CN104560864B - Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings - Google Patents
Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings Download PDFInfo
- Publication number
- CN104560864B CN104560864B CN201410806018.0A CN201410806018A CN104560864B CN 104560864 B CN104560864 B CN 104560864B CN 201410806018 A CN201410806018 A CN 201410806018A CN 104560864 B CN104560864 B CN 104560864B
- Authority
- CN
- China
- Prior art keywords
- ifn
- sequence
- grna
- pgl
- stranded dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the 293T cell lines of the knockout IFN β genes using CRISPR Cas9 system constructings.The 293T cell lines of knockout IFN β genes provided by the present invention, specially human embryonic kidney cells 293T KO IFN β, it is CGMCC No.10096 in the deposit number of China Committee for Culture Collection of Microorganisms's common micro-organisms center.It is demonstrated experimentally that the 293T cell lines of the knockout IFN β genes obtained by the present invention can not correctly express IFN β albumen.Because IFN β albumen has antivirus action, therefore Type B influenza virus substantial amounts of can not breed in the 293T cells of wild type.And the 293T cell lines for knocking out IFN β genes are preferably bred due to can not correctly express IFN β albumen, therefore available for Type B influenza virus in the cell line, obtaining a greater amount of viruses is used for experimental study.
Description
Technical field
The invention belongs to biological technical field, it is related to a kind of knockout IFN-β gene of utilization CRISPR-Cas9 system constructings
293T cell lines.
Background technology
293T cells are cell-derived by 293 and go out, and 293 cells are the people's renal epithelial cell systems for transfecting Adenovirus E1A gene,
SV40 large T antigens are expressed simultaneously, and the plasmid containing SV40 replication origins and promoter region can be replicated.Use Ca3(PO4)2Transfection
Efficiency may be up to 50%.Protein expression level is high, can relatively easily detect expression with alkaline phosphatase analysis within 2-3 days after transfection
Albumen.Transiently transfecting 293T cells is overexpression albumen and obtains the convenient of intracellular and extracellular (secretion or film) albumen
Mode.
IFN-β is in the induction of the stimulants such as bacterium, virus, poly I-C (Poly IC), nucleotides
Under, mainly by a kind of glycoprotein of the generations such as fibroblast, leucocyte.HuIFN- β gene is positioned at No. 9 dyeing of people
Body, HuIFN- β albumen is made up of 166 amino acid, is belonged to containing 3 Cys in glycosylation albumen, molecular weight about 23KD, peptide chain, point
Not 17,31 and 141, wherein biological activity of the disulfide bond formed between the cysteine of 31 and 141 to HuIFN- β
It is extremely important.IFN-β has various biological function, mainly including growth that is antiviral, suppressing some cells, immunological regulation and
Suppress the function with killing tumor cell.The antiviral effect of IFN-β is directed to different virus, even same viral difference
Serotype and it is different.Its antiviral mechanism of action is mainly realized by two aspects：1) by suppressing some viral suctions
Its antiviral functions is realized in attached, undress shell and transcription, virus protein synthesis and the release of ripe virus；2) by enhancing certainly
NK cells are so killed, mononuclear macrophage realizes its antiviral functions to the phagocytosis of virus.IFN-β can also suppress certain
The propagation of the growth, such as fibroblast, epithelial cell, endothelial cell and hematopoietic cell of a little cells, its mechanism is probably logical
Crossing makes cell division rest on the G0/G1 phases, reduces DNA synthesis, lowers the transcriptional level of cellular proto-oncogene, lowers some lifes
Growth factor receptor body surface reaches.IFN-β also has immunoregulation effect, including promotes the expression of most cells MHC-I class antigens, living
Changing NK cells and cytotoxic T lymphocyte strengthens the function of macrophage, regulation T, the function of bone-marrow-derived lymphocyte.IFN-β can suppress
And killing tumor cell, mainly by promoting the immunologic function of body, improve macrophage, NK cells and CT L killing water
It is flat.
CRISPR-Cas9 gene editing technologies are the third generation genes developed rapidly after ZFN and TALEN technologies
There is the CRISPR-Cas acquired immunity of phage resistance invasion in bacterium and archeobacteria in group editing technique, the Technology origin
System, gradually grows up through artificial reconstructed.CRISPR refers to the short palindrome repetitive sequence in rule cluster interval, and Cas refers to
CRISPR GAP-associated protein GAPs.CRISPR-Cas genome editing techniques are to recognize target practice site by one section of RNA, pass through Cas cores
Nucleic acid near sour restriction endonuclease air exercise target site is cut to realize the fixed point editor to genome, therefore the technology is also referred to as
The endonuclease zymotechnic that RNA is instructed.Compared with ZFN and TALEN technologies, CRISPR-Cas genomes editing technique design,
It is all more convenient in synthesis and the screening of positive colony, and can realize and intracellular multiple sites are compiled at one simultaneously
Volume, improve the efficiency of gene editing.
The content of the invention
It is an object of the present invention to provide a kind of 293T cell lines for knocking out IFN-β gene.
The 293T cell lines provided by the present invention for knocking out IFN-β gene are specially human embryonic kidney cells 293T-KO-IFN- β,
It is CGMCC No.10096 in the deposit number of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
It is thin that second object of the present invention is to provide a kind of 293T based on CRISPR-Cas9 structure knockout IFN-β genes
The method of born of the same parents system.
It is provided by the present invention based on CRISPR-Cas9 build knock out IFN-β gene 293T cell lines method, be with
Meet in sequence table in IFN-β gene order shown in sequence 15 '-GG-18N-NGG-3 ' or 5 '-GG-20N-NGG-3 ' or 5 '-
Sequence shown in " 18N " or " 20N " in the sequence of CCN-18N-CC-3 ' or 5 '-CCN-20N-CC-3 ' series arrangements rule is target
Sequence；N is A or T or C or G.Wherein, 18N is 18 deoxyribonucleotides, and 20N is 20 deoxyribonucleotide
The target sequence can be 1-2；When the target sequence is 2, being preferably spaced between 2 target sequences
More than 200bp.
In one embodiment of the invention, the target sequence is the of IFN-β gene order shown in sequence 1 in sequence table
216-235, (being designated as target sequence 1)；In another embodiment of the present invention, the target sequence is the institute of sequence in sequence table 1
Show 545-562 (being designated as target sequence 2) of IFN-β gene order.
More specific, methods described is following (A) or (B)：
(A) (a1)-(a4) is comprised the following steps：
(a1) two single stranded DNAs of entitled positive single stranded DNA 1 and entitled reverse single stranded DNA 1 are synthesized；The forward direction
The sequence of single stranded DNA 1 is to add ACCG at 5 ' ends of the target sequence 1 as shown in sequence 2 in sequence table；It is described reversely single-stranded
DNA1 sequence is to add AAAC at 5 ' ends of the reverse complementary sequence of the target sequence 1 as shown in sequence 3 in sequence table；
(a2) the positive single stranded DNA 1 and the reverse single stranded DNA 1 are subjected to annealing reaction, obtain double-stranded DNA 1 (special
Different from target sequence 1), the double-strand has viscous end, its viscous end and the restriction enzyme site of the pGL-U6-gRNA plasmids after BsaI digestions
Complementation, can directly be attached reaction；
(a3) double-stranded DNA 1 is connected to the restriction enzyme BsaI of pGL-U6-gRNA plasmids cleavage site
Place, obtained recombinant plasmid is designated as pGL-U6-gRNA-IFN β -1；
(a4) by the pGL-U6-gRNA-IFN β -1 (Puromycin resistances) and Cas9 plasmids, (Blasticidin resists
Property), cotransfection 293T cells carry out resistance screening with Puromycin (3ug/ml) and Blasticidin (3ug/ml), screening
Time is 7 days, is then changed to normal DMEM culture mediums, obtains what IFN-β gene was knocked from the 293T cells after transfection
293T cell lines；
(B) (b1)-(b4) is comprised the following steps：
(b1) two single stranded DNAs of entitled positive single stranded DNA 2 and entitled reverse single stranded DNA 2 are synthesized；The forward direction
The sequence of single stranded DNA 2 is to be added at 5 ' ends of the reverse complementary sequence of the target sequence 2 as shown in sequence 4 in sequence table
ACCG；The sequence of the reverse single stranded DNA 2 is to add AAAC at 5 ' ends of the target sequence 2 as shown in sequence 5 in sequence table；
(b2) the positive single stranded DNA 2 and the reverse single stranded DNA 2 are subjected to annealing reaction, obtain double-stranded DNA 2 (special
Different from target sequence 2), the double-strand has viscous end, its viscous end and the restriction enzyme site of the pGL-U6-gRNA plasmids after BsaI digestions
Complementation, can directly be attached reaction；
(b3) double-stranded DNA 2 is connected to the restriction enzyme BsaI of pGL-U6-gRNA plasmids cleavage site
Place, obtained recombinant plasmid is designated as pGL-U6-gRNA-IFN β -2；
(b4) by the pGL-U6-gRNA-IFN β -2 (Puromycin resistances) and Cas9 plasmids, (Blasticidin resists
Property), cotransfection 293T cells carry out resistance screening with Puromycin (3 μ g/ml) and Blasticidin (3 μ g/ml), screening
Time is 7 days, is then changed to normal DMEM culture mediums, obtains what IFN-β gene was knocked from the 293T cells after transfection
293T cell lines；
The step of methods described in (a2) and (b2), the condition of the annealing reaction can be：97 DEG C of effect 7min, so
After shut down, Temperature fall 1h.
The step of methods described in (a4) and (b4), by the pGL-U6-gRNA-IFN β -1 (or pGL-U6-
GRNA-IFN β -2) and during Cas9 plasmid co-transfection 293T cells, the pGL-U6-gRNA-IFN β -1 (or the pGL-U6-
GRNA-IFN β -2) and the Cas9 plasmids mass ratio can be 1:1.
The 293T cell lines that the IFN-β gene prepared using methods described is knocked fall within the protection model of the present invention
Enclose.
The 293T cell lines that the IFN-β gene is knocked are specially the human embryonic kidney cells 293T-KO-IFN- β CGMCC
No.10096。
Third object of the present invention is to provide a kind of complete plasmid.
Complete plasmid provided by the present invention is by the pGL-U6-gRNA-IFN β -1 (or pGL-U6-gRNA-IFN
β -2) and Cas9 plasmids composition.
Wherein, two kinds of plasmids in the complete plasmid can be packed individually, can also be 1 according to mass ratio:1
Ratio is hybrid packed.
The purposes of the complete plasmid falls within protection scope of the present invention.
The purposes is specially to knock out IFN-β gene (sequence 1) in 293T cells based on CRISPR-Cas9.
It is thin that fourth object of the present invention is to provide a kind of 293T based on CRISPR-Cas9 structure knockout IFN-β genes
The kit of born of the same parents system.
The kit provided by the present invention that the 293T cell lines for knocking out IFN-β gene are built based on CRISPR-Cas9, is contained
There are the complete plasmid and specification；Record to build based on CRISPR-Cas9 as described above in the specification and knocked out
The method of the 293T cell lines of IFN-β gene.
The human embryonic kidney cells 293T-KO-IFN- β, or the IFN-β gene that is prepared using methods described are knocked
Application of the 293T cell lines in amplification Type B influenza virus falls within protection scope of the present invention.
The advantage of the invention is that：The 293T cell lines of IFN-β gene are knocked out, or lack a part for IFN-β gene, or
Cause frameshift mutation due to knocking out or inserting some fragments, therefore can not correctly express IFN-β albumen.Due to IFN-β albumen
With antivirus action, therefore Type B influenza virus substantial amounts of can not breed in the 293T cells of wild type.And knock out IFN-β base
The 293T cell lines of cause can be used for Type B influenza virus more preferable in the cell line due to can not correctly express IFN-β albumen
Propagation, obtain it is a greater amount of virus be used for experimental study.
Preservation explanation
Join the biomaterial of Ju：293T-KO-IFN-β
Scientific description：Human embryonic kidney cells
Preservation mechanism：China Committee for Culture Collection of Microorganisms's common micro-organisms center
Preservation mechanism is referred to as：CGMCC
Address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Preservation date：On December 1st, 2014
Collection is registered on the books numbering：CGMCC No.10096
Brief description of the drawings
Fig. 1 is PCR qualification results.
Fig. 2 is Westren-Blotting qualification results.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
PGL-U6-gRNA plasmids：GRNA is manually inserted to the recombinant plasmid constituted after the plasmid has guide effect, can be with
Position corresponding with the genome to be edited is combined, and plays a part of Guiding.Be recorded in " Ma Y, Ma J,
Zhang X,Chen W,Yu L,Lu Y,Bai L,Shen B,Huang X,Zhang L.2014.Generation of eGFP
and Cre knockin rats by CRISPR/Cas9.FEBS J.Jul 17.doi:10.1111/febs.12935. " one
Text, the public can obtain from Institute of Microorganism, Academia Sinica.
Cas9 plasmids：Function with endonuclease, the Cas9 plasmids can by and pGL-U6-gRNA combination after
Realize its cutting function to genome in the position for reaching the genome to be edited.It is recorded in " Ma Y, Zhang X, Shen
B,Lu Y,Chen W,Ma J,Bai L,Huang X,Zhang L.2014.Generating rats with
conditional alleles using CRISPR/Cas9.Cell Res.Jan；24(1):The text of 122-5. " one, the public can be from
Institute of Microorganism, Academia Sinica obtains.
Drug resistance is all carried on pGL-U6-gRNA plasmids and Cas9 plasmids, by drug screening, gene knockout can be obtained
Cell line.
Escherichia coli TOP10：Purchased from Invitrogen companies and article No. C4040-10.
293T cells：Be recorded in " Sh Cao, X-L Liu, M-R Yu, J Li, X-J Jia, Y-H Bi, L Sun,
George F.Gao,W-J Liu*.2012.A Nuclear Export Signal in the Matrix Protein of
Influenza A Virus Is Required for the Efficient Virus Replication.Journal of
Virology,86(9):4883-91." text, the public can obtain from Institute of Microorganism, Academia Sinica.
The structure of embodiment 1, the 293T cell lines of knockout IFN-β gene
First, the determination of gene target sequence to be knocked out and the design of DNA oligo primers
1st, the determination of gene target sequence to be knocked out
With HuIFN- beta gene sequences (sequence 1, intronless) for gene to be knocked out, using in DNAStar softwares
Editseq softwares are analyzed HuIFN- beta gene sequences, on this basis the suitable target sequence of artificial screening.For
HuIFN- β gene complete sequence the present inventor's final designs two target sequences, the of sequence 1 respectively in sequence table
216-235 (GAGGCTTGAATACTGCCTCA is designated as target sequence 1) and 545-562 of sequence 1
(AGGAGTACAGTCACTGTG is designated as target sequence 2).
When progress target sequence is determined, the present inventor is carried out according to following principle：
(1) meet in prioritizing selection HuIFN- β genes complete sequence (sequence 1) 5 '-GG-18N-NGG-3 ' (N represent A or T or
C or G) or " 18N " or " 20N " in the sequence of 5 '-GG-20N-NGG-3 ' series arrangement rules shown in sequence be used as target sequence.
If there is no above two sequence in the complete sequence for the gene to be knocked out, also may be selected the complementary series 5 ' of above two sequence-
CCN-18N-CC-3 ' or 5 '-CCN-20N-CC-3 ' motifs, will be used after the complementation of its direction.
(2) it is target sequence to be typically chosen the sequence required in (1) meeting on extron, the cell of general same knockout
System sets up two pairs of satisfactory target sequences simultaneously.
Both (3) select during two pairs of satisfactory target sequences to be desirable to be spaced a distance (>200bp).
(4) selected target sequence is preferably located at the more important functional domain of translated protein, so can be more
Good guarantee knocks out effect.
2nd, the design of DNA oligo primers
The target sequence determined according to step 1, designs two pairs of DNA oligo primers, and particular sequence is as follows：
Having synthesized two pairs of Oligonucleolide primers is used to prepare gRNA, and sequence is as follows：
For the DNA oligo primers of target sequence 1：
HuIFNβ-gRNA-UP1：5 '-ACCGGAGGCTTGAATACTGCCTCA-3 ' (sequence 2)；
HuIFNβ-gRNA-DOWN1：5 '-AAACTGAGGCAGTATTCAAGCCTC-3 ' (sequence 3).
For the DNA oligo primers of target sequence 2：
HuIFNβ-gRNA-UP2：5 '-ACCGCACAGTGACTGTACTCCT-3 ' (sequence 4)；
HuIFNβ-gRNA-DOWN2：5 '-AAACAGGAGTACAGTCACTGTG-3 ' (sequence 5).
2nd, the structure of expression gRNA recombinant plasmid
1st, the single-stranded annealing of oligonucleotides obtains double chain oligonucleotide
Two DNA oligo for target sequence 1 single-stranded (sequence 2 and sequence 3) of synthesis are annealed, double-strand double-strand is obtained
Oligonucleotides 1.
Two DNA oligo for target sequence 2 single-stranded (sequence 4 and sequence 5) of synthesis are annealed, double-strand double-strand is obtained
Oligonucleotides 2.
Annealing reaction system and annealing reaction condition are as follows：
Annealing reaction system：The μ l of HuIFN β-gRNA-UP1 or HuIFN β-gRNA-UP2 (concentration 10mM) 20；HuIFNβ-
The μ l of gRNA-DOWN1 or HuIFN β-gRNA-DOWN 2 (concentration 10mM) 20；NEB buffer210μl.
Annealing reaction condition：By in the well mixed rear PCR instrument of above-mentioned system, then 97 DEG C of effect 7min shut down, drop naturally
Agarose gel electrophoresis detection and gel extraction annealed product that sample carries out 2% are taken out after temperature, 1h, QIAquick Gel Extraction Kit used is
Oligonucleotides QIAquick Gel Extraction Kit (Tiangeng company), concrete operation step is strictly carried out by its specification.
2nd, digestion and coupled reaction
Spend endotoxic plasmid extraction kit and extract pGL-U6-gRNA plasmids, then use restriction endonuclease
BSAI carries out digestion, and digestion condition is 37 DEG C and cuts 4h.The agarose gel electrophoresis that plasmid after digestion is carried out into 1% detects digestion
Effect simultaneously carries out glue reclaim, and glue reclaim used kit is Bo Maide Products.
Because annealed product directly contains the viscous end complementary with pGL-U6-gRNA carriers restriction enzyme site, therefore can directly it use
In connection experiment.
Digested plasmid after glue reclaim and glue reclaim annealed product are attached reaction, specific system and condition are as follows：
Linked system：The μ l of annealed product (double chain oligonucleotide 1 or double chain oligonucleotide 2) 6 after glue reclaim；After glue reclaim
The μ l of digestion pGL-U6-gRNA carriers 2；The μ l of ligase 1；The μ l of 10 × ligase Buffer 1.
Condition of contact：16 DEG C of connections are stayed overnight in PCR instrument.
3rd, convert
10 μ l connection products are added in 50 μ l Escherichia coli TOP10 competent cells in superclean bench, ice bath
30min, then heat shock 90sec in 42 DEG C of water-baths, then ice bath 5min, is then added after 500 μ l nonreactive LB fluid nutrient mediums, 37
DEG C, after 200rpm concussion and cultivates 40min, it is coated with overnight incubation in the LB solid plates of ammonia benzyl resistance, 37 DEG C of incubators.It is to appear
After single bacterium colony, the bacterium colony that picking 5 is of moderate size extracts plasmid, transfers to Bo Maide companies to be sequenced.
It will show to insert at the restriction enzyme site BSAI of pGL-U6-gRNA plasmids through sequencing
The recombinant plasmid of DNA fragmentation is named as shown in " 5 '-GAGGCTTGAATACTGCCTCA-3 ' "
pGL-U6-gRNA-IFNβ1；It will show to insert at the restriction enzyme site BSAI of pGL-U6-gRNA plasmids through sequencing
The recombinant plasmid of DNA fragmentation is named as shown in " 5 '-CACAGTGACTGTACTCCT-3 ' "
pGL-U6-gRNA-IFNβ2。
4th, the extraction of recombinant plasmid
The correct clone of sequencing is enlarged culture, endotoxic plasmid extraction kit (Tiangeng company) extraction is spent
Recombinant plasmid simultaneously determines plasmid concentration, and the concrete operation step of recombinant plasmid is carried out in strict accordance with specification.
3rd, transfection and the screening of monoclonal
The recombinant plasmid pGL-U6-gRNA-IFN β 1 (or pGL-U6-gRNA-IFN β 2) that step 2 is built and Cas9 matter
Grain corotation 293T cells, concrete operation step is as follows：
(1) by 293T cells point to overnight incubation after 10cm Tissue Culture Dish, used medium is containing 10% (volume integral
Number) FBS DMEM culture mediums, carry out next-step operation when next day, early cell confluency degree reached 70% or so.
(2) cell that cell confluency degree is reached into 70% changes liquid into opti-MEM, is transfected after 2h.Then by two kinds
Plasmid and Lip2000 are diluted in 250 μ l opti-MEM respectively, are then added the Lip2000 after dilution mixed after dilution
In conjugative plasmid, gently mix, stand after 20min, be gently added dropwise and shift in advance in the cell of opti-MEM culture mediums, be placed in 37 DEG C
Cultivated in cell culture incubator, cell is changed into liquid after 4-6h and continued into the DMEM culture mediums containing 10% (volume fraction) FBS
Culture.The two kinds of plasmid concentrations transfected are to distinguish 12 μ g/10cm wares, and plasmid and Lip ratio are 1：2.5, that is, add 24 μ g's
Plasmid is mixed, then the Lip2000 needed to use amount is 60 μ l.
(3) after plasmid 24h is added, cell is changed into liquid to the 10% (body containing 3 μ g puromycins and 3 μ g blasticidin Ss
Fraction) FBS DMEM culture mediums in, cultivate 3-5 days, each 24h changes once fresh resistance culture base.
(4) after 3-5 days monoclonal occur, it is changed to the culture medium that resistance halves and maintains 2-3 days, be changed to be not added with resistance afterwards
The culture medium of DMEM containing 10% (volume fraction) FBS is cultivated.
(5) after after cell formation monoclonal, cell is diluted in 96 orifice plates by limiting dilution assay, picking list after cultivating 7 days
Hole is cloned, is passaged in 24 orifice plates and is enlarged culture.In 24 orifice plates cultivate 4-5 days after, pancreatin had digestive transfer culture into 12 orifice plates,
Each monoclonal passes 2 holes, and a hole is used to expand culture to 6 orifice plates to facilitate follow-up PCR to detect, a hole is used to stay
Deposit.
(6) PCR identifies positive colony
It will be enlarged by the monoclonal of 6 orifice plates carrying out the extraction of cell genomic dna, used kit is given birth to for Tiangeng company
Production.
Drawing for cotransfection recombinant plasmid pGL-U6-gRNA-IFN β 1 and the 293T cells of Cas9 plasmids is identified for PCR
Thing sequence is as follows：
PCR-KOIFN-β-up1：5 '-TCTAACTGCAACCTTTCGAAGCC-3 ' (5-27 of sequence 1)；
PCR-KOIFN-β-down1：5 '-CCAGGACTGTCTTCAGATGGTTT-3 ' be (423-445 s' of sequence 1
Reverse complementary sequence).
PCR-KOIFN- β-up1/PCR-KOIFN- β-down1 primer pair amplifies are used to cannot get size for 441bp purposes
The clone of band (5-445 of sequence 1) is the positive.
Drawing for cotransfection recombinant plasmid pGL-U6-gRNA-IFN β 2 and the 293T cells of Cas9 plasmids is identified for PCR
Thing sequence is as follows：
PCR-KOIFN-β-up2：5 '-GCATTGACCATCTATGAGATGCT-3 ' (304-326 of sequence 1)；
PCR-KOIFN-β-down2：5 '-CTTCTAGTGTCCTTTCATATGCAG-3 ' be (731-754 s' of sequence 1
Reverse complementary sequence).
PCR-KOIFN- β-up2/PCR-KOIFN- β-down2 primer pair amplifies are used to cannot get size for 451bp purposes
The clone of band (304-754 of sequence 1) is the positive.
Experiment simultaneously using the 293T cell lines genome of wild type as masterplate as a control group.
As a result show, using wild type 293T cell lines genome as the control group of masterplate, using PCR-KOIFN- β-up1/
PCR-KOIFN- β-down1 primer pair amplifies must obtain size for 441bp purpose bands (5-445 of sequence 1), use
It is 451bp purpose bands (the of sequence 1 that PCR-KOIFN- β-up2/PCR-KOIFN- β-down2 primer pair amplifies, which obtained size,
304-754).And cotransfection recombinant plasmid pGL-U6-gRNA-IFN β 1 and Cas9 plasmids 293T cells, and cotransfection
Recombinant plasmid pGL-U6-gRNA-IFN β 2 and Cas9 plasmids 293T cells obtain positive colony.Wherein, partly use
PCR-KOIFN- β-up1/PCR-KOIFN- β-down1 primer pairs identify cotransfection recombinant plasmid pGL-U6-gRNA-IFN β 1
The result cloned with the 293T cell positives of Cas9 plasmids as shown in figure 1, swimming lane 1 be using wild type 293T cell lines genome as
The control group of masterplate；Swimming lane 2 be knocked out the 293T cell lines after the HuIFN- β genes of part positive colony (i.e. it is of the invention most
Eventually obtain preservation cell 293T-KO-IFN- β) amplification.
(7) Western-blot identifies the expression of IFN-β
1. by the 293T passages of the cell line to be identified and wild type into 24 orifice plates, overnight incubation, training used
It is the DMEM culture mediums containing 10% (volume fraction) FBS to support base, under being carried out when next day, early cell confluency degree reached 70% or so
Step operation.
2. with the PR8 strains (A/H1N1/PR8) of influenza A (be recorded in " and Zhong Juying, Cui Xiaolan, when space wait the golden bavins of quietly
Antiviral capsules prevent and treat experimental study world's combination of Chinese tradiational and Western medicine magazines of PR8 plants of infecting mouse pneumonia of H1N1virus,
The text of the 4th phase of volume 5 in 2010 " one) the infection cell line to be detected, infective dose is MOI=0.1, before infection and after infection
12h is separately sampled.Lysis buffer (the formulas of precooling will be added in cell precipitation：The Triton X100 of 1% volume fraction,
150mM NaCl, 20mM Hepes, the glycerine of 10% volume fraction, 1mM EDTA, pH7.4), per the μ l of hole 100, use cell
Scrape after cell, in the EP pipes for inserting 1.5ml, cell precipitation is abandoned after centrifugation, supernatant is standby.
3. ready sample is subjected to Western-blot analyses.Concrete operation step is：
A. according to《Molecular cloning》Described method carries out SDS-PAGE.With the protein molecular weight Marker of pre-dyed.Electricity
After swimming is finished, gel is put into electricity and turns to carry out transferring film after balancing 2min in buffer solution.
B. the thick filter paper of six 3mm is sheared according to the size of gel, be soaked in transfering buffering liquid.Cut one it is more slightly larger than filter paper
Pvdf membrane, methanol soak more than 5min, electricity turn liquid balance 10min after use.3 thickness are sequentially placed in half-dried transferring film instrument
Filter paper, transfer film, gel, 3 metafiltration paper, note driving each interlayer bubble away.15V electricity turns 20min.
C. it is sure not to make the transfer film of transfer to be dried, transferring film is quickly put in appropriate confining liquid after terminating and closed.Room temperature jog
1h。
D. transfer film is put into hybridization bag, according to 0.1ml/cm2Consumption is separately added into the mouse suitably diluted with confining liquid
Anti- HuIFN β primary antibodies (Santa Cruz Products, catalog number (Cat.No.)：Sc-17565,1:1000 dilutions), bubble is eliminated, is sealed.
Jog on decolorization swinging table is placed at room temperature and is incubated 2h or so (or being stayed overnight in 4 DEG C of jogs), antibody is fully combined.After film is removed
It is put into TBST solution, washes film 3 times, each 7min.
E. film is put into hybridization bag, the corresponding sheep for horseradish peroxidase (HRP) mark that addition is prepared with confining liquid
Anti- mouse IgG secondary antibodies (Santa Cruz Products, catalog number (Cat.No.)：Sc-166261,1:5000 dilutions).Bubble removing is caught up with to seal, room temperature
Vibrate 2h.
F. transfer film is taken out, is washed with TBST three times, each 10min.
G. luminescent solution (Tiangeng Products) A liquid, each 0.5ml of B liquid is taken to be well mixed in equal volume.Transfer film is gently contacted
Filter paper blots liquid, and the one side for having protein is placed on preservative film upward.ECL mixed liquors are added drop-wise on transfer film, reacted
3min.Pvdf membrane is wrapped up with preservative film immediately, notices that surface is smooth, is put into CLINX chemical gel imagers and is imaged.
As a result as shown in Fig. 2 swimming lane 1 be with knock out the 293T cell lines after the HuIFN- β genes of part infection before 0h knot
Really (no purpose band), swimming lane 2 be with knock out the 293T cell lines after the HuIFN- β genes of part infection after 12h result (no mesh
Band), swimming lane 3 is the result (no purpose band) of 0h before the 293T cell lines infection of wild type, and swimming lane 4 is wild type
12h result (obtaining the purpose band that size is about 21KD, in the same size with expection) after the infection of 293T cell lines.Can from result
To find out, 293T cell lines (the preservation cell 293T-KO- that i.e. present invention is finally obtained after the HuIFN- β genes of part is knocked out
IFN-β) 12h still can't detect the expression of HuIFN- β albumen after virus is stimulated, and show that the cell line is knocked out successfully.
The present inventor identifies one of them through above PCR and Western-blot identifies to be positive clone
(cotransfection 293T cells of the recombinant plasmid pGL-U6-gRNA-IFN β 1 with Cas9 plasmids) was preserved on December 1st, 2014
China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address：Chaoyang District, Beijing City North Star west
The institute 3 of road 1), join the biomaterial of Ju：293T-KO-IFN- β, scientific description：Human embryonic kidney cells, collection is registered on the books
Numbering：CGMCC No.10096.
Claims (7)
1. a kind of method that the 293T cell lines for knocking out IFN-β gene are built based on CRISPR-Cas9, it is characterised in that：It is described
Method in IFN-β gene order shown in sequence in sequence table 1 to meet 5 '-GG-18N-NGG-3 ' or 5 '-GG-20N-NGG-3 '
5 '-CCN-18N-CC-3 ' or 5 '-CCN-20N-CC-3 ' series arrangements rule sequence in " 18N " or " 20N " shown in sequence
Row are used as target sequence；N is A or T or C or G.
2. according to the method described in claim 1, it is characterised in that：The target sequence is IFN-β base shown in sequence 1 in sequence table
Because of 216-235 of sequence or 545-562.
3. method according to claim 2, it is characterised in that：Methods described is following (A) or (B)：
(A) (a1)-(a4) is comprised the following steps：
(a1) two single stranded DNAs of entitled positive single stranded DNA 1 and entitled reverse single stranded DNA 1 are synthesized；The forward direction is single-stranded
DNA1 sequence is as shown in sequence 2 in sequence table；The sequence of the reverse single stranded DNA 1 is as shown in sequence 3 in sequence table；
(a2) the positive single stranded DNA 1 and the reverse single stranded DNA 1 are subjected to annealing reaction, obtain double-stranded DNA 1；
(a3) double-stranded DNA 1 is connected at the restriction enzyme BsaI cleavage site of pGL-U6-gRNA plasmids, obtained
To recombinant plasmid be designated as pGL-U6-gRNA-IFN β -1；
(a4) by the pGL-U6-gRNA-IFN β -1 and Cas9 plasmid co-transfection 293T cells, from the 293T cells after transfection
Obtain the 293T cell lines that IFN-β gene is knocked；
(B) (b1)-(b4) is comprised the following steps：
(b1) two single stranded DNAs of entitled positive single stranded DNA 2 and entitled reverse single stranded DNA 2 are synthesized；The forward direction is single-stranded
DNA2 sequence is as shown in sequence 4 in sequence table；The sequence of the reverse single stranded DNA 2 is as shown in sequence 5 in sequence table；
(b2) the positive single stranded DNA 2 and the reverse single stranded DNA 2 are subjected to annealing reaction, obtain double-stranded DNA 2；
(b3) double-stranded DNA 2 is connected at the restriction enzyme BsaI cleavage site of pGL-U6-gRNA plasmids, obtained
To recombinant plasmid be designated as pGL-U6-gRNA-IFN β -2；
(b4) by the pGL-U6-gRNA-IFN β -2 and Cas9 plasmid co-transfection 293T cells, from the 293T cells after transfection
Obtain the 293T cell lines that IFN-β gene is knocked.
4. method according to claim 3, it is characterised in that：In step (a2) and step (b2), the annealing reaction
Condition is：97 DEG C of effects 7min, Temperature fall 1h；Or
In step (a4), during by the pGL-U6-gRNA-IFN β -1 and Cas9 plasmid co-transfection 293T cells, the pGL-U6-
The mass ratio of gRNA-IFN β -1 and the Cas9 plasmids is 1:1；Or
In step (b4), during by the pGL-U6-gRNA-IFN β -2 and Cas9 plasmid co-transfection 293T cells, the pGL-U6-
The mass ratio of gRNA-IFN β -2 and the Cas9 plasmids is 1:1.
5. complete plasmid, is made up of pGL-U6-gRNA-IFN β -1 described in claim 4 and the Cas9 plasmids, or by right
It is required that pGL-U6-gRNA-IFN β -2 described in 4 and Cas9 plasmids composition.
6. the purposes of complete plasmid described in claim 5, it is characterised in that：The purposes is to be knocked out based on CRISPR-Cas9
IFN-β gene in 293T cells.
7. the kit for the 293T cell lines for knocking out IFN-β gene is built based on CRISPR-Cas9, containing described in claim 5
Complete plasmid and specification；Had the right described in the specification any described method in requirement 1-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410806018.0A CN104560864B (en) | 2014-12-22 | 2014-12-22 | Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410806018.0A CN104560864B (en) | 2014-12-22 | 2014-12-22 | Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560864A CN104560864A (en) | 2015-04-29 |
| CN104560864B true CN104560864B (en) | 2017-08-11 |
Family
ID=53077944
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410806018.0A Active CN104560864B (en) | 2014-12-22 | 2014-12-22 | Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560864B (en) |
Families Citing this family (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3613852A3 (en) | 2011-07-22 | 2020-04-22 | President and Fellows of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
| US9322037B2 (en) | 2013-09-06 | 2016-04-26 | President And Fellows Of Harvard College | Cas9-FokI fusion proteins and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| DK3066201T3 (en) | 2013-11-07 | 2018-06-06 | Editas Medicine Inc | CRISPR-RELATED PROCEDURES AND COMPOSITIONS WITH LEADING GRADES |
| US20150166982A1 (en) | 2013-12-12 | 2015-06-18 | President And Fellows Of Harvard College | Methods for correcting pi3k point mutations |
| WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| CN105112412B (en) * | 2015-09-14 | 2017-12-26 | 中国科学院北京基因组研究所 | For knocking out the gRNA sequences and its knockout technique of people's BTF genes |
| JP7109784B2 (en) | 2015-10-23 | 2022-08-01 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Evolved Cas9 protein for gene editing |
| EP3380616A4 (en) | 2015-11-24 | 2019-11-06 | Commonwealth Scientific and Industrial Research Organisation | Production of viruses in avian eggs |
| CN108603188A (en) | 2015-11-24 | 2018-09-28 | 联邦科学技术研究组织 | Virus is generated in cell culture |
| WO2018027078A1 (en) | 2016-08-03 | 2018-02-08 | President And Fellows Of Harard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| WO2018071868A1 (en) | 2016-10-14 | 2018-04-19 | President And Fellows Of Harvard College | Aav delivery of nucleobase editors |
| WO2018119359A1 (en) | 2016-12-23 | 2018-06-28 | President And Fellows Of Harvard College | Editing of ccr5 receptor gene to protect against hiv infection |
| WO2018165504A1 (en) | 2017-03-09 | 2018-09-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| KR20190127797A (en) | 2017-03-10 | 2019-11-13 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Cytosine to Guanine Base Editing Agent |
| CA3057192A1 (en) | 2017-03-23 | 2018-09-27 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable dna binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| CN107236741A (en) * | 2017-07-19 | 2017-10-10 | 广州医科大学附属第五医院 | A kind of gRNA and method for knocking out wild-type T cells TCR alpha chains |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| CA3082251A1 (en) | 2017-10-16 | 2019-04-25 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN107937501A (en) * | 2017-11-24 | 2018-04-20 | 安徽师范大学 | A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects |
| CN108148866B (en) * | 2018-01-19 | 2020-09-01 | 中国人民解放军第三0二医院 | HCBP6 gene knockout cell line and construction method thereof |
| CN108467874A (en) * | 2018-04-04 | 2018-08-31 | 首都医科大学附属北京朝阳医院 | The gene constructed O-type of Cosmc, which is knocked out, using Crispr technologies glycosylates abnormal colon carcinoma cell line |
| CN108504693A (en) * | 2018-04-04 | 2018-09-07 | 首都医科大学附属北京朝阳医院 | The O-type that T synthase genes structure is knocked out using Crispr technologies glycosylates abnormal colon carcinoma cell line |
| MX2021011426A (en) | 2019-03-19 | 2022-03-11 | Broad Inst Inc | Methods and compositions for editing nucleotide sequences. |
| IL297761A (en) | 2020-05-08 | 2022-12-01 | Broad Inst Inc | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN114075549A (en) * | 2020-08-19 | 2022-02-22 | 中国科学院分子细胞科学卓越创新中心 | Fluorescent reporter cell for detecting interferon IFN beta induced expression and construction method thereof |
| CN112481305A (en) * | 2020-11-30 | 2021-03-12 | 郑州大学 | Method for constructing EPB41 gene knockout THP-1 cell line based on CRISPR-Cas9 system |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103668472B (en) * | 2013-12-31 | 2014-12-24 | 北京大学 | Method for constructing eukaryon gene knockout library by using CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system |
-
2014
- 2014-12-22 CN CN201410806018.0A patent/CN104560864B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560864A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104560864B (en) | Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings | |
| Zhang et al. | Isolation and characterization of an astrovirus causing fatal visceral gout in domestic goslings | |
| CN108486108A (en) | It is a kind of knock out people's HMGB1 genes cell strain and its application | |
| CN106957844A (en) | It is a kind of effectively to knock out the virus genomic CRISPR/Cas9 of HTLV 1 gRNA sequences | |
| CN105518138A (en) | Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes | |
| CN105518137A (en) | Method for specifically removing pig SALL1 gene by CRISPR-Cas9 and sgRNA used for specific targeting SALL1 gene | |
| CN105492609A (en) | Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene | |
| CN105518135A (en) | Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene | |
| CN105492608A (en) | Method using CRISPR-Cas9 to specifically knock off pig PDX1 gene and sgRNA of PDX1 gene for specific targeting | |
| Sozzi et al. | Genomic Characterization of Pseudorabies Virus Strains Isolated in I taly | |
| Stenzel et al. | The epidemiology, molecular characterization and clinical pathology of circovirus infections in pigeons–current knowledge | |
| CN106282216A (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| CN105543257A (en) | PAPN gene site-directed modified pig | |
| CN105002146A (en) | RHVT (recombinant Herpesvirus of Turkey)-H9HA (H9 hemagglutinin) and construction method thereof | |
| Dong et al. | CRISPR/Cas9‐mediated disruption of the immediate early‐0 and 2 as a therapeutic approach to Bombyx mori nucleopolyhedrovirus in transgenic silkworm | |
| CN108048483A (en) | Science recombined adhenovirus HAdV-5 carrier systems and its application | |
| CN108148866A (en) | A kind of HCBP6 Knockout cells system and its construction method | |
| CN105132424A (en) | MicroRNA inhibitor, microRNA inhibitor expression vector, building method of microRNA inhibitor expression vector and application of microRNA inhibitor expression vector | |
| Shortridge et al. | Incidence and preliminary characterisation of a hitherto unreported, serologically distinct, avian paramyxovirus isolated in Hong Kong | |
| CN102327606B (en) | Brucella live vaccine and production method thereof | |
| CN103981192A (en) | Recombinant adenovirus for expression of goat alpha interferon and construction method and application thereof | |
| CN105063023A (en) | Zinc finger nuclease-mediated porcine MSTN (myostatin) gene mutation sequence and application thereof | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN109897825A (en) | It is a kind of to be simple and efficient the cell system for generating hepatitis type B virus recombination cccDNA | |
| CN111793721A (en) | Application of eEF1D protein in preparation of drugs for preventing or treating foot-and-mouth disease virus infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |