CN108004304B - Method for detecting clonality of lymphocyte related gene rearrangement - Google Patents
Method for detecting clonality of lymphocyte related gene rearrangement Download PDFInfo
- Publication number
- CN108004304B CN108004304B CN201711382598.5A CN201711382598A CN108004304B CN 108004304 B CN108004304 B CN 108004304B CN 201711382598 A CN201711382598 A CN 201711382598A CN 108004304 B CN108004304 B CN 108004304B
- Authority
- CN
- China
- Prior art keywords
- igh
- tcrg
- sample
- gamma
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention discloses a method for detecting the clonality of lymphocyte related gene rearrangement, belonging to the technical field of biology. The invention utilizes a high-throughput next-generation sequencing method to detect the rearrangement clonality of the relevant genes of the lymphoid tissue, and specifically utilizes a multifunctional primer and a PCR reagent to amplify a sample to be detected to obtain a multi-sample locus proliferation sublibrary; wherein the proliferation sublibrary refers to DNA fragments with different linkers connected at two ends, one side is a sequencing linker (which can contain sample labels to distinguish sequencing results of different samples), and the other side is a fixed linker for connecting capture particles; and then carrying out high-throughput sequencing on the proliferation sublibrary, classifying and sorting the sequencing result according to the tag sequence and the target gene locus, and analyzing whether the clonal rearrangement of the target gene exists or not. The invention has the characteristics of high detection flux, high sensitivity and high specificity, the sensitivity can reach 0.01 percent, and the DNA concentration of a sample can be as low as 0.1-1 ng/mul.
Description
Technical Field
The invention relates to a method for detecting the clonality of lymphocyte related gene rearrangement, belonging to the technical field of biology.
Background
Lymphocytes are produced by lymphoid organs, and are a cell line with the function of immune recognition response of organisms, and can be divided into B cells, T cells and NK cells. The lymphocyte has a receptor protein on its surface that can participate in immune response, and can specifically bind to an antigen or an antibody, such as Immunoglobulin (IG) on the surface of a B lymphocyte and a T Cell Receptor (TCR) on the surface of a T lymphocyte. Taking the IGH gene expressing an immunoglobulin heavy chain polypeptide as an example, in undifferentiated lymphocytes, the IGH gene is composed mainly of a variable region (variabl V), a diversity region (diversity D), and a joining region (joining J), and each gene region is composed of a plurality of gene segments. As lymphocytes differentiate from mother cells into mature lymphocytes, the original IGH gene is cleaved by recombinase action to form a fragment of each gene region, which is then rejoined to form a new gene with expression function, i.e., gene rearrangement occurs. Derived from genes after rearrangement of different gene segments, ensures the diversity of expressed proteins, such as normal B lymphocytes presenting the polyclonality of IGH gene rearrangement.
Lymphoma is a common malignant tumor originated from lymph nodes or other lymphoproliferations, is one of the most rapidly growing malignant tumors at present, is complex in type and is difficult to diagnose at an early stage. It is believed that malignant lymphoma occurs because lymphocyte monoclonal proliferation is caused by blocking lymphocytes at a certain stage during differentiation, and usually has only one gene rearrangement form, i.e., the monoclonality of gene rearrangement. Therefore, the clonality detection of gene rearrangement can play an important role in clinical applications such as differential diagnosis of lymphoma, pedigree analysis, Minimal Residual Disease (MRD) detection and the like.
At present, the method for detecting the clonality of lymphoma gene rearrangement is mainly a PCR-capillary electrophoresis method, namely, PCR is adopted to perform specific amplification on the rearranged gene, a gene analyzer is used to perform capillary electrophoresis on an amplification product, and whether an amplification fragment is a single-length fragment or whether a single fragment is dominant is analyzed to judge whether the gene rearrangement is monoclonal. In order to solve the problem of primer coverage in the PCR method, a BIOMED-2 gene rearrangement primer detection system and a kit thereof are developed in 2007 by groups consisting of European seven-national hematopathology experts and the like, so that the detection difficulty of high false positive and false negative rates caused by complexity and diversity of lymphoma gene rearrangement is broken through, clinical approval is obtained with relatively high sensitivity and specificity, and the system becomes a gold standard for detecting gene rearrangement clonality. However, the detection of the method still has a great problem in clinical application: 1. the detection gene sites are more, one sample needs a plurality of PCR reactions for detection, the detection cost is improved, and the operation flow is complicated; 2. the method can not carry out more detailed and deep pedigree analysis, only can detect monoclonal rearrangement aiming at IG or TCR genes, and cannot deeply analyze which family of genes in a V region or a J region participate in the rearrangement, thereby providing more detailed information for clinic; 3. the detection limit is still greatly limited, and the current PCR-capillary electrophoresis method can only detect 1% of monoclonal rearrangement and cannot meet the requirement of clinical MRD detection; 4. the body cells cannot be simultaneously detected to be hypermutated.
Disclosure of Invention
In order to solve the above problems, the present invention provides a method for detecting the rearrangement clonality of lymphoid tissue-associated genes by high-throughput sequencing. The detection technical route and the data analysis and interpretation method provided by the invention have higher accuracy and sensitivity, and have important significance for detecting the lymphoma minimal residual focus.
The first purpose of the invention is to provide a kit for detecting rearrangement clonality and/or somatic hypermutation and/or minimal residual disease of genes, which comprises multifunctional primers; the multifunctional primer contains a nucleotide sequence of a sequencing joint suitable for a high-throughput sequencing platform, a nucleotide sequence capable of being matched with a sample target region, and a nucleotide sequence of a fixed joint suitable for a corresponding high-throughput sequencing platform.
In one embodiment, the nucleotide sequence of the multifunctional primer comprises a nucleotide sequence of a sequencing adaptor suitable for a high-throughput sequencing platform, a nucleotide sequence capable of matching with a target region of a sample, and a nucleotide sequence of a fixed adaptor suitable for a corresponding high-throughput sequencing platform.
In one embodiment, the sample target region refers to a gene segment that is capable of undergoing rearrangement. Such as the variable, polytropic, joining regions of the IGH gene, or gene segments of regions of these genes.
In one embodiment, the sample refers to a chromosome, DNA fragment, nucleotide fragment, gene, etc., containing the target region of the gene to be detected for rearranged clonality.
In one embodiment, the sample is lymph node, tonsil, blood, bone marrow, etc. that is rich in lymphocytes.
In one embodiment, the gene is a lymphoid tissue-associated gene, such as lymphoid tissue cell surface receptor gene IG or TCR.
In one embodiment, the nucleotide sequence that matches the target region of the sample is the nucleotide sequence of the BIOMED-2 classical primer.
In one embodiment, the plurality of multifunctional primers are packaged separately or in a mixture after mixing.
In one embodiment, the kit further comprises PCR reagents.
In one embodiment, the PCR reagents include an amplification enzyme, Buffer, dNTP, or further include MgCl2。
In one embodiment, the enzymes in the PCR reagent include, but are not limited to, any one or more of AmpliTaq, Gold Taq, AntiTaq, EagleTaq, and the like, high specificity hot start enzymes.
In one embodiment, the nucleotide sequence of the sequencing adaptor comprises a sample tag sequence.
The sample label sequence is a segment of sequence with bases arranged according to a specific sequence, is connected with one end of a specific primer and is used for distinguishing different samples during data analysis.
The second purpose of the invention is to provide a system for detecting the rearrangement clonality of genes and/or somatic hypermutation and/or minimal residual disease, which comprises a multifunctional primer, a PCR reagent and a high-throughput sequencing platform; the multifunctional primer contains a nucleotide sequence of a sequencing joint suitable for a corresponding high-throughput sequencing platform, a nucleotide sequence capable of being matched with a sample target region, and a nucleotide sequence of a fixed joint suitable for a corresponding high-throughput sequencing platform.
In one embodiment, the nucleotide sequence of the sequencing adaptor comprises a sample tag sequence.
In one embodiment, the PCR reagents include an amplification enzyme, Buffer, dNTP, or further include MgCl2。
In one embodiment, the high throughput sequencing platform includes, but is not limited to, the Min Seq sequencing platform, Ion PGM sequencing platform.
In one embodiment, the multifunctional primer is designed as a multiplex primer, and the specific amount can be different according to different detection sites, or different primers can be designed according to different detection sites.
In one embodiment, the system firstly amplifies an in-vitro sample to be detected by using a multifunctional primer and a PCR reagent to obtain a multi-sample locus proliferation subfamily; wherein the proliferation sublibrary refers to DNA fragments with different linkers connected at two ends, one side is a sequencing linker (which can contain sample labels to distinguish sequencing results of different samples), and the other side is a fixed linker for connecting capture particles; and then carrying out high-throughput sequencing on the proliferation sublibrary, classifying and sorting the sequencing result according to the tag sequence and the target gene locus, and analyzing whether the clonal rearrangement of the target gene exists or not.
In one embodiment, the analyzing the presence or absence of clonal rearrangement of a gene of interest comprises: (1) calculating the total number of detected gene sequences; (2) comparing each detected target sequence with a standard sequence, analyzing the length of a gene segment in the obtained sequence, specifically from which gene region (V region and J region), and the obtained gene is formed by rearranging the gene segments of which families (1-7 families), wherein the same sequence is detected for the total times in the detection process; (3) and counting the sum of the number of sequences from the rearranged gene segments of the same family in the obtained gene sequences, and respectively calculating the sum of the number of sequences from different families accounting for the total detected gene sequences to generate a Read Summary table.
In one embodiment, the system further comprises: when the detected sample is judged to be the rearrangement of the target gene to be the monoclonal, the somatic hypermutation analysis is carried out on the sequence of the detected monoclonal.
In one embodiment, the system further comprises: determining that the sample is a target gene rearrangement into a single clone through the detection; then, carrying out rearrangement clonality detection on the target gene again on samples of the same patient at different periods; after the second data introduction is finished, introducing the detected monoclonality gene sequence into software, and comparing and analyzing whether the sequence detected for the first time still exists in the second data by the software; if so, then MRD is present.
In one embodiment, the standard sequence is a gene that refers to standard human genome data that is included in the public database of NCBI data for the gene to be detected.
A third object of the present invention is a method for detecting rearranged clonality and/or somatic hypermutation of a gene, the method comprising: firstly, amplifying an in-vitro sample to be detected by using a multifunctional primer to obtain a multi-sample locus proliferation sublibrary; wherein the proliferation sublibrary refers to DNA fragments with different linkers connected at two ends, one side is a sequencing linker (which can contain sample labels to distinguish sequencing results of different samples), and the other side is a fixed linker for connecting capture particles; then, carrying out high-throughput sequencing on the proliferation sublibrary, classifying and sorting the sequencing result according to the label sequence, the sample and the target gene locus, and analyzing whether the clonal rearrangement of the target gene exists;
the multifunctional primer contains a nucleotide sequence of a sequencing joint suitable for a corresponding high-throughput sequencing platform, a nucleotide sequence capable of being matched with a sample target region, and a nucleotide sequence of a fixed joint suitable for a corresponding high-throughput sequencing platform.
The detection of the reagent mainly aims at several specific rearranged genes in lymphocytes, only the result of detection and analysis has auxiliary significance in some aspects of clinic, and the diagnosis and treatment of diseases cannot be completed completely depending on the detection or the result.
In one embodiment, the high throughput sequencing platform includes, but is not limited to, the Min Seq sequencing platform, Ion PGM sequencing platform.
In one embodiment, the gene is a lymphoid tissue-associated gene, such as lymphoid tissue cell surface receptor gene IG or TCR.
In one embodiment, the analyzing the presence or absence of clonal rearrangement of a gene of interest comprises: (1) calculating the total number of detected gene sequences; (2) comparing each detected target sequence with a standard sequence, analyzing the length of a gene segment in the obtained sequence, specifically from which gene region (V region and J region), and the obtained gene is formed by rearranging the gene segments of which families (1-7 families), wherein the same sequence is detected for the total times in the detection process; (3) and counting the sum of the number of sequences from the rearranged gene segments of the same family in the obtained gene sequences, and respectively calculating the sum of the number of sequences from different families accounting for the total detected gene sequences to generate a Read Summary table.
In one embodiment, the standard sequence refers to a gene of standard human genome data included in the public database of NCBI data for the gene to be detected. For example, the IGH, IGK and TCR genes refer to the standard sequences of the IGH, IGK and TCR genes in the NCBI database. The standard sequence is compared with the detection sequence in the data analysis process and is used for comparing which family the detected sequence belongs to or which rearrangement mode is adopted, so that the sequences of the same family or the same rearrangement mode are conveniently classified, the detection quantity of the sequences of the same class is counted, and the clonality is further analyzed.
In one embodiment, the presence or absence of clonal rearrangement of a gene of interest is as set forth in table 1:
TABLE 1 interpretation method
In one embodiment, the method further comprises: when the detected sample is judged to be the rearrangement of the target gene to be the monoclonal, the somatic hypermutation analysis is carried out on the sequence of the detected monoclonal.
In one embodiment, the method further comprises: determining that the sample is a target gene rearrangement into a single clone through the detection; then, carrying out rearrangement clonality detection on the target gene again on in-vitro samples of the same patient at different periods; after the second data introduction is finished, introducing the detected monoclonality gene sequence into software, and comparing and analyzing whether the sequence detected for the first time still exists in the second data by the software; if so, then MRD is present.
In one embodiment, the method specifically includes:
(1) preparation of a multi-sample locus proliferation sublibrary:
the proliferous library refers to DNA fragments with different linkers attached to both ends, wherein one side is the sequencing linker: sample tags may be included to distinguish sequencing results of different samples; the other side is a fixed joint: the preparation method of the proliferation sublibrary for connecting the capture particles adopts an amplification method;
designing a multiple PCR primer combination by using a target gene specific primer, dissolving the multiple PCR primer combination in a tube in a mixture form, amplifying a target region in a sample to be detected to obtain a target fragment with a corresponding joint and a label, and forming a sample library;
the tag sequences are used for distinguishing samples to be sequenced, and the tag sequences are various;
the sample to be detected is a plurality of samples, and each sample is amplified corresponding to a label sequence primer;
primers and amplification scheme: fig. 1.
(2) High throughput DNA sequencing
The sequencing applicable sequencer is a Min Seq or Ion PGM sequencing platform, and the designed connector sequence and the tag sequence are different aiming at different sequencing platforms; the general second generation sequencing technology is that specific primer is first used for amplification, and then ligase is used for connecting the amplified product with the adaptor.
The sequencing reaction system comprises the following components: DNA template multiple PCR reaction, template library construction, machine template preparation and enrichment reaction, machine sequencing reaction and test data processing analysis;
(3) data analysis and reporting of results
The data result obtained by the computer reaction is analyzed by sequence screening, comparison and other methods and bioinformatics, and finally the target region sequence information of the test sample is obtained;
according to the sample label sequence information in the sequencing result, the sequencing result can be effectively classified into files of different samples; through comparing the sequence to the standard sequence, classifying the source families of V region, D region and J region segments involved in rearrangement in the detected sample sequence result, merging the same source sequence, counting the number of different source sequences and finally analyzing the gene rearrangement clonality.
In one embodiment, step (3) of the method further comprises: the presence of somatic hypermutations in the sample is detected by analysis by comparison to a standard sequence.
In one embodiment, step (3) of the method further comprises: and (3) determining a clonality spectrum by detecting the extracorporeal peripheral blood or the non-disease related extracorporeal tissue of the same patient again, and comparing the clonality spectrum with the clonality spectrum of the related disease tissue to detect the MRD condition.
The invention has the advantages and effects that:
(1) the invention has the characteristics of high detection flux, high sensitivity and high specificity, the sensitivity can reach 0.01 percent, and the DNA concentration of a sample can be as low as 0.1-1 ng/mul.
(2) The method can detect the V region somatic hypermutation and monitor the tiny residual focus condition of the patient while detecting the clonal rearrangement.
(3) The detection kit, the system and the detection method are based on a new generation sequencing technology; the high-throughput new generation sequencing technology adopted by the invention solves the problems that different detection sites of different samples are simultaneously operated, the rearrangement clonality of the lymph tissue is greatly improved, multiple samples and multiple sites are detected, and the like; the mature new generation sequencing data analysis technology can calculate the proportion of all sequences in a tested sample, and judge the clonality of rearrangement more accurately in a datamation manner by analyzing whether a certain sequence has advantages or not; the intuitive detection result of the base sequence not only can confirm the family pedigree of the rearranged gene by comparing with the standard sequence, but also can analyze the mutation proportion in the detected sequence; the clonality detection of an electrophoresis method aiming at the lymphatic tissue, the flow-type tiny residual focus monitoring and the somatic mutation detection of the first-generation sequencing are integrated into a comprehensive solution of a second-generation sequencing platform.
Drawings
FIG. 1 is a schematic diagram of a multifunctional primer;
FIG. 2 is a 4200D1000ScreenTape result diagram;
FIG. 3 is a schematic view of an interpretation process;
FIG. 4 is an example of the results for sample 1IGH-FR 1;
FIG. 5 is an example of the results for sample 2IGH-FR 1;
FIG. 6 is an example of the results for sample 3IGH-FR 1;
FIG. 7 is a graph showing the results of sample 1 TCRG-A.
Detailed description of the preferred embodiments
The present invention will be described in detail below.
Example 1
The specific operation flow adopted by the invention to realize the aim is as follows:
(1) selecting and verifying target fragment specific primers:
the BIOMED-2 gene rearrangement primer detection system is proved to have good specificity and sensitivity through a large number of clinical experiments, and a gel electrophoresis method or a capillary electrophoresis method adopted by the BIOMED-2 gene rearrangement primer detection system is a gold standard for detecting the clonal rearrangement of B lymphocyte receptor genes and T lymphocyte receptor genes. However, with the development of the second-generation sequencing, no Report exists for applying such a primer combination with high specificity and high sensitivity to the second-generation sequencing detection, so that BIOMED-2 classical primer (such as JJM van Dongen, Design and standardization of PCR primers and protocols for the detection of cyclic immunological activities and T-cell receptor genes in mutation primers: Report BIOMED-2 consensus activity BMH4-CT98-3936, Leukemia (2003)17, 2257-2317) is adopted as the specific amplification primer of the method to ensure the primer availability.
(2) Multifunctional primer design and reaction condition verification
The multifunctional primer amplification method comprises the following steps: and (2) amplifying to obtain target fragments of different samples with the same adaptor sequence connected at two ends and different sample labels by using a multifunctional primer consisting of the target fragment specific primer, the adaptor and the sample label 3 part through a multiple PCR reaction system repeatedly optimized and verified to form a DNA library.
Multifunctional primers are long primers that contain other sequences (including sequencing adaptors, immobilization adaptors, sample tags) in addition to the target fragment-specific primers, and the structure of which is shown in FIG. 1. The P joint is a fixed joint and is used for DNA capture magnetic bead connection and sequencing by using a universal primer; the sample tag consists of about 10 nucleotides to distinguish the samples; the A-linker, the sequencing linker, was used for sequencing with the universal primers.
After the reaction system is optimized, amplifying by using high-specificity hot start enzyme, namely AmpliTaq Gold Taq, AntiTaq and EagleTaq; adopting an optimized buffer system: 10mM Tris HCl (pH 8.3), 50mM KCl; using optimized primer combination concentrations: 10 pmol; optimum MgCl2Concentration: 2.5 mM; and dNTP concentration: 200 mM; optimized amplification conditions were used.
(3) One-step library preparation
The method adopts a multifunctional primer one-step amplification method to construct the library, and the library construction can be completed only by configuring a specific primer with a joint and a label into a reaction system, adding a template and carrying out one-step amplification. Compared with the classical multiplex primer amplification → the amplification of the terminal of the amplicon and the modification of phosphorylation → the connection of the CodedA linker and the P linker to the amplicon → the linker-added library construction method of the sample library greatly simplifies the library construction process, facilitates the experimental operation and saves the detection time.
In the specific operation, firstly, a PCR reaction system is prepared according to the composition of the PCR system, and the reaction system consisting of a specific primer group with a joint and a label sequence 1 is subpackaged in a reaction solution 1 tube for the detection of a sample 1; subpackaging a reaction system consisting of a joint, a tag sequence 2 and a specific primer group into a reaction solution 2 tube for detecting a sample 2; a reaction system consisting of the joint, the tag sequence 3 and the specific primer group is subpackaged in a reaction liquid 3 tube and used for detecting the sample 3; and sequentially analogizing a reaction system consisting of the joint, the label sequence n and the specific primer group, subpackaging the reaction system and a reaction liquid n tube, and detecting the sample n. The multiple samples are amplified simultaneously in the multiple reaction tubes, and simultaneously positive control and negative control are amplified simultaneously by using a single reaction system, so that the effectiveness of amplification reaction can be monitored, and sequencing and quality control sequencing results can be simultaneously sequenced in the subsequent sequencing process. And (3) detecting the size of an amplified fragment by electrophoresis of an amplified product, purifying by using a magnetic bead purification method, detecting the concentration of the product, determining the mixed concentration of the sample and the sequencing loading concentration, mixing a plurality of samples according to a certain proportion, and performing on-machine sequencing detection to achieve the purpose of simultaneously detecting the plurality of samples.
(3) High throughput DNA sequencing
The DNA sequencing process is a standard operation process from the PGM platform or the Min Seq platform to the on-machine detection after completing library construction, and the libraries constructed by the joint and the tag sequence primer suitable for the PGM platform or the Min Seq platform are respectively adopted to carry out the experiment operation of the corresponding platform, and the method has different embodiments in the aspects of sample concentration, detection time, data screening and the like according to the difference of the detection platforms.
(4) Data analysis
After the self data screening and bioinformatics analysis of the sequencing platform, sequencing results are classified and sorted according to the sample and the target gene locus according to the difference of the tag sequences, and a sequence information file is generated.
And importing the generated file into software for analysis, and presenting the result in the form of an Excel table.
First, the total number of detected gene sequences was calculated.
And comparing each detected target sequence with a standard sequence, analyzing the length of the gene segment in the obtained sequence, specifically from which gene region (V region and J region), and the obtained gene is rearranged by the gene segments of which families (1-7 families), wherein the same sequence is detected for the total times in the detection process.
And further counting the sum of the number of sequences from the same family gene fragment rearrangement in the obtained gene sequences, and respectively calculating the sum of the number of sequences from different families in the total detection gene sequence.
Thereby generating a Read Summary table and a statistical histogram.
Finally, the test sample is read according to the following procedure, specifically to determine whether the clonal rearrangement of the target gene exists.
(5) Analysis of gene hypermutation
When the detected sample is judged to be the target gene and rearranged into the monoclonal, the somatic hypermutation analysis can be carried out on the sequence of the detected monoclonal through data analysis software.
The specific process is that the monoclone rearranged gene sequence is selected and judged, and compared with the standard sequence through software, the mutation proportion in the detected sequence is judged, and the reference can be provided for clinical prognosis.
(6) MRD analysis
First, the sample is determined to be a sample in which a desired gene is rearranged into a single clone by the above-described detection. Then, the rearrangement clonality test of the target gene is performed again on samples of the same patient at different stages. And after the second data introduction is finished, introducing the sequence of the monoclonality gene detected for the first time into software, and comparing and analyzing whether the sequence detected for the first time still exists in the second data by the software. If so, then MRD is present.
Example 2
Materials (I) and (II)
1.1 sample selection:
selecting a paraffin section of a clinical sample of an unknown type to extract 3 cases of nucleic acid; 1 sample of nucleic acid extracted from ATCC CRL-2959 cell line is used as a positive control; 1 case of frozen section of clinical tonsil tissue resection is used as negative control; pure water 1 example was used as a blank control
1.2 detection of genes:
the selection for the clonality detection of the IGH gene rearrangement uses the following sequence matching the primers to the target region of the sample:
TABLE 2
The selection was made for clonality detection of TCRG gene rearrangements using primers matching the target region of the sample as follows:
TABLE 3
1.3PCR reagents
Including AntiTaq enzyme (Roche) and Buffer for amplification, dNTP and MgCl2Solutions of
1.4 second generation sequencing kit
The samples and labels correspond to the following table by adopting a PGM second generation sequencing detection platform
TABLE 4
| Tag name and | Numbering | |
| Sample | ||
| 1 | IonXpress_001(CTAAGGTAAC) | SEQ ID NO:15 |
| Sample 2 | IonXpress_008(TTCCGATAAC) | SEQ ID NO:16 |
| Sample 3 | IonXpress_003(AAGAGGATTC) | SEQ ID NO:17 |
| Positive control | IonXpress_004(TACCAAGATC) | SEQ ID NO:18 |
| Negative control | IonXpress_007(TTCGTGATTC) | SEQ ID NO:19 |
| Blank control | IonXpress_002(TAAGGAGAAC) | SEQ ID NO:20 |
Linker sequences are as follows
TABLE 5
| Joint 1 | CCATCTCATCCCTGCGTGTCTCCGACTCAG | SEQ ID NO:21 |
| Joint 2 | CCTCTCTATGGGCAGTCGGTGAT | SEQ ID NO:22 |
Because the library is constructed by adopting a one-step method, a terminal modification reagent and a joint connection reagent in a common second-generation sequencing reagent are not needed. The high-throughput second-generation sequencing related reagent mainly comprises a sequencing template preparation kit and a sequencing kit.
Experiment operation of second-generation and second-generation sequencing platform
2.1 sample extraction and sample evaluation assays
2.1.1 sample extraction
And selecting a corresponding kit for extraction according to different sample requirements, wherein the extraction operation refers to kit specifications.
2.1.2 sample concentration determination
The concentration of the extracted nucleic acid was measured using a Qubit 3.0 fluorometer.
DNA standard calibration
Use of
DNA quantification calibration was performed with 2 standards (0 ng/. mu.L, 10 ng/. mu.L) in the dsDNAHS Assay Kit. Firstly, preparing a calibration working solution: and (3) uniformly mixing 190 mu L of LDNAHS buffer (kit component) and 1 mu L of ds DNA HS reagent (kit component) in a 0.5mL centrifuge tube, then taking 1 mu L of the mixture out, and obtaining the residual 190 mu L of the mixture as the calibration working solution. 10 μ L of each of the 2 standards was added to 190 μ L of the calibration solution, and the final volume was 200 μ L, and the tubes were incubated in the dark for 2min after mixing. Open
3.0, selecting High Sensitive DNA for calibration, and putting the prepared solution in the previous step in sequence according to the prompt to finish the quantitative calibration of the DNA.
DNA sample quantification
Firstly, preparing quantitative working solution: get199 mu L of LDNAHS buffer (kit component) and 1 mu L of ds DNAHS reagent (kit component) are mixed in a 0.5mL centrifuge tube, then 1 mu L of the mixture is taken out, and the residual 199 mu L is the quantitative working solution. Adding 1 mu L of DNA sample to be detected into 199 mu L of quantitative working solution, mixing uniformly, and incubating the centrifuge tube for 2min in a dark place. Open
3.0, High Sensitive DNA was selected for quantification and the concentration value of the sample was recorded. Sample concentrations are as follows:
TABLE 6
| Numbering | Concentration (ng/. mu.L) |
| |
98.2 |
| Sample 2 | 68.2 |
| Sample 3 | 64.2 |
2.2PCR amplification
2.2.1 remove the reagent from the freezer, thaw, stabilize to room temperature, vortex mix, and centrifuge instantaneously.
2.2.2 the number of PCR reaction tubes was set according to the following table, and if the number of samples was n and the number of reaction tubes was n +3, 1 negative control, 1 positive control and 1 blank control were set for each test item.
TABLE 7
2.2.3 reaction system 50. mu.L, composition is as follows. Template dosage is 5 mu L, blank quality control is ddH2O, reaction system is shown in Table 8.
TABLE 8
| Components | Concentration of | Single reaction dosage | Final dose |
| Primer and method for producing the same | 100μM | 0.2μL | 10pmol |
| Enzyme | 1kU\176μL | 0.34 | 1U |
| Buffer | |||
| 10× | 5.0 |
1× | |
| dNTP | 2.5mM | 4μL | 200μM |
| MgCl2 | 25mM | 5.0μL | 2.5mM |
| ddH2O | 29.3μL | ||
| Form panel | 5.0μL | ||
| Total volume | 50μL |
2.2.4PCR amplification: the amplification procedure is as in table 9.
TABLE 9
2.3PCR product purification
Reference to the AMPure Regent operating Specification
2.3.1 preparing 70% ethanol for later use; gently shake
XP magnetic bead tube.
2.3.2 sample DNA amount 50-100ng 195. mu.l
XP Reagent, the DNA amount of a sample for establishing a library is 1 mu g, and 390 mu l of DNA is added
XP Reagent, blow-suck 5 times, and leave at room temperature for 5 min.
2.3.3 standing the magnetic frame for 3min, and discarding the supernatant;
2.3.4 adding 500 mul 70% ethanol, standing for 30s, moving the EP tube to move the beads, repeating the movement twice, and discarding the supernatant;
2.3.5 repeat experiment step 2.3.4;
2.3.6 removing residual ethanol, and drying at room temperature for at least 5 min;
2.3.7 Add 20. mu.l Low TE, vortex for 10 s;
2.3.8 the magnetic stand was left for 1min and the supernatant was transferred to a new 0.2ml PCR tube.
2.4 analysis of the size of the purified product fragments and determination of the concentration
2.4.1 the size and concentration of the purified product fragments were determined using 4200D1000ScreenTape, as follows:
A. d1000Reagents were placed at room temperature and held for 30 min;
B. starting an instrument, opening software, and placing the D1000Screen tape into the instrument;
C. respectively adding 1 mu LD1000 DNAdde and 1 mu L of Sample to be detected into 3 mu LD1000Sample Buffer;
D. shaking and mixing evenly, and detecting on a machine.
The sample detection results are shown in fig. 2, wherein a1 is Ladder, E1 and F1 are positive quality control and negative quality control of IGH-FR1, B2 and C2 are positive quality control and negative quality control of TCG, and others are sample detection.
2.4.2 after completion of electrophoresis, the software can automatically calculate the concentration of the major amplification product. The concentrations tested are shown in Table 10.
2.4.3 library dilutions: based on the assay concentration, dilution and mixing of the library were performed according to table 11.
TABLE 11
2.5 second Generation sequencing
This was done using Ion Torrent PGM (purchased from Life Technologies) with sequencing kit.
2.6 data processing
After sequencing was complete, the FASTQ file derived from PGM analysis could be imported directly into the rearranged clonality data analysis software and data analysis completed, and the final results imported into Microsoft Excel tables, generating the following 7 reports:
·Read Summary
·VJ Sequence Frequency Graph
·VJ Usage
·VJ Usage Percent Graph
·VJ Usage Raw Graph
·VJ Sequence Frequency
·Unique Reads
2.7 data analysis
Checking related data in the EXCEL table according to the flow of the following table, and performing interpretation of the result of rearrangement clonality
TABLE 12
The flow chart is as shown in figure 3.
Third, interpretation of results
According to the flow chart, the results of the test samples are interpreted as follows:
watch 13
Four, somatic hypermutation analysis
According to the result of the clonal rearrangement interpretation, somatic hypermutation analysis is carried out on the sample 1 and the sample 3, and the results are as follows:
TABLE 14
Fifth, comparative experiment
1. Analysis of clonality
Using the detection protocol provided in the literature (JJM van Dongen, Design and standardization of PCR primers and protocols for the detection of a critical immunological ligand and T-cell receptor gene in specific primers: Report of the BIOMED-2 centered Action BMH4-CT98-3936, Leukemia (2003)17, 2257-2317), PCR-capillary electrophoresis analysis was performed using BIOMED-2 primer system as primers, and the clonality was determined based on whether the fragment size of the amplified product was within the specified range and whether a single dominant peak was present. The results are shown in FIGS. 4-7, and the results are interpreted as in Table 15, and the clonality interpretation results are consistent with the second-generation sequencing results.
Watch 15
2. Mutation ratio analysis
Uploading the obtained sequence to NCBI Blast for comparison, wherein the website: https:// www.ncbi.nlm.nih.gov/igblast/. The comparison results of the samples 1 and 3 show that the mutation ratio of the main clone sequence is consistent with the database analysis.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> Beijing medical science and technology Limited
<120> a method for detecting clonality of rearrangement of lymphocyte-associated genes
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggcctcagtg aaggtctcct gcaag 25
<210> 2
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtctggtcct acgctggtga aaccc 25
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctggggggtc cctgagactc tcctg 25
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cttcggagac cctgtccctc acctg 25
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cggggagtct ctgaagatct cctgt 25
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tcgcagaccc tctcactcac ctgtg 25
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cttacctgag gagacggtga cc 22
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cggcactgtc agaaaggaat c 21
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cttccacttc cactttgaaa 20
<210> 12
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ttaccaggcg aagttactat gagc 24
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gtgttgttcc actgccaaag ag 22
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
<210> 15
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
<210> 16
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
<210> 17
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
<210> 18
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
<210> 19
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
<210> 20
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
<210> 21
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ccatctcatc cctgcgtgtc tccgactcag 30
<210> 22
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
cctctctatg ggcagtcggt gat 23
Claims (7)
1. A kit for detecting gene rearrangement clonality and/or somatic hypermutation and/or minimal residual disease, characterized in that the kit comprises multifunctional primers; the multifunctional primer consists of a nucleotide sequence of a sequencing joint suitable for a high-throughput sequencing platform, a nucleotide sequence of a fixed joint suitable for a corresponding high-throughput sequencing platform, a sample label and a nucleotide sequence capable of being matched with a sample target region in sequence; the multifunctional primer comprises a first primer group for detecting the clonality of IGH gene rearrangement and a second primer group for detecting the clonality of TCRG gene rearrangement; the first primer group comprises IGH-VH1-FR1, IGH-VH2-FR1, IGH-VH3-FR1, IGH-VH4-FR1, IGH-VH5-FR1, IGH-VH6-FR1 and IGH-JH, and the sequences are shown as SEQ ID NO 1-NO 7 in sequence; the second primer group comprises TCRG-V gamma 1f, TCRG-V gamma 9, TCRG-V gamma 10, TCRG-V gamma 11, TCRG-V gamma 1.1, TCRG-V gamma 1.3 and TCRG-V gamma 1f, and the sequences of the second primer group are sequentially shown as SEQ ID NO. 8-NO. 14.
2. The kit of claim 1, wherein the sample is bone marrow, blood, tissue sample, etc. containing lymphocytes.
3. The kit according to claim 1, wherein the multifunctional primer has a plurality of strands, and is packaged separately or in a mixture after mixing.
4. The kit according to any one of claims 1 to 3, wherein the kit further comprises PCR reagents.
5. The kit of claim 4, wherein the PCR reagents comprise an amplification enzyme, Buffer, dNTP.
6. A system for detecting gene rearrangement clonality and/or somatic hypermutation and/or minimal residual disease, which is characterized in that the system comprises a multifunctional primer, a PCR reagent and a high-throughput sequencing platform; the multifunctional primer consists of a nucleotide sequence of a sequencing joint suitable for a high-throughput sequencing platform, a nucleotide sequence of a fixed joint suitable for a corresponding high-throughput sequencing platform, a sample label and a nucleotide sequence capable of being matched with a sample target region in sequence; the multifunctional primer comprises a first primer group for detecting the clonality of IGH gene rearrangement and a second primer group for detecting the clonality of TCRG gene rearrangement; the first primer group comprises IGH-VH1-FR1, IGH-VH2-FR1, IGH-VH3-FR1, IGH-VH4-FR1, IGH-VH5-FR1, IGH-VH6-FR1 and IGH-JH, and the sequences are shown as SEQ ID NO 1-NO 7 in sequence; the second primer group comprises TCRG-V gamma 1f, TCRG-V gamma 9, TCRG-V gamma 10, TCRG-V gamma 11, TCRG-V gamma 1.1, TCRG-V gamma 1.3 and TCRG-V gamma 1f, and the sequences of the second primer group are sequentially shown as SEQ ID NO. 8-NO. 14.
7. A method for detecting rearranged clonality and/or somatic hypermutation of genes for the purpose of non-disease diagnosis and treatment, said method comprising: firstly, amplifying a sample to be detected by using a multifunctional primer to obtain a multi-sample locus proliferation sublibrary; wherein the proliferation sublibrary refers to DNA fragments with the same joint connected with both ends; then, carrying out high-throughput sequencing on the proliferation sublibrary, classifying and sorting the sequencing result according to the label sequence, the sample and the target gene locus, and analyzing whether the clonal rearrangement of the target gene exists; the multifunctional primer consists of a nucleotide sequence of a sequencing joint suitable for a high-throughput sequencing platform, a nucleotide sequence of a fixed joint suitable for a corresponding high-throughput sequencing platform, a sample label and a nucleotide sequence capable of being matched with a sample target region in sequence; the multifunctional primer comprises a first primer group for detecting the clonality of IGH gene rearrangement and a second primer group for detecting the clonality of TCRG gene rearrangement; the first primer group comprises IGH-VH1-FR1, IGH-VH2-FR1, IGH-VH3-FR1, IGH-VH4-FR1, IGH-VH5-FR1, IGH-VH6-FR1 and IGH-JH, and the sequences are shown as SEQ ID NO 1-NO 7 in sequence; the second primer group comprises TCRG-V gamma 1f, TCRG-V gamma 9, TCRG-V gamma 10, TCRG-V gamma 11, TCRG-V gamma 1.1, TCRG-V gamma 1.3 and TCRG-V gamma 1f, and the sequences of the second primer group are sequentially shown as SEQ ID NO. 8-NO. 14.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711382598.5A CN108004304B (en) | 2017-12-20 | 2017-12-20 | Method for detecting clonality of lymphocyte related gene rearrangement |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711382598.5A CN108004304B (en) | 2017-12-20 | 2017-12-20 | Method for detecting clonality of lymphocyte related gene rearrangement |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108004304A CN108004304A (en) | 2018-05-08 |
| CN108004304B true CN108004304B (en) | 2021-04-23 |
Family
ID=62060065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711382598.5A Active CN108004304B (en) | 2017-12-20 | 2017-12-20 | Method for detecting clonality of lymphocyte related gene rearrangement |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108004304B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486230B (en) * | 2018-05-18 | 2022-02-08 | 中国人民解放军陆军军医大学第一附属医院 | Kit for noninvasive detection of MITF gene mutation and preparation method thereof |
| CN109897898A (en) * | 2019-02-14 | 2019-06-18 | 厦门飞朔生物技术有限公司 | A kind of construction method and its application for resetting library for high-flux sequence detection lymthoma IG and TCR |
| CN109929924B (en) * | 2019-03-27 | 2022-11-08 | 上海科医联创医学检验所有限公司 | IGH gene rearrangement detection method based on high-throughput sequencing |
| CN111261226B (en) * | 2020-03-12 | 2020-10-27 | 江苏先声医学诊断有限公司 | NGS-based automatic sequencing analysis method and device for minimal residual lesions |
| CN111235148A (en) * | 2020-03-26 | 2020-06-05 | 迈杰转化医学研究(苏州)有限公司 | DNA probe pool, lymphoma detection kit containing DNA probe pool, and preparation method and application of lymphoma detection kit |
| CN114657254B (en) * | 2022-05-17 | 2022-08-23 | 至本医疗科技（上海）有限公司 | Kit and device for BCR/TCR gene rearrangement detection |
| CN114842911B (en) * | 2022-06-21 | 2022-09-20 | 深圳市睿法生物科技有限公司 | Gene detection process optimization method and device based on precise medical treatment |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102066578A (en) * | 2008-04-16 | 2011-05-18 | 哈森阿尔法生物技术研究院 | Method for evaluating and comparing immunorepertoires |
| CN102212888A (en) * | 2011-03-17 | 2011-10-12 | 靳海峰 | High throughput sequencing-based method for constructing immune group library |
| CN104560978A (en) * | 2015-01-20 | 2015-04-29 | 中国人民解放军第三军医大学 | Multiplex-polymerase chain reaction (PCR) primer and method for constructing human B cell receptor (BCR) heavy-chain library based on high-throughput sequencing |
| CN105506746A (en) * | 2014-09-22 | 2016-04-20 | 深圳华大基因科技有限公司 | Method for constructing variable region sequencing library, and method for determining variable region nucleic acid sequence |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2659492T3 (en) * | 2014-11-05 | 2018-03-15 | Fundacion De Investigacion Hospital 12 De Octubre | Method to quantify the level of minimum residual disease in a subject |
-
2017
- 2017-12-20 CN CN201711382598.5A patent/CN108004304B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102066578A (en) * | 2008-04-16 | 2011-05-18 | 哈森阿尔法生物技术研究院 | Method for evaluating and comparing immunorepertoires |
| CN102212888A (en) * | 2011-03-17 | 2011-10-12 | 靳海峰 | High throughput sequencing-based method for constructing immune group library |
| CN105506746A (en) * | 2014-09-22 | 2016-04-20 | 深圳华大基因科技有限公司 | Method for constructing variable region sequencing library, and method for determining variable region nucleic acid sequence |
| CN104560978A (en) * | 2015-01-20 | 2015-04-29 | 中国人民解放军第三军医大学 | Multiplex-polymerase chain reaction (PCR) primer and method for constructing human B cell receptor (BCR) heavy-chain library based on high-throughput sequencing |
Non-Patent Citations (3)
| Title |
|---|
| B细胞BCR CDR3受体库的高通量测序分析概况;王小妹等;《中国免疫学杂志》;20111231;第947-951页 * |
| Quantitative T cell repertoire analysis by deep cDNA sequencing of T cell receptor a and b chains using next-generation sequencing (NGS);Hua Fang等;《OncoImmunology》;20141231;第1-12页 * |
| Ｔ细胞ＴＣＲ ＣＤＲ３受体库的高通量测序分析概况;王鹏等;《现代免疫学》;20111231;第512-516页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108004304A (en) | 2018-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108004304B (en) | Method for detecting clonality of lymphocyte related gene rearrangement | |
| CN109609647B (en) | Detection Panel for pan-cancer-species targeting, chemotherapy and immune drugs based on next-generation sequencing, detection kit and application thereof | |
| CN107475375B (en) | A kind of DNA probe library, detection method and kit hybridized for microsatellite locus related to microsatellite instability | |
| CN108753967A (en) | A kind of gene set and its panel detection design methods for liver cancer detection | |
| CN106778073B (en) | A kind of method and system of assessment tumor load variation | |
| AU2021290268A1 (en) | Immunorepertoire normality assessment method and its use | |
| JP2014503223A (en) | Method for evaluating immune diversity and use thereof | |
| CN112852936A (en) | Method for analyzing sample lymphocyte or plasma cell by using immune repertoire sequencing method, application and kit thereof | |
| JP2018531044A6 (en) | Method for assessing normality of immune repertoire and use thereof | |
| Gupta et al. | Evaluation of somatic hypermutation status in chronic lymphocytic leukemia (CLL) in the era of next generation sequencing | |
| CN115786459B (en) | Method for detecting tiny residual disease of solid tumor by high-throughput sequencing | |
| AU2022202555A1 (en) | Method for measuring a change in an individual's immunorepertoire | |
| CN114657254A (en) | Kit and device for BCR/TCR gene rearrangement detection | |
| CN112259165B (en) | Method and system for detecting microsatellite instability state | |
| CN115948607B (en) | Method and kit for simultaneously detecting multiple pathogen genes | |
| CN114438218B (en) | Gene Panel for detecting various tumors, kit and application | |
| McClure et al. | High-throughput sequencing using the Ion Torrent personal genome machine for clinical evaluation of somatic hypermutation status in chronic lymphocytic leukemia | |
| CN116121360A (en) | Kit for detecting DBA pathogenic gene set and detection method | |
| CN112266963B (en) | Detection kit for combined detection of chronic granulocytic leukemia | |
| US20220148690A1 (en) | Immunorepertoire wellness assessment systems and methods | |
| CN114250269A (en) | Probe composition, second-generation sequencing library based on probe composition and application of second-generation sequencing library | |
| Pott et al. | cfDNA-based NGS IG analysis in lymphoma | |
| JP2022527036A (en) | Means and methods for accurately assessing clonal immunoglobulin (IG) / T cell receptor (TR) gene rearrangements | |
| CN116524999B (en) | Screening method and detection system for target set for detecting colorectal cancer tiny residual focus | |
| Zhang et al. | Accurate somatic variant calling performance using Avidity Sequencing with Burning Rock OncoScreenTM Plus panel |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |