CN104531698A

CN104531698A - Multi-PCR (Polymerase Chain Reaction) primer and method for constructing mouse TCRB (T-Cell Receptor Beta) library based on high-throughput sequencing

Info

Publication number: CN104531698A
Application number: CN201510027905.2A
Authority: CN
Inventors: 贾罄竹; 万瑛; 陈钢; 于海礼; 关鹏; 张建阳
Original assignee: Third Military Medical University TMMU
Current assignee: Third Military Medical University TMMU
Priority date: 2015-01-20
Filing date: 2015-01-20
Publication date: 2015-04-22

Abstract

The invention discloses a multi-PCR (Polymerase Chain Reaction) primer and a method for constructing a mouse TCRB (T-Cell Receptor Beta) library based on high-throughput sequencing. The sequence of the primer is presented by SEQ ID No.2-25. The primer is designed according to a rearrangement rule of heavy chain body cells of T lymphocyte receptors, and a sequencing joint is added to upstream of a forward primer and a backward primer; the primer is capable of efficiently expanding a template and can be used for constructing an immunity group library. The method is easy, can be used for rapidly constructing the mouse TCRB library and has important significances in the further understanding of the changing rule of the immunity group library and the revealing of mechanisms of diseases.

Description

Multiple PCR primer and the method in mouse TCRB library is built based on high-flux sequence

Technical field

The invention belongs to biological technical field, be specifically related to the multiple PCR primer building mouse TCRB library based on high-flux sequence, also relate to the method utilizing this primer to build mouse TCRB library.

Background technology

Have benefited from fast development and the widespread use of high throughput sequencing technologies of future generation, DNA and RNA order-checking platform plays outstanding pushing effect in all respects of genomics.Meanwhile, this emerging technical field has been applied to the immune group storehouse order-checking of T cell and B-cell receptor.In acquired immunity, T cell and B cell are passed through surperficial φt cell receptor and the specific identification antigen peptide-MHC (pMHC) of B-cell receptor and then startup immunity system and are activated.By the CDR3 immune group storehouse of the lymphocyte receptor that checks order, determine the composition of acceptor molecule in T, bone-marrow-derived lymphocyte, in order to evaluate the characteristic parameters such as the diversity in immune group storehouse, and response generating process and the mechanism thereof of acquired immune system can be studied further.φt cell receptor (TCR) is made up of alpha and beta two peptide chains, respectively by TCRA and TCRB genes encoding, forms the composition situation that thus can better reflect TCR because beta chain has more complicated inside simultaneously.The germline gene of TCRB gene is arranged in order by multiple open reading frame and forms, TRBV can be divided into, TRBD, TRBJ, TRBC tetra-pack section, in T lymphocyte development process, realize random combine between different fragments by Somatic Rearrangement produce ripe TCRB molecule, for the diversity of TCR provides Molecular and genetic basis.In the junction of TRBD-TRBJ, TRBV-TRBD, due to radom insertion and the disappearance of non-masterplate Nucleotide, considerably increase the diversity level of TCR molecule.And the complementary determining region 3 (CDR3) of TCRB gene just covers TRBV-Junction-TRBD-Junction-TRBJ region, include the most diversity information of TCRB gene, therefore, the sequence for T lymphocyte TCR 1 B gene CDR3 region forms composition and the response situation of carrying out order-checking and can well reflect TCR immune group storehouse.

Summary of the invention

In view of this, an object of the present invention is to provide the multiple PCR primer building mouse TCRB library based on high throughput sequencing technologies; Two of object of the present invention is to provide the method utilizing described multiple PCR primer to build mouse TCRB library.

For achieving the above object, the invention provides following technical scheme:

1, build the multiple PCR primer in mouse TCRB library based on high-flux sequence, described multiple PCR primer is as shown in SEQ IDNO.2 ~ 25.

2, described multiple PCR primer is utilized to build the method in mouse TCRB library, first extract mouse spleen glandular tissue or peripheral blood total serum IgE, then cDNA is synthesized with SEQ ID NO.1 for reverse transcription primer reverses, again with synthesis cDNA for template, sequence shown in SEQ IDNO.2 ~ 25 is that primer carries out multiplex PCR, reclaims PCR primer, PCR primer is carried out micro emulsion and drips PCR, then carry out PGM order-checking, obtain mouse TCRB library.

Preferably, the amplification condition of described multiplex PCR is: 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 59 DEG C of annealing 90s, 72 DEG C extend 90s, circulate 35 times; 10min is extended after last 72 DEG C.

Beneficial effect of the present invention is: the invention discloses and build the multiple PCR primer in mouse TCRB library, and this primer can increase TCRB gene C DR3 district, obtains mouse TCRB library; The invention also discloses the operating process building mouse TCRB gene C DR3 district sequencing library, achieve the stable detection in φt cell receptor immune group storehouse, to understanding immune group storehouse Changing Pattern further, to disclose disease incidence mechanism significant.

Accompanying drawing explanation

In order to make object of the present invention, technical scheme and beneficial effect clearly, the invention provides following accompanying drawing:

Fig. 1 is gel imaging testing goal histogram (1:DL2000; 2: mouse TCRB library band).

Fig. 2 is mouse TCRB library statistics.

Embodiment

Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are described in detail.The experimental technique of unreceipted actual conditions in embodiment, usually conveniently condition, the such as condition described in Molecular Cloning: A Laboratory guide (third edition, the work such as J. Pehanorm Brooker), or according to the condition that manufacturer advises.

Total serum IgE in embodiment 1, extraction rat tissue

In rat tissue, the extracting method of total serum IgE, comprises the steps:

A. get after mouse spleen glandular tissue and peripheral blood add Trizol and blow and beat, room temperature leaves standstill 5min, extracting directly RNA or to put into-80 DEG C of refrigerators frozen;

B. add 200 μ l chloroforms by every microlitre Trizol, put upside down mixing (30s), room temperature places 3min, then in 4 DEG C, the centrifugal 15min of 12000g;

C. to fetch water phase, add 200 μ l chloroforms put upside down mixing (30s) by every microlitre Trizol, room temperature places 3min, the then centrifugal 15min of 12000g under 4 DEG C of conditions;

D. get upper strata aqueous phase again, add 0.5ml Virahol, put upside down mixing by every microlitre Trizol, room temperature places 10min, and then the centrifugal 10min of 12000g under 4 DEG C of conditions, abandons supernatant;

E. precipitate that to add 1ml volume fraction by every microlitre Trizol be 75% ethanol, gentle concussion, suspend precipitation, then in 4 DEG C, the centrifugal 5min of 8000g, sucks supernatant, be deposited in room temperature (18 ~ 25 DEG C) and dry;

D. dry rear without RNA enzyme water dissolution, obtain mouse total serum IgE.

Gained RNA epoch will be extracted and measure RNA concentration and quality.Detected result shows, and OD260/OD280 is about 1.8 ~ 2.0.

Recycling sex change gel electrophoresis detects 28s, 18s and 5s.Detected result shows, and band is obvious, and 28s/18s is about 2.0.

Above-mentioned detected result shows that RNA quality that the present embodiment extracts meets and builds storehouse demand, continues storehouse after can be used in.

Embodiment 2, reverse transcription and multiplex PCR

Total serum IgE sample embodiment 1 obtained carries out reverse transcription respectively, reverse transcription uses RevertAid First Strand cDNASysthesis kit, concrete operations are undertaken by test kit specification sheets, its reaction system is: total serum IgE 0.1 ~ 5 μ g, concentration is reverse transcription primer 5 '-actgtggacctccttgcca-3 ' (SEQ ID NO.1) the 1 μ L of 20pmol, add DEPC process water and be settled to 12 μ L, then by mixed solution in PCR instrument 65 DEG C hatch 5min, then ice ice bath 5min is put into rapidly, then 5 × reaction buffer 4 μ L is added, Ribolock ^tMrNase inhibitor (20u/ μ L) 1 μ L, 1mM dNTP Mix 2 μ L, revertAidTM M-MuLV ThermoScript II 200u/ μ L 1 μ L, after mixing, centrifugal, then under 42 DEG C of conditions, hatch 1h, obtain the first chain cDNA.

According to the rule that t lymphocyte receptor Beta chain (TCRB gene) Somatic Rearrangement, non-masterplate radom insertion disappearance, somatic hypermutation and type conversion are recombinated, design multiple PCR primer, for convenience of the sequence measuring joints that order-checking is added in the upstream of forward primer and reverse primer, concrete primer is as shown in table 1.

The multiple PCR primer in table 1, TCRB library

Primer	5’→3’	Sequence number
			trP1-mmTRBV01	cctctctatgggcagtcggtgatccagggcagaaccttgtactg	SEQ ID NO.2
trP1-mmTRBV02	cctctctatgggcagtcggtgatgactcggccacatacttctg	SEQ ID NO.3
			trP1-mmTRBV03	cctctctatgggcagtcggtgatgactcagctgtgtacttctgtgc	SEQ ID NO.4
trP1-mmTRBV04	cctctctatgggcagtcggtgatgactctgctgtgtatctctgtgc	SEQ ID NO.5
			trP1-mmTRBV05	cctctctatgggcagtcggtgatgactcagctgtctatttttgtgc	SEQ ID NO.6
trP1-mmTRBV12-1	cctctctatgggcagtcggtgataactggaggactctgctatgtac	SEQ ID NO.7
			trP1-mmTRBV12-2	cctctctatgggcagtcggtgattagaggactctgccgtgtacttc	SEQ ID NO.8
trP1-mmTRBV13-1	cctctctatgggcagtcggtgattcagacatctttgtacttctgtgc	SEQ ID NO.9
			trP1-mmTRBV13-2	cctctctatgggcagtcggtgatcagacatcagtgtacttctgtgcc	SEQ ID NO.10
trP1-mmTRBV13-3	cctctctatgggcagtcggtgatcagacagctgtatatttctgtgcc	SEQ ID NO.11
			trP1-mmTRBV14	cctctctatgggcagtcggtgatggcgacacagccacctatc	SEQ ID NO.12

trP1-mmTRBV15	cctctctatgggcagtcggtgatgactcagctgtgtatctgtgtgcc	SEQ ID NO.13
			trP1-mmTRBV16	cctctctatgggcagtcggtgatgactcagcggtgtatctttgtgca	SEQ ID NO.14
trP1-mmTRBV17	cctctctatgggcagtcggtgatattctgccatgtacctctgtgcta	SEQ ID NO.15
			trP1-mmTRBV19	cctctctatgggcagtcggtgatcgagatggccgtttttctctgtg	SEQ ID NO.16
trP1-mmTRBV20	cctctctatgggcagtcggtgatgaagacagaggcttatatctctgtg	SEQ ID NO.17
			trP1-mmTRBV21	cctctctatgggcagtcggtgatgattcagctgtgtacttctgtgcta	SEQ ID NO.18
trP1-mmTRBV23	cctctctatgggcagtcggtgatgactcagcactgtacttgtgctc	SEQ ID NO.19
			trP1-mmTRBV24	cctctctatgggcagtcggtgatgactcagcactgtagctctgtg	SEQ ID NO.20
trP1-mmTRBV26	cctctctatgggcagtcggtgatgacatccagttgtattctgg	SEQ ID NO.21
			trP1-mmTRBV29	cctctctatgggcagtcggtgatcagacatctgtgtacttctgtgcta	SEQ ID NO.22
trP1-mmTRBV30	cctctctatgggcagtcggtgatggagacagcagtatctatttctgta	SEQ ID NO.23
			trP1-mmTRBV31	cctctctatgggcagtcggtgatgccactctggcttctacctc	SEQ ID NO.24
Axbcd01-mmTRBC-sn	ccatctcatccctgcgtgtctccgactcagctaaggtaacagaccttgggtggagtcac	SEQ ID NO.25

Then with obtain the first chain cDNA for template, with sequence shown in table 1 for primer, carry out pcr amplification, the reaction system of pcr amplification is as follows: multiplex-PCR premixed liquid 25 μ L, forward primer 5 μ L, reverse primer 5 μ L, cDNA 5 μ L, water 10 μ L, amounts to 50 μ L; Pcr amplification condition is: 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 59 DEG C of annealing 90s, 72 DEG C extend 90s, circulate 35 times; 10min is extended after last 72 DEG C.The product massfraction obtained increasing is the TAE sepharose (low melting-point agarose gel) of 3%, electrophoresis 3h under 50V voltage, under ultraviolet, the gel containing object band is cut after electrophoresis, put into 1.5mL EP pipe, then 1mL QG Solubilization buffer is added, at 45 DEG C of Water Under bath 5 ~ 10min until blob of viscose dissolves completely, then ice bath 1-2min, the sol solutions dissolved joins on adsorption column by ice prognosis, add 500 μ L at every turn, then at the centrifugal 1min of 18000g, the waste liquid in collection tube is outwelled after centrifugal, adsorption column is put back in collection tube, 300 μ L QG Solubilization buffer are added in adsorption column, the centrifugal 1min of 18000g, outwell the waste liquid in collection tube, adsorption column is put back in collection tube, the centrifugal 2min of 18000g, adsorption column is being placed in new 1.5ml EP pipe, with blower, the alcohol that adsorption column remains thoroughly is dried up the ultrapure water adding 95 DEG C of preheatings in backward adsorption column, leave standstill 2min, centrifugal 2min under last 18000g, collect elutriant, this elutriant is for building storehouse sample.

In order to determine that building storehouse sample quality meets the requirements, to building storehouse sample electrophoresis 30min under massfraction is 1.5% sepharose, 100V voltage, then by gel imaging testing goal band, result as shown in Figure 1.Above-mentioned detected result show obtain build storehouse sample meet build storehouse demand, can be used in next step order-checking.

Embodiment 3, emulsionPCR (micro emulsion drips PCR) and PGM check order

What utilize the different sample of Qubit mensuration acquisition builds storehouse concentration of specimens, then by identical amount mixing.The method of diluted sample is: suppose that the concentration that Qubit records is N ng/ μ L, the sub-degree of amplified library is M kb, then the extension rate in library is N*1 .515*1000/26*M.

Then with the library after dilution for template, carry out emPCR, emPCR and use Ion OneTouch ^tMsequencing system provides reagent, and operation steps is undertaken by test kit specification sheets, then carries out PGM order-checking, and sequencing result is mouse TCRB library.Then added up by sequencing result, result as shown in Figure 2.Result shows, the mouse TCRB library utilizing method of the present invention to build can cover the diversity information of TCRB gene.

What finally illustrate is, above preferred embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although by above preferred embodiment to invention has been detailed description, but those skilled in the art are to be understood that, various change can be made to it in the form and details, and not depart from claims of the present invention limited range.

Claims

1. build the multiple PCR primer in mouse TCRB library based on high-flux sequence, it is characterized in that: described multiple PCR primer is as shown in SEQ ID NO.2 ~ 25.

2. utilize multiple PCR primer described in claim 1 to build the method in mouse TCRB library, it is characterized in that: first extract mouse spleen glandular tissue or peripheral blood total serum IgE, then cDNA is synthesized with SEQ ID NO.1 for reverse transcription primer reverses, again with synthesis cDNA for template, sequence shown in SEQ ID NO.2 ~ 25 is that primer carries out multiplex PCR, reclaims PCR primer, PCR primer is carried out micro emulsion and drips PCR, then carry out PGM order-checking, obtain mouse TCRB library.

3. method according to claim 2, is characterized in that: the amplification condition of described multiplex PCR is: 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 59 DEG C of annealing 90s, 72 DEG C extend 90s, circulate 35 times; 10min is extended after last 72 DEG C.