim 22 or 23 comprising by the vaccine systemic administration In the animal.

25. the antibody or antiserum that are reacted with the virus of any one of claim 1-14.

26. diagnostic test reagent box is used to detect and react with the virus of any one of claim 1-14 or its antigenic substance Antibody, which is characterized in that the test kit includes the virus or its antigenic substance of any one of claim 1-14.

27. diagnostic test reagent box is used to detect any one of -14 herpesviral or its antigen object according to claim 1 Matter, which is characterized in that the test kit includes to react with the virus of any one of claim 1-14 or its antigenic substance Antibody or the PCR primer group as defined by any one of claim 11-14.