CN104560978A

CN104560978A - Multiplex-polymerase chain reaction (PCR) primer and method for constructing human B cell receptor (BCR) heavy-chain library based on high-throughput sequencing

Info

Publication number: CN104560978A
Application number: CN201510027844.XA
Authority: CN
Inventors: 贾罄竹; 万瑛; 陈钢; 于海礼; 关鹏; 张建阳
Original assignee: Third Military Medical University TMMU
Current assignee: Third Military Medical University TMMU
Priority date: 2015-01-20
Filing date: 2015-01-20
Publication date: 2015-04-29
Anticipated expiration: 2035-01-20
Also published as: CN104560978B

Abstract

The invention discloses a multiplex-polymerase chain reaction (PCR) primer and a method for constructing a human B cell receptor (BCR) heavy-chain library based on high-throughput sequencing; the sequence of the primer is as shown in SEQ ID NO.7-17; the primer is designed according to the laws of somatic rearrangement, non-template random insertion and deletion, somatic hypermutation and class switch recombination of a B lymphocyte receptor heavy chain (IGH gene), and sequencing linkers are added on the upstream sides of a forward primer and a reverse primer; the primer can be used for effectively amplifying a template and can be used for constructing an immune group library. Furthermore, the invention also discloses a method for constructing the human BCR heavy-chain library; the method is simple and is capable of rapidly constructing the human BCR heavy-chain library; therefore, the invention is of significance for further understanding the change law of the immune group library and for revealing disease pathogenesis.

Description

Multiple PCR primer and the method for people BCR heavy chain library is built based on high-flux sequence

Technical field

The invention belongs to biological technical field, be specifically related to build the multiple PCR primer of people BCR heavy chain library based on high-flux sequence and utilize this primer to build the method for people BCR heavy chain library.

Background technology

Have benefited from fast development and the widespread use of high throughput sequencing technologies of future generation, DNA and RNA order-checking platform plays outstanding pushing effect in all respects of genomics.Meanwhile, this emerging technical field has been applied to the immune group storehouse order-checking of T cell and B-cell receptor.In acquired immunity, T cell and B cell are passed through surperficial φt cell receptor and the specific identification antigen peptide-MHC (pMHC) of B-cell receptor and then startup immunity system and are activated.By the CDR3 immune group storehouse of the lymphocyte receptor that checks order, determine the composition of acceptor molecule in T, bone-marrow-derived lymphocyte, in order to evaluate the characteristic parameters such as the diversity in immune group storehouse, and response generating process and the mechanism thereof of acquired immune system can be studied further.B-cell receptor (BCR) is by two heavy chains and two light chains, totally four peptide chain compositions, heavy chain is by IGH genes encoding, light chain is encoded by IGL (Lamda chain) and IGK (Kappa chain) respectively, forms the composition situation that thus can better reflect BCR because heavy chain has more complicated inside simultaneously.The germline gene of IGH gene is arranged in order by multiple open reading frame and forms, IGHV can be divided into, IGHD, IGHJ, IGHC tetra-pack section, in bone-marrow-derived lymphocyte growth course, realize random combine between different fragments by Somatic Rearrangement produce ripe IGH molecule, for the diversity of BCR provides Molecular and genetic basis.In the junction of IGHD-IGHJ, IGHV-IGHD, due to radom insertion and the disappearance of non-masterplate Nucleotide, considerably increase the diversity level of BCR molecule.In B cell reactivation process, due to the effect that somatic hypermutation (i.e. affinity maturation) and recombinant type are changed, the diversity of BCR increases further.And the complementary determining region 3 (CDR3) of IGH gene just covers IGHV-Junction-IGHD-Junction-IGHJ region, include the most diversity information of IGH gene, therefore, the sequence for bone-marrow-derived lymphocyte IGH gene C DR3 region forms composition and the response situation of carrying out order-checking and can well reflect BCR immune group storehouse.

Summary of the invention

In view of this, an object of the present invention is to provide the multiple PCR primer building people BCR heavy chain library based on high-flux sequence; Two of object of the present invention is to provide the method utilizing described multiple PCR primer to build people BCR heavy chain library.

For achieving the above object, the invention provides following technical scheme:

1, build the multiple PCR primer of people BCR heavy chain library based on high-flux sequence, described multiple PCR primer is as shown in SEQ IDNO.7 ~ 17.

2, multiple PCR primer described in claim 1 is utilized to build the method for people BCR heavy chain library, first extract normal mucosa tissues, stomach organization or peripheral blood total serum IgE, then cDNA is synthesized with sequence shown in SEQ ID NO.1 ~ 6 for reverse transcription primer reverses, again with the cDNA of synthesis be template, sequence shown in SEQ ID NO.7 ~ 17 carries out multiplex PCR for primer, reclaim PCR primer, PCR primer is carried out micro emulsion and drips PCR, then carry out PGM order-checking, obtain people BCR heavy chain library.

Preferably, the amplification condition of described multiplex PCR is: 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 59 DEG C of annealing 90s, 72 DEG C extend 90s, circulate 35 times; 10min is extended after last 72 DEG C.

Beneficial effect of the present invention is: the invention discloses the multiple PCR primer building people BCR heavy chain library, this primer can increase IGH gene C DR3 district diverse sequence, be built into BCR heavy chain library, establish the operating process building people IGH gene C DR3 district sequencing library, achieve the stable detection in B-cell receptor immune group storehouse, to understanding further immune group storehouse Changing Pattern, to disclose disease incidence mechanism significant.

Accompanying drawing explanation

In order to make object of the present invention, technical scheme and beneficial effect clearly, the invention provides following accompanying drawing:

Fig. 1 is gel imaging testing goal histogram (1:DL2000; 2,3: people BCR heavy chain library band).

Fig. 2 is BCR heavy chain library statistics.

Embodiment

Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are described in detail.The experimental technique of unreceipted actual conditions in embodiment, usually conveniently condition, the such as condition described in Molecular Cloning: A Laboratory guide (third edition, the work such as J. Pehanorm Brooker), or according to the condition that manufacturer advises.

Total serum IgE in embodiment 1, extraction people tissue

In people's tissue, the extracting method of total serum IgE, comprises the steps:

A. get after people's normal mucosa tissues, stomach organization and peripheral blood add Trizol and blow and beat, room temperature leaves standstill 5min, extracting directly RNA or to put into-80 DEG C of refrigerators frozen;

B. add 200 μ l chloroforms by every microlitre Trizol, put upside down mixing (30s), room temperature places 3min, then in 4 DEG C, the centrifugal 15min of 12000g;

C. to fetch water phase, add 200 μ l chloroforms put upside down mixing (30s) by every microlitre Trizol, room temperature places 3min, the then centrifugal 15min of 12000g under 4 DEG C of conditions;

D. get upper strata aqueous phase again, add 0.5ml Virahol, put upside down mixing by every microlitre Trizol, room temperature places 10min, and then the centrifugal 10min of 12000g under 4 DEG C of conditions, abandons supernatant;

E. precipitate and add by every microlitre Trizol the ethanol that 1ml volume fraction is 75%, gentle concussion, suspend precipitation, then in 4 DEG C, the centrifugal 5min of 8000g, sucks supernatant, be deposited in room temperature (18 ~ 25 DEG C) and dry;

D. dry rear without RNA enzyme water dissolution, obtain RNA.

Gained RNA epoch will be extracted and measure RNA concentration and quality.Detected result shows, and OD260/OD280 is about 1.8 ~ 2.0.

Recycling sex change gel electrophoresis detects 28s, 18s and 5s.Detected result shows, and band is obvious, and 28s/18s is about 2.0.

Above-mentioned detected result shows that RNA quality that the present embodiment extracts meets and builds storehouse demand, continues storehouse after can be used in.

Embodiment 2, reverse transcription and multiplex PCR

Total serum IgE sample embodiment 1 obtained carries out reverse transcription respectively, reverse transcription uses RevertAid First Strand cDNASysthesis kit, concrete operations are undertaken by test kit specification sheets, its reaction system is: total serum IgE 0.1 ~ 5 μ g, concentration is the reverse transcription primer 1 μ L of 20pmol, add DEPC process water and be settled to 12 μ L, then by mixed solution in PCR instrument 65 DEG C hatch 5min, then ice ice bath 5min is put into rapidly, then 5 × reaction buffer 4 μ L is added, Ribolock ^tMrNase inhibitor (20 μ/μ L) 1 μ L, 1mM dNTP Mix 2 μ L, revertAid TM M-MuLV ThermoScript II 200 μ/μ L 1 μ L, after mixing, centrifugal, then under 42 DEG C of conditions, hatch 1h, obtain the first chain cDNA.Wherein the concrete sequence of reverse transcription primer is:

hsIGG RT UID vlmr：5’-tgactggagttcagacgtgtgnnnnnnnnaagaccgatgggcccttg-3’(SEQ IDNO.1)；hsIGA RT UID vlmr：5’-tgactggagttcagacgtgtgnnnnnnnngaagaccttggggctggt-3’(SEQ IDNO.2)；hsIGM RT UID vlmr：5’-tgactggagttcagacgtgtgnnnnnnnngggaattctcacaggagacg-3’(SEQ IDNO.3)；hsIGD RT UID vlmr：5’-tgactggagttcagacgtgtgnnnnnnnngggtgtctgcaccctgata-3’(SEQ IDNO.4)；hsIGE.1RT UID vlmr：5’-tgactggagttcagacgtgtgnnnnnnnngaagacggatgggctctgt-3’(SEQ IDNO.5)；hsIGE.2RT UID vlmr：5’-tgactggagttcagacgtgtgnnnnnnnnttgcagcagcgggtcaaggg-3’(SEQID NO.6)，n＝a/c/g/t。

According to the rule that b lymphocyte receptor heavy chain (IGH gene) Somatic Rearrangement, non-masterplate radom insertion disappearance, somatic hypermutation and type conversion are recombinated, design multiple PCR primer, for convenience of the sequence measuring joints that order-checking is added in the upstream of forward primer and reverse primer, concrete primer is as shown in table 1:

Table 1, people BCR library multiple PCR primer

Primer	5’→3’	Sequence number
			trP1-hsIGHV1-vlmr	cctctctatgggcagtcggtgatagcctacatggagctgagc	SEQ ID NO.7
trP1-hsIGHV2-vlmr	cctctctatgggcagtcggtgataggtggtccttacaatgaccaac	SEQ ID NO.8

trP1-hsIGHV3.1-vlmr	cctctctatgggcagtcggtgattctgcaaatgaacagcctga	SEQ ID NO.9
			trP1-hsIGHV3.2-vlmr	cctctctatgggcagtcggtgattgttcaaatgagcagtctgagag	SEQ ID NO.10
trP1-hsIGHV3.3-vlmr	cctctctatgggcagtcggtgattctgcaaatgggcagcctga	SEQ ID NO.11
			trP1-hsIGHV4/6-vlmr	cctctctatgggcagtcggtgatttctccctgaagctgaactctg	SEQ ID NO.12
trP1-hsIGHV5-vlmr	cctctctatgggcagtcggtgatgcctacctgcagtggagcag	SEQ ID NO.13
			trP1-hsIGHV6-vlmr	cctctctatgggcagtcggtgatttctccctgcagctgaactctg	SEQ ID NO.14
trP1-hsIGHV7.1-vlmr	cctctctatgggcagtcggtgatgcatatctgcagatcagcagc	SEQ ID NO.15
			trP1-hsIGHV7.2-vlmr	cctctctatgggcagtcggtgatcagatcagcagcctaaaggc	SEQ ID NO.16
Acbcd01-adaptor21m	ccatctcatccctgcgtgtctccgactcagttacctctgactggagttcagacgtgtg	SEQ ID NO.17

Then with obtain the first chain cDNA for template, with sequence shown in SEQ ID NO.7 ~ SEQ ID NO.17 for primer, carry out pcr amplification, the reaction system of pcr amplification is as follows: multiplex-PCR premixed liquid 25 μ L, forward primer 5 μ L, reverse primer 5 μ L, cDNA 5 μ L, water 10 μ L, amounts to 50 μ L; Pcr amplification condition is: 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 59 DEG C of annealing 90s, 72 DEG C extend 90s, circulate 35 times; 10min is extended after last 72 DEG C.The product massfraction obtained increasing is the TAE sepharose (low melting-point agarose gel) of 3%, electrophoresis 3h under 50V voltage, under ultraviolet, the gel containing object band is cut after electrophoresis, put into 1.5mL EP pipe, then 1mL QGSolubilization buffer is added, at 45 DEG C of Water Under bath 5 ~ 10min until blob of viscose dissolves completely, then ice bath 1-2min, the sol solutions dissolved joins on adsorption column by ice prognosis, add 500 μ L at every turn, then at the centrifugal 1min of 18000g, the waste liquid in collection tube is outwelled after centrifugal, adsorption column is put back in collection tube, 300 μ L QG Solubilizationbuffer are added in adsorption column, the centrifugal 1min of 18000g, outwell the waste liquid in collection tube, adsorption column is put back in collection tube, the centrifugal 2min of 18000g, adsorption column is being placed in new 1.5ml EP pipe, with blower, the alcohol that adsorption column remains thoroughly is dried up in backward adsorption column the ultrapure water adding 25 DEG C of preheatings (95 DEG C of preheatings), leave standstill 2min, centrifugal 2min under last 18000g, collect elutriant, this elutriant is for building storehouse sample.

In order to determine that building storehouse sample quality meets the requirements, to building storehouse sample electrophoresis 30min under massfraction is 1.5% sepharose, 100V voltage, then by gel imaging testing goal band, result as shown in Figure 1.Above-mentioned detected result show obtain build storehouse sample meet build storehouse demand, can be used in next step order-checking.

Embodiment 3, em-PCR (micro emulsion drips PCR) and PGM check order

The method of diluted sample is: suppose that the concentration that Qubit records is N ng/ μ L, the sub-degree of amplified library is M kb, then the extension rate in library is N*1 .515*1000/26*M.

Then with the library after dilution for template, carry out emPCR, emPCR and use Ion OneTouch ^tMsequencing system provides reagent, and operation steps is undertaken by test kit specification sheets, then carries out PGM order-checking, and namely sequencing result is people BCR heavy chain library.Then added up by sequencing result, result as shown in Figure 2.Result shows, the people BCR heavy chain library utilizing method of the present invention to build can cover the diversity information of people BCR heavy chain.

What finally illustrate is, above preferred embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although by above preferred embodiment to invention has been detailed description, but those skilled in the art are to be understood that, various change can be made to it in the form and details, and not depart from claims of the present invention limited range.

Claims

1. build the multiple PCR primer of people BCR heavy chain library based on high-flux sequence, it is characterized in that: described multiple PCR primer is as shown in SEQ ID NO.7 ~ 17.

2. utilize multiple PCR primer described in claim 1 to build the method for people BCR heavy chain library, it is characterized in that: first extract normal mucosa tissues, stomach organization or peripheral blood total serum IgE, then cDNA is synthesized with sequence shown in SEQ ID NO.1 ~ 6 for reverse transcription primer reverses, again with the cDNA of synthesis be template, sequence shown in SEQ ID NO.7 ~ 17 carries out multiplex PCR for primer, reclaim PCR primer, PCR primer is carried out micro emulsion and drips PCR, then carry out PGM order-checking, obtain people BCR heavy chain library.

3. method according to claim 2, is characterized in that: the amplification condition of described multiplex PCR is: 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 59 DEG C of annealing 90s, 72 DEG C extend 90s, circulate 35 times; 10min is extended after last 72 DEG C.