CN105755014B - CaHV-TNFR specific gene and application - Google Patents
CaHV-TNFR specific gene and application Download PDFInfo
- Publication number
- CN105755014B CN105755014B CN201610172024.4A CN201610172024A CN105755014B CN 105755014 B CN105755014 B CN 105755014B CN 201610172024 A CN201610172024 A CN 201610172024A CN 105755014 B CN105755014 B CN 105755014B
- Authority
- CN
- China
- Prior art keywords
- cahv
- gene
- tnfr
- crucian carp
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
- C07K16/085—Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses CaHV-TNFR specific gene and application, the CaHV-TNFR special gene sequence is shown in SEQ ID NO.1.It devises for the gene for crucian carp gill haemorrhage primer: CaHV-MCP F/R, CaHV-TNFR F/R.Composite PCR amplification is carried out with these two pair primer, when two segments of 436bp and 915bp are arrived in amplification simultaneously, diagnosable is to be infected by CaHV；When only mono- segment of 436bp is arrived in amplification, can detect to be infected by CyHVs.Gene order provided by the invention and primer are particularly suitable for gene diagnosis and Molecule Epidemiology Investigation to acute crucian carp gill haemorrhage Simplex Virus, apply also for the monitoring and warning to aquatic livestock herpesviral, positive rate and accuracy rate are more than 98%, and gene dosage containing CaHV is that 10pg/ μ L can be detected in measuring samples.
Description
Technical field
The invention belongs to virology, fisheries biology technology and aquatic livestock medical domains, are more particularly to a kind of CaHV-
TNF R specific gene also relates to a kind of purposes of CaHV-TNFR specific gene.
Background technique
Fish herpesviral is classified as emphasis aquatic animal epidemic disease register, China by World Organization for Animal Health (OIE)
Two class epidemic disease registers have been included in [in fishery fisheries administrative office, Ministry of Agriculture .2014 China aquatic animal sanitary condition report
Agricultural publishing house, state, Beijing, 2015].Herpesviral is that one kind has cyst membrane, the virus containing double stranded big DNA genome.It is known
Carp Herpesvirus (Cyprinivirus) is the member of fish frog herpesvirus section (Alloherpesviridae), referred to as carp blister
Exanthema virus group (C yprinid herpesviruseses) contains 1 type, 2 types and 3 types (CyHV1, CyHV2 and CyHV3) [Zhang Qi
Asia, Gui Jianfang Chinese science: life science, 2014,44:1236-1252], CyHVs can be abbreviated as.Herpesviral can infect feeding
It grows and the wild shoal of fish, causes massive mortality [Hanson et al, Viruses.2011,3 (11): 2160-2191；Lovy&
Friend.Dis Aquat Org,2014,108:1–9]。
Crucian carp (Carassius auratus) is the important cultured freshwater fish in China, and it cultivates scale and potentiality increasingly
Greatly.But in recent years, the acute crucian carp gill haemorrhage as caused by herpesviral brought serious harm to aquaculture, largely died of illness fish also
Adverse effect is caused to water environment.The disease has the characteristics that sudden, popular wide and lethality is high.The typical case of acute crucian carp gill bleeding
Illness is gill swelling, bleeding, also with body surface and in-vivo tissue bleeding.Make Histopathological Studies to sick crucian carp to show: in addition to the gill,
Also there is different degrees of lesion in liver, spleen, kidney and head-kidney tissue.Studies have shown that acute crucian carp gill haemorrhage is exactly by crucian carp blister sore
Malicious (Carassius aruatus herpesvirus, CaHV) [side into etc., Chinese aquatic science in March, 2016,23 (2)::
336-343] caused by.Once there is fish morbidity, propagate, is judged by symptom and pathology late in the shoal of fish soon.Especially
There is CyHVs infection simultaneously in crucian carp gill haemorrhage Endemic Area in it, is just more difficult to identify.It is efficient and special therefore, it is necessary to establish as early as possible
Diagnostic method, targetedly to carry out the diagnosis and immune prevention and control of crucian carp Simplex Virus.
In view of the above-mentioned problems, applicant completes its full genome on the basis of crucian carp gill haemorrhagic virus CaHV is identified in separation
Group sequencing.Compare display through genome and homologous sequence, there are conserved sequences between CaHV and CyHVs, such as: CaHV coding is main
Capsid protein (Major capsid protein, MCP) gene 88R [Davison et al.J Virol, 2013,87:
2908–2922].By different polymerase chain reactions (polymerase chain reaction, PCR) method, including
[week is brave etc., aquatic product journal, 2013,37 (4): 607-613 for TaqMan real-time fluorescence quantitative PCR, ring mediated isothermal；Gotesman
105 (2): et al, Dis Aqua t Organ.2013 163-174], expands single MCP gene, for detecting fish bleb
Virus.But the area of prevalence CaHV and CyHVs at the same time, is just difficult to identify and diagnose.Homologous sequence comparison also shows that CaHV is deposited
In unique gene, such as: CaHV encoding tumor necrosis factor receptor (Tumor necrosis factor receptor, TNFR)
Gene 146R, and CyH Vs (such as CyHV1 and CyHV3) or lack sequence area in this gene or homologous gene there are significant difference
Section (see Fig. 2).Accordingly, our separately design for a CaHV mono- conservative gene MCP and unique gene TNFR two pairs draw
Object CaHV-MCP F/R and CaHV-TNFR F/R, and create and be not only suitble to diagnosis of viral crucian carp gill haemorrhage, but also can detect
The composite PCR method of CyHVs.
Summary of the invention
The purpose of the invention is to provide a kind of CaHV-TNFR specific gene, sequence is SEQ ID NO.1 institute
Show.
Another object of the present invention is to be the provision of the primer based on the design of CaHV-TNFR specific gene, preferably
Primer sequence are as follows: CaHV-TNFR F:ctacccaccagactaccc and CaHV-TNFR R:tcacaaccaccgtcccacta.
Final object of the present invention is to be the provision of a kind of CaHV-TNFR specific gene or drawing based on its design
Application of the object in preparation crucian carp gill haemorrhage diagnostic reagent, the reagent is especially suitable for by crucian carp herpesviral (Carassius
Arua tus herpesvirus, CaHV) caused by acute crucian carp gill haemorrhage diagnosis.
In order to achieve the above object, the present invention takes following technical measures:
A kind of CaHV-TNFR specific gene, sequence are shown in SEQ ID NO.1.
Primer based on the design of CaHV-TNFR specific gene is protection scope of the present invention, preferred primer sequence are as follows:
CaHV-TNFR F:ctacccaccagactaccc and CaHV-TNFR R:tcacaaccaccgtcccacta.
CaHV-TNFR specific gene or primer the answering in preparation crucian carp gill haemorrhage diagnostic kit designed based on it
With: crucian carp gill haemorrhage diagnostic kit is prepared including CaHV-TNFR specific gene or based on the exclusive use of the primer of its design；
Or CaHV-TNFR specific gene or based on its design primer and other gene orders or based on other genes design primer
For preparing crucian carp gill haemorrhage diagnostic kit.The kit prepared include but is not limited to be used for acute crucian carp gill haemorrhage, or
Carp Simplex Virus fashion trend and early warning, or by crucian carp herpesviral (Carassius aruatus herpesvirus,
CaH V) caused by illness.
In addition, being gone forward side by side by constructing carrier, transfection cell containing CaHV-MCR (88R) and CaHV-TNFR gene (146R)
After row expression, antibody is prepared with expression product, then can further research and develop fish herpesviral immunoassay technology and preparation.
A kind of crucian carp gill haemorrhage diagnostic kit, the mentality of designing of the kit are the CaHV's newly measured based on applicant
Fish hsv gene group is homologous compares with other for whole genome sequence, separately designs synthesis for CaHV major capsid protein
Two pairs of the highly conserved section of gene (CaHV-MCP) and CaHV Tumor Necrosis Factor Receptors (CaHV-TNFR) distinguished sequence section
Primer: CaHV-MCP-F/R and CaHV-TNFR-F/R, and carry out composite PCR amplification.It is shown through gel electrophoresis: having infected CaHV
Sample two nucleic acid belts that can to amplify simultaneously molecular weight respectively be 436bp and 915bp；And other carp herpesvirals are infected
(CyHVs) sample only amplifies a nucleic acid belt of 436bp.In this way, through once composite PCR can simultaneously to CaHV and
CyHVs is diagnosed or is detected.Nucleic acid belt size is easily distinguished, clear bright, is judged convenient for result.
This is a kind of height for being not only directed to crucian carp gill haemorrhage herpesviral CaHV but also can recognize other carp herpesviral CyHVs
Effect, stable, special aquatic products virosis detection method are suitable for carrying out early stage to acute crucian carp gill haemorrhage caused by herpesviral
Diagnosis.With this method, positive rate and accuracy rate reach 100%.
The kit includes primer:
CaHV-MCP F:cagaccaagaactacgtggg；
CaHV-MCP R:cctcggccttggcgatgttgta；
CaHV-TNFR F:ctacccaccagactaccc；
CaHV-TNFR R:tcacaaccaccgtcccacta.
Compared with prior art, the invention has the following advantages that
1) present invention realizes the efficiently and accurately diagnosis to acute crucian carp gill haemorrhage Simplex Virus.
2) present invention is compared based on the CaHV whole genome sequence newly measured and with CyHVs genome and homologous gene,
It using composite PCR amplification method, is improving efficiency, while saving the time, reduce cost, moreover it is possible to CyHVs is detected, to obtain
Richer data.
3) utilize primer of the present invention, not only can from have illness after herpesvirus infection or fish body without illness in detect
Viral nucleic acid band, and viral nucleic acid band, positive rate are detected in the different tissues for the fish that can fall ill from herpesvirus infection
With accuracy rate more than 98%.
4) gene order provided by the invention or its primer, can research and develop accurate, quick, convenient and fast immunoassay technology and/
Or preparation, it is widely used in epidemiological survey and the early warning of aquatic livestock herpesviral.
5) sensitive using composite PCR detection primer provided by the invention, gene dosage containing CaHV is 10pg/ μ L in measuring samples
It can detect.
6) the gene C aHV-TNFR expanded has predictable function or conserved domain；Gene size is moderate, amplification
After be easy to analyze and judge.
Detailed description of the invention
It the conserved sequence (gray background) of Fig. 1 CaHV-MCP gene 88R and carp herpesviral homologous gene and is marked
Primer and site.
CaHV: crucian carp herpesviral (Carassius aruatus herpesvirus, CaHV)；
CyHV1: carp chimpanzee agent (NC_019491)；
CyHV2: carp herpesvirusⅡtype (NC_019495):
CyHV3: III type of carp herpesviral (NC_009127).
Fig. 2 CaHV-TNFR gene 146R and carp herpesviral Homologous gene sequences (gray background) and its Primer and
Site.
Short-term indicates to lack base in corresponding position.
The electrophoretogram of Fig. 3 composite PCR amplification measuring samples DNA product.
Measuring samples successively come from, swimming lane: 1: mandarin fish rhabdovirus (Siniperca chuatsi rhabdovirus,
SCRV) genome；2: viral (Rana grylio virus, the RGV) genome of the Frog Rana Grylio frog；3: giant salamander frog virus
(Andrias davidianu s ranavirus, ADRV) genome；4:DNA Marker DL2000；5: crucian carp herpesviral
(Carassius aruatus herpesv irus, CaHV) genome；6:CaHV artificial challenge's crucian carp head-kidney；7: Jiangsu disease crucian carp head
Kidney；8: Hubei disease crucian carp head-kidney；9: from fishpond of once falling ill, the temporary crucian carp head-kidney without illness；10: normal crucian carp head-kidney.
Fig. 4 composite PCR expands the electrophoretogram of sick crucian carp different tissues DNA product.
M.DNA Marker DL2000；L. sick crucian carp liver；S. sick crucian carp spleen；K. sick crucian carp kidney；HK. sick crucian carp head-kidney；G. the sick crucian carp gill；
CaHV. positive control；NC. negative control.
The electrophoretogram of Fig. 5 various concentration template CaHV DNA cloning product.
Template DNA concentration to be checked is followed successively by 10-2、10-3、10-4、10-5、10-6With 10-7μg/μL.To 10-5μ g/ μ L is still visible
Two weaker nucleic acid belts.
Specific embodiment
Technical solution of the present invention, such as special standby explanation is the conventional scheme of this field, the reagent or material,
Such as not special standby explanation, commercial channel is derived from.
Embodiment 1:
A kind of crucian carp gill haemorrhage diagnostic kit, including primer are as shown in table 1:
1 primer essential information of table
The above primer be according to crucian carp herpesviral CaHV (Carassius aruatus herpesvirus, the present invention or
For acute crucian carp gill haemorrhage herpesviral) it is compared with carp herpesviral CyHVs genome and Homologous gene sequences, selection is directed to
The high identity sequence and CaHV tumor necrosis factor CaHV-TNFR gene of CaHV major capsid protein CaHV-MCP gene 88R
The low identity sequence of 146R, it is each to design pair of primers CaHV-MCP-F/R and CaHV-TNFR-F/R.It is according to Ca HV-
MCP gene 88R corresponding sequence (Fig. 1), design has synthesized pair of primers CaHV-MCP F and CaHV-MCP R, and (this abridges to primer
For CaHV-MCP F/R)；Meanwhile according to CaHV-TNFR gene 146R corresponding sequence (Fig. 2), design has synthesized another pair primer
CaHV-TNFR F and CaHV-TNFR R (this is abbreviated as CaHV-TNFR F/R to primer).The sequence and length of these two pair primer
Etc. essential informations be shown in Table 1.
Occur two nucleic acid belts after gene containing CaHV in sample DNA, electrophoresis, is to be expanded to grow by CaHV-MCP F/R respectively
Degree is a nucleic acid belt of 436bp, and the nucleic acid belt for being 915bp by CaHV-TNFR F/R amplification length.
Embodiment 2:
A kind of application of crucian carp gill haemorrhage diagnostic kit, application process include:
1) measuring samples DNA is extracted:
With DNA extraction kit (TaKaRa MiniBEST Universal Genomic DNA Extraction Kit
Ver.5.0, Clontech Products), measuring samples DNA is extracted as template DNA, carries out composite PCR amplification.DNA is extracted
Step is referring to kit specification.
2) composite PCR amplification and its product analysis
First various reactive components are added in PCR reaction tube, then loop parameter is set, then carry out cyclic amplification.Specifically
Method is as follows: step 1) the 1 μ l of measuring samples DNA (0.1~1.0 μ g), primer CaHV-M CP being added in PCR reaction tube
F/R and CaHV-TNFR F/R every respectively adds 10 μM of 0.5 μ l；Add the dNTP Mix of 1 μ l, 10mM；Add 2.5 μ l 10 ×
TranStart Taq Buffer(Mg2+) and 0.5 μ l TranStart Taq DNA Polymerase (the full formula gold biology in Beijing
Technology Co., Ltd.'s product), add 18 μ l ddH2O, make 25 μ l of final volume, after mixing, centrifugation 15s concentrates on reactive component
Tube bottom.Carry out PCR amplification, cyclic program are as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 55 DEG C of renaturation 30s, 72 DEG C extend
1min, 30 circulations, 72 DEG C of extension 10min, 12 DEG C of end.
After PCR, 3 μ l 6 × Loading buffer are added into system, mixes, takes 5 μ l loadings to 1.2% concentration
In Ago-Gel hole, 199V, 97mA, electrophoresis 30min.After electrophoresis, Ago-Gel is put into the E B liquid of 1% concentration
In, 5min is impregnated, in gel imaging system (imaging of GBOX full automatic gel and analysis system, the production of SYNGEN E company, the U.S.)
Middle imaging.
3) determine:
If amplifying the nucleic acid belt that two sizes are respectively 436bp and 915bp in sample DNA, show sample by CaHV
Infection；
If sample DNA only amplifies the nucleic acid belt that a size is 436bp, show that sample is not infected by CaHV, and only
Other carp herpesvirals (CyHVs) are infected.
Embodiment 3:
The specificity of crucian carp gill haemorrhage diagnostic kit
1) template nucleic acid sample preparation:
Extract the different non-hsv gene group nucleic acid of aquatic animal: by chloroform-phenol extraction method [Chen et
Al.Veterinary Res earch 2013,44:101], mandarin fish rhabdovirus (Siniperca chuatsi is prepared respectively
Rhabdovirus, SCRV) geneome RNA, viral (Rana grylio virus, the RGV) genomic DNA of the Frog Rana Grylio frog,
And viral (Andrias dav idianus ranavirus, ADRV) genomic DNA of the giant salamander frog.Fish rhabdovirus geneome RNA
First through RT-PCR reverse transcription amplification, cDNA is synthesized by RNA.CDNA, RGV base synthesized respectively with SCRV genome through reverse transcription again
Because a group DNA and ADRV genomic DNA is negative control as the non-hsv gene group template of aquatic animal.
Extract acute crucian carp gill haemorrhage herpesviral (Carassius aruatus herpesvirus, CaHV, side into etc.,
Chinese aquatic science in March, 2016,23 (2):: 336-343) genomic DNA is positive control as template DNA.
Extract separate sources crucian carp head-kidney DNA: the sick crucian carp head-kidney that first takes typical gill haemorrhage respectively, CaHV are through artificial challenge
Sick crucian carp head-kidney, Jiangsu morbidity fishpond and there is the sick crucian carp head-kidney of typical gill haemorrhage, Hubei morbidity fishpond and to have typical gill bleeding
The sick crucian carp head-kidney of disease, the fishpond that typical gill hemorrhage once occurred but the temporarily crucian carp head-kidney without illness, and healthy crucian carp head-kidney.It uses
DNA extraction kit (TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0,
Clontec h Products) extract crucian carp head-kidney DNA.Extracting method is comprised the concrete steps that referring to specification: taking fish head nephridial tissue
25mg, and shred as far as possible, it is placed in 1.5ml EP pipe；Be added 180 μ l Buffer GL, the Proteinase K of 20 μ l and
The RNaseA of 10 μ l, 10mg/ml, warm bath about 3 hours in 56 DEG C of water-baths, until tissue sufficiently digestion；Add 2 00 in lysate
Mixing is played in μ 100% ethyl alcohol of l Buffer GB and 200 μ l, suction.Centrifugal column Spin Column is placed in collecting pipe Colle
On ction Tube, the solution beaten and mixed will be inhaled and moved in Spin Column, 15,294 × g (eppendorf, FA-45-
30-1 1) centrifugation 2 minutes, abandon filtrate；The Buffer WA of 500 μ l is added in people Spin Column, 15,294 × g is centrifuged 1 point
Clock abandons filtrate；The Buffer WB of 700 μ l is added in Spin Column, 15,294 × g is centrifuged 1 minute, abandons filtrate, is repeated
This operation is primary；Separately 15,294 × g is centrifuged 2 minutes again；Spin Column is taken out, is placed on the centrifuge tube of new 1.5ml,
100 μ l aqua sterilisas or Elution Buffer is added, is stored at room temperature 5 minutes, 15,294 × g is centrifuged 2 minutes eluted dnas；It takes and washes
De- liquid rejoins in Spin Column film, repeats to stand and centrifugation is primary, eluted dna.Extracted crucian carp head-kidney DNA will make
For measuring samples template DNA, PCR amplification is carried out.
2) it is expanded by step 2) in embodiment 2 through composite PCR, carries out the diagnosis of crucian carp gill haemorrhage Simplex Virus, it is used
Primer is shown in embodiment 1.
3) result is as shown in Figure 3: the result of the non-hsv gene group template amplification of swimming lane 1~3. 3 kind aquatic animal is equal
For feminine gender.4. molecular weight marker DNA Marker DL2000.Swimming lane 5. with CaHV genomic templates expand as a result, it is clear go out
Existing two nucleic acid belts, size is respectively 436bp and 915bp.6~8. measuring samples of swimming lane occur and positive control C aHV
Two completely the same nucleic acid belts, diagnose these measuring samples and are infected by CaHV.9. measuring samples of swimming lane are to come from once to fall ill
Fishpond, though temporarily asymptomatic fish, also occurs and two weaker nucleic acid belts of positive control CaHV brightness in the same size, diagnosis
For by CaHV infect but viral gene content it is lower.The healthy crucian carp that swimming lane 10. is not infected by CaHV.
Embodiment 4:
The detection of crucian carp gill haemorrhage diagnostic kit limits:
1) by acute crucian carp gill haemorrhage herpesviral (Carassius aruatus herpesvirus, CaHV) genome
DNA is successively serially diluted for 10 times: 10-2μg/μL、10-3μ g/ μ L ... to 10-7μ g/ μ L, as template DNA.
2) using the primer of designed synthesis in embodiment 1.
3) it is expanded by step 2) in embodiment 2 through composite PCR.
4) result is diluted to 10-5The template of μ g/ μ L (10pg/ μ L), remain to amplify two sizes be respectively 436bp and
The nucleic acid belt of 915bp (see Fig. 5).Show that the detection of the crucian carp gill haemorrhage diagnostic kit is limited up to 10pg/ μ L.
Embodiment 5:
The application that crucian carp gill haemorrhage diagnostic kit is distributed in susceptible fish different tissues in Test Virus gene
1) infection crucian carp gill haemorrhage herpesviral (Carassius aruatus herpesvirus, CaHV) is extracted respectively
Sick crucian carp liver,spleen,kidney, head-kidney and the DNA of gill tissue, as measuring samples template DNA.
2) composite PCR amplification and its product analysis are carried out by step 2) in embodiment 2 and 3).
As a result as shown in Figure 4: M. molecular weight marker DNA Marker DL2000；L.liver, sick crucian carp liver；S.spleen,
Sick crucian carp spleen；K.kidney, sick crucian carp kidney；HK.head kidney, sick crucian carp head-kidney；G.gill, the sick crucian carp gill；CaHV. positive control；
NC. negative control.The results show that liver,spleen,kidney, head-kidney and five kinds of gill tissues from sick crucian carp all occur and positive control CaHV
In the same size, identical two nucleic acid belts of brightness, show the gene that all there is CaHV in sick crucian carp different tissues.
Embodiment 6:
The application of CaHV-MCP gene and CaHV-TNFR gene in preparation fish herpesviral immune formulation
1) CaHV-MCP gene (88R) and CaHV-TNFR gene (146R) expression vector establishment, prokaryotic expression and expression produce
The purifying of object
It will be built with conventional gene cloning process by above-mentioned two gene magnification and insertion expression vector pET32a
Carrier convert e. coli bl21 (DE3), with isopropyl-β-D-thiogalactoside (IPTG) inducible protein express, collect
Expression product, and purified through affinity chromatography.
2) prepared by monoclonal antibody
Using CaHV-MCP the and CaHV-TNFR albumen of purifying as mice immunized with antigen, then take the B lymph of immune mouse thin
Born of the same parents are merged with myeloma cell, and selectivity is cultivated, and are screened hybridoma positive colony and are expanded culture, produced by persistent collection
Monoclonal antibody.
3) immunodiagnosis kit/test strips preparation
Optimize monoclonal antibody preparation process and quality inspection standard, said monoclonal antibody exploitation is supported at can be directly used for aquatic products
The immunodiagnosis kit or test strips that the scene of growing uses.
SEQUENCE LISTING
<110>Inst. of Hydrobiology, Chinese Academy of Sciences
<120>CaHV-TNFR specific gene and application
<130>CaHV-TNFR specific gene and application
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 975
<212> DNA
<213> Carassius aruatus herpesvirus
<400> 1
atgcttctaa tcgctgtcct cttgacccta tcgggcctgg acgctgttcg actcataccc 60
ctacccacca gactacccac cagacgtgca atcaccaagc caacaatcaa aaagagcttg 120
gacgagcttt ttgtcatcgc gaccaatgac agtgaatggt tggaaaccga cgttgctctc 180
gatccgcgag tatgccccaa caagtttgga ttctacggga ctcttctcga cggctcgttt 240
gttatcaaat gtgattatca cgtccagatg atcaacatga aatacgaaaa caacacagaa 300
atcatgcaca tttacgacta caaatggcct gtccatttca accggtctga ttataccgag 360
gacatcgtac agatatgtga tcggtgtttg ccttgcaagg gacgcttcga ttaccagagt 420
ccgaacggca cctgttgtca accgtgcccc gccggatttt acgccgctga acattgtacg 480
gtggacggag aaaggagtgt atgcaagagg tgtcctctgg accattacaa ggacaacagc 540
tacgttggta ctctgcaaca cgaagaagtg tgccgaccac tgaaaacgaa cgctacgtgt 600
ccaaggaaca cacacatcag aaagcgcgaa aatcgccagt cggaggacgg ataccaccgg 660
gataacatat gcgatccgaa cgttggctat tactgtccag gtatcgggat cggccagagc 720
tgctctcacg atgctgtatt gggtacgtgt ccgtccggac agtacacgtt cgctcataac 780
acgagggaaa acaatgccgt ttgtggacat tgtaactctg accagtacgc caaaacgaac 840
ctcgatacgg gactcactgt gtgtgtcaac caggttacgt gtcccaatgg tactatatcg 900
acgggaggta gtaaaacaac caaggctacg tgttctccac aaacttcaaa ctggatagtg 960
ggacggtggt tgtga 975
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
cagaccaaga actacgtggg 20
<210> 3
<211> 22
<212> DNA
<213>artificial sequence
<400> 3
cctcggcctt ggcgatgttg ta 22
<210> 4
<211> 18
<212> DNA
<213>artificial sequence
<400> 4
ctacccacca gactaccc 18
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
tcacaaccac cgtcccacta 20
Claims (5)
1. a kind of CaHV-TNFR specific gene, the gene is shown in SEQ ID NO.1.
2. for the primer of the design of gene described in claim 1 are as follows: CaHV-TNFR F:ctacccaccagactaccc and CaHV-
TNFR R:tcacaaccaccgtcccacta.
3. gene described in claim 1 or primer as claimed in claim 2 answering in preparation crucian carp gill haemorrhage diagnostic reagent
With.
4. application according to claim 3, the reagent includes primer:
CaHV-MCP F:cagaccaagaactacgtggg；
CaHV-MCP R:cctcggccttggcgatgttgta；
CaHV-TNFR F:ctacccaccagactaccc；
CaHV-TNFR R:tcacaaccaccgtcccacta.
5. gene described in claim 1 or primer as claimed in claim 2 are examined in preparation disease as caused by crucian carp herpesviral
Application in disconnected reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610172024.4A CN105755014B (en) | 2016-03-23 | 2016-03-23 | CaHV-TNFR specific gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610172024.4A CN105755014B (en) | 2016-03-23 | 2016-03-23 | CaHV-TNFR specific gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105755014A CN105755014A (en) | 2016-07-13 |
| CN105755014B true CN105755014B (en) | 2019-03-19 |
Family
ID=56345560
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610172024.4A Active CN105755014B (en) | 2016-03-23 | 2016-03-23 | CaHV-TNFR specific gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105755014B (en) |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2010111725A (en) * | 2007-08-28 | 2011-10-10 | Юниверсите Де Льеж (Be) | RECOMBINANT COI HERPESVIRUS (KHV) OR HERPESVIRUS 3 CARP FAMILY (CYHV-3) AND VACCINE FOR PREVENTION OF A DISEASE CAUSED BY KHV / CYHV-3 IN CYPRINUS CARPIO OR CYPRIUS CAR |
| CU20100233A7 (en) * | 2010-12-01 | 2012-10-15 | Ct De Ingeniería Genética Y Biotecnología | VETERINARY COMBINATION FOR THE CONTROL OF VIRAL INFECTIONS IN AQUACULTURE |
| CN102851403B (en) * | 2012-09-29 | 2014-04-09 | 中国水产科学研究院长江水产研究所 | Cyprinidherpesvirus 2 (CyHV-2) nested PCR (polymerase chain reaction) detection kit |
| CN104593388B (en) * | 2014-12-29 | 2017-04-12 | 中国水产科学研究院长江水产研究所 | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof |
| CN104524564B (en) * | 2014-12-29 | 2017-08-25 | 中国水产科学研究院长江水产研究所 | A kind of crucian Simplex Virus combination vaccine preparation and preparation method and application |
| CN104673934A (en) * | 2015-02-10 | 2015-06-03 | 中山出入境检验检疫局检验检疫技术中心 | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof |
| CN104846124B (en) * | 2015-05-21 | 2017-10-20 | 广州利洋水产科技股份有限公司 | Crucian carp herpes virus type 2 specific PCR detection kit and detection method |
| CN105256071A (en) * | 2015-11-11 | 2016-01-20 | 四川农业大学 | Method for quickly detecting carp herpes virus type III |
| CN105274257A (en) * | 2015-11-12 | 2016-01-27 | 通威股份有限公司 | Realtime fluorescent PCR (polymerase chain reaction) detection method of Herpesvirus Cyprini-2 |
| WO2018029301A1 (en) * | 2016-08-11 | 2018-02-15 | Intervet International B.V. | Novel fish pathogenic virus |
-
2016
- 2016-03-23 CN CN201610172024.4A patent/CN105755014B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105755014A (en) | 2016-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103966358B (en) | A kind of mandarin fish infectious spleen and kidney necrosis virus fluorescent quantificationally PCR detecting kit and detection method | |
| CN110184390A (en) | For identifying the double FQ-PCR detection kit of African swine fever and wild strains of classical swine fever virus | |
| CN106636459B (en) | A kind of fluorescence RT-RPA specific detection of american type porcine reproductive and respiratory syndrome virus | |
| CN104673934A (en) | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof | |
| CN103725796A (en) | BVDV (bovine viral diarrhea virus) internal control typing fluorescent PCR (polymerase chain reaction) detection kit and preparation thereof | |
| CN103205511A (en) | Primer pair for detecting pigeon torque teno viruses and application of primer pair | |
| CN105002298A (en) | Fluorescent quantitative PCR detection method of spring viraemia of carp virus | |
| CN112301168B (en) | TaqMan real-time fluorescent quantitative RT-PCR kit and method for detecting largemouth black bass double RNA virus | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN105755014B (en) | CaHV-TNFR specific gene and application | |
| CN110964848A (en) | RAA amplification primer and probe for rapidly detecting carp herpesvirus II, detection kit and use method | |
| CN114703177B (en) | Pseudorabies virus detection composition, method and kit based on RPA isothermal amplification and immunochromatography technology | |
| Zhu et al. | Identification and rapid diagnosis of the pathogen responsible for haemorrhagic disease of the gill of Allogynogenetic crucian carp | |
| CN110257561A (en) | Reagent, detection method and application for epizootic hemorrhagic disease virus of deer (EHDV) detection | |
| CN105256071A (en) | Method for quickly detecting carp herpes virus type III | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
| CN106566895B (en) | PCR primer for simultaneously detecting type I, type II and type III of cyprinid herpes virus, kit and application | |
| RU2607025C1 (en) | Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle | |
| CN110184385B (en) | Freshwater crayfish thrum virus PCV-87R specific sequence and application | |
| CN101525671B (en) | Highly pathogenic porcine reproductive and respiratory syndrome virus detection reagent kit and application thereof | |
| CN106521028A (en) | Multiplex RT-PCR method used for synchronously detecting four kinds of viruses transmitted by insects | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN101838677B (en) | Preparation method of shrimp white spot syndrome virus disease nucleic acid sample and shrimp white spot syndrome virus detection method | |
| CN110317900A (en) | A kind of the multiple RT-PCR primer sets and detection method of quick detection CSFV, GETV, JEV |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |