CN104560864B - Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings - Google Patents

Abstract

The invention discloses a 293T cell line constructed by using a CRISPR-Cas9 system to knock out the IFN-β gene. The 293T cell line knocked out of the IFN-β gene provided by the present invention is specifically the human embryonic kidney cell 293T-KO-IFN-β, and its preservation number in the General Microbiology Center of the China Committee for the Collection of Microorganisms is CGMCC No. 10096. Experiments have proved that the knockout 293T cell line of the IFN-β gene obtained in the present invention cannot correctly express the IFN-β protein. Since the IFN-β protein has an antiviral effect, the type B influenza virus cannot proliferate in large quantities in wild-type 293T cells. The 293T cell line with IFN-β gene knockout can not express IFN-β protein correctly, so it can be used for better proliferation of influenza B virus in this cell line, and a larger amount of virus can be obtained for experimental research.

Description

293T cell line with IFN-β gene knockout constructed by CRISPR-Cas9 system

technical field

The invention belongs to the field of biotechnology, and relates to a 293T cell line constructed by using a CRISPR-Cas9 system to knock out the IFN-β gene.

Background technique

293T cells are derived from 293 cells. 293 cells are human renal epithelial cell lines transfected with adenovirus E1A gene, and express SV40 large T antigen at the same time. The plasmid containing the SV40 replication origin and promoter region can replicate. The transfection efficiency can be as high as 50% with Ca ₃ (PO ₄ ) ₂ . The protein expression level is high, and the expressed protein can be easily detected by alkaline phosphatase analysis 2-3 days after transfection. Transient transfection of 293T cells is a convenient way to overexpress proteins and obtain intracellular and extracellular (secreted or membrane) proteins.

IFN-β is a glycoprotein mainly produced by fibroblasts and leukocytes under the induction of stimuli such as bacteria, viruses, polyinosinic acid polycytidylic acid (Poly IC), and nucleotides. The genes of HuIFN-β are all located on human chromosome 9. The HuIFN-β protein consists of 166 amino acids and is a glycosylated protein with a molecular weight of about 23KD. The peptide chain contains 3 Cys at positions 17, 31 and 141, respectively. , wherein the disulfide bond formed between cysteines 31 and 141 is very important for the biological activity of HuIFN-β. IFN-β has a variety of biological functions, mainly including anti-virus, inhibiting the growth of certain cells, immune regulation, and the functions of inhibiting and killing tumor cells. The antiviral effect of IFN-β is different for different viruses, even for different serotypes of the same virus. Its antiviral mechanism of action is mainly achieved through two aspects: 1) It realizes its antiviral function by inhibiting the adsorption, uncoating and transcription of certain viruses, viral protein synthesis and the release of mature viruses; 2) by enhancing natural killing NK cells and mononuclear macrophages phagocytize viruses to realize their antiviral functions. IFN-β can also inhibit the growth of certain cells, such as the proliferation of fibroblasts, epithelial cells, endothelial cells, and hematopoietic cells. The mechanism may be to stop cell division in G0/G1 phase, reduce DNA synthesis, and down-regulate cell Transcriptional levels of proto-oncogenes, downregulation of certain growth factor receptors. IFN-β also has immunoregulatory effects, including promoting the expression of MHC-I antigens in most cells, activating NK cells and killer T lymphocytes, enhancing the function of macrophages, and regulating the functions of T and B lymphocytes. IFN-β can inhibit and kill tumor cells, mainly by promoting the immune function of the body and increasing the killing level of macrophages, NK cells and CTL.

CRISPR-Cas9 gene editing technology is the third-generation genome editing technology developed rapidly after ZFN and TALEN technology. This technology comes from the CRISPR-Cas acquired immune system in bacteria and archaea that resists phage invasion. gradually developed. CRISPR refers to regularly clustered interspaced short palindromic repeats, and Cas refers to CRISPR-associated proteins. CRISPR-Cas genome editing technology uses a piece of RNA to identify the target site, and the Cas endonuclease cuts the nucleic acid near the target site to achieve fixed-point editing of the genome, so this technology is also called RNA-guided endonucleic acid cutting enzyme technology. Compared with ZFN and TALEN technologies, CRISPR-Cas genome editing technology is more convenient in design, synthesis and screening of positive clones, and can simultaneously edit multiple sites in a cell, improving the efficiency of gene editing .

Contents of the invention

One object of the present invention is to provide a 293T cell line in which the IFN-β gene is knocked out.

The 293T cell line with IFN-β gene knockout provided by the present invention is specifically human embryonic kidney cell 293T-KO-IFN-β, and its preservation number in the General Microbiology Center of China Committee for Culture Collection of Microorganisms is CGMCC No. 10096.

The second object of the present invention is to provide a method for constructing a 293T cell line that knocks out the IFN-β gene based on CRISPR-Cas9.

The method for constructing a 293T cell line that knocks out the IFN-β gene based on CRISPR-Cas9 provided by the present invention is to conform to 5'-GG-18N-NGG-3' in the IFN-β gene sequence shown in sequence 1 in the sequence listing Or "18N" or "20N" in the sequence of 5'-GG-20N-NGG-3' or 5'-CCN-18N-CC-3' or 5'-CCN-20N-CC-3' sequence arrangement rules The sequence shown is that of the target sequence; N is A or T or C or G. Among them, 18N is 18 deoxyribonucleotides, and 20N is 20 deoxyribonucleotides.

There may be 1-2 target sequences; when there are 2 target sequences, the interval between the 2 target sequences is preferably greater than 200bp.

In one embodiment of the present invention, the target sequence is the 216-235th position of the IFN-β gene sequence shown in Sequence 1 in the Sequence Listing (denoted as target sequence 1); in another embodiment of the present invention , the target sequence is the 545th-562th position of the IFN-β gene sequence shown in sequence 1 in the sequence table (denoted as target sequence 2).

More specifically, the method is as follows (A) or (B):

(A) includes the following steps (a1)-(a4):

(a1) Synthesize two single-stranded DNAs named forward single-stranded DNA1 and reverse single-stranded DNA1; the sequence of the forward single-stranded DNA1 is as shown in sequence 2 in the sequence table, which is in the target sequence ACCG is added to the 5' end of 1; the sequence of the reverse single-stranded DNA 1 is shown as sequence 3 in the sequence listing, which is to add AAAC to the 5' end of the reverse complementary sequence of the target sequence 1;

(a2) annealing the forward single-stranded DNA1 and the reverse single-stranded DNA1 to obtain a double-stranded DNA1 (specific to the target sequence 1), the double-strand has a sticky end, and the sticky end is digested with BsaI The enzyme cutting site of pGL-U6-gRNA plasmid is complementary and can be used for direct ligation reaction;

(a3) connecting the double-stranded DNA1 to the cleavage site of the restriction endonuclease BsaI of the pGL-U6-gRNA plasmid, and the resulting recombinant plasmid is denoted as pGL-U6-gRNA-IFNβ-1;

(a4) Co-transfect 293T cells with the pGL-U6-gRNA-IFNβ-1 (Puromycin resistance) and Cas9 plasmid (Blasticidin resistance), and perform with Puromycin (3ug/ml) and Blasticidin (3ug/ml) Resistance screening, the screening time was 7 days, and then replaced with normal DMEM medium, and the 293T cell line with the IFN-β gene knocked out was obtained from the transfected 293T cells;

(B) includes the following steps (b1)-(b4):

(b1) Synthesize two single-stranded DNAs named forward single-stranded DNA2 and reverse single-stranded DNA2; the sequence of the forward single-stranded DNA2 is as shown in sequence 4 in the sequence table, which is in the target sequence ACCG is added to the 5' end of the reverse complementary sequence of 2; the sequence of the reverse single-stranded DNA 2 is shown in sequence 5 in the sequence listing, which is AAAC is added to the 5' end of the target sequence 2;

(b2) annealing the forward single-stranded DNA2 and the reverse single-stranded DNA2 to obtain a double-stranded DNA2 (specific to the target sequence 2), the double-strand has a sticky end, and the sticky end is digested with BsaI The enzyme cutting site of pGL-U6-gRNA plasmid is complementary and can be used for direct ligation reaction;

(b3) connecting the double-stranded DNA 2 to the cleavage site of the restriction endonuclease BsaI of the pGL-U6-gRNA plasmid, and the resulting recombinant plasmid is denoted as pGL-U6-gRNA-IFNβ-2;

(b4) The pGL-U6-gRNA-IFNβ-2 (Puromycin resistance) and Cas9 plasmid (Blasticidin resistance) were co-transfected into 293T cells with Puromycin (3 μg/ml) and Blasticidin (3 μg/ml) Resistance screening, the screening time was 7 days, and then replaced with normal DMEM medium, and the 293T cell line with the IFN-β gene knocked out was obtained from the transfected 293T cells;

In the steps (a2) and (b2) of the method, the conditions of the annealing reaction can be: 97°C for 7 minutes, then shut down, and cool down naturally for 1 hour.

In steps (a4) and (b4) of the method, when the pGL-U6-gRNA-IFNβ-1 (or the pGL-U6-gRNA-IFNβ-2) and the Cas9 plasmid are co-transfected into 293T cells , the mass ratio of the pGL-U6-gRNA-IFNβ-1 (or the pGL-U6-gRNA-IFNβ-2) and the Cas9 plasmid can be 1:1.

The 293T cell line in which the IFN-β gene is knocked out prepared by the method also belongs to the protection scope of the present invention.

The 293T cell line in which the IFN-β gene is knocked out is specifically the human embryonic kidney cell 293T-KO-IFN-βCGMCC No. 10096.

The third object of the present invention is to provide a set of plasmids.

The set of plasmids provided by the present invention consists of the pGL-U6-gRNA-IFNβ-1 (or the pGL-U6-gRNA-IFNβ-2) and the Cas9 plasmid.

Wherein, the two plasmids in the set of plasmids can be packaged separately, or mixed and packaged according to a mass ratio of 1:1.

The use of the set of plasmids also belongs to the protection scope of the present invention.

The use is specifically to knock out the IFN-β gene (sequence 1) in 293T cells based on CRISPR-Cas9.

The fourth object of the present invention is to provide a kit for constructing a 293T cell line that knocks out the IFN-β gene based on CRISPR-Cas9.

The kit for constructing a 293T cell line that knocks out the IFN-β gene based on CRISPR-Cas9 provided by the present invention contains the set of plasmids and instructions; the instructions describe the above-mentioned construction of knockout IFN based on CRISPR-Cas9 -Methods for the 293T cell line of the beta gene.

The application of the human embryonic kidney cell 293T-KO-IFN-β, or the IFN-β gene knockout 293T cell line prepared by the method in amplifying influenza B virus also belongs to the protection scope of the present invention .

The advantage of the present invention is that: the 293T cell line with IFN-β gene knockout, or lack of a part of IFN-β gene, or cause frameshift mutation due to knockout or insertion of certain fragments, so it cannot express IFN-β protein correctly . Since the IFN-β protein has an antiviral effect, the type B influenza virus cannot proliferate in large quantities in wild-type 293T cells. The 293T cell line with IFN-β gene knockout can not express IFN-β protein correctly, so it can be used for better proliferation of influenza B virus in this cell line, and a larger amount of virus can be obtained for experimental research.

Preservation instructions

Reference biological material: 293T-KO-IFN-β

Scientific Description: Human Embryonic Kidney Cells

Preservation institution: General Microbiology Center of China Committee for the Collection of Microorganisms

Depository institution abbreviation: CGMCC

Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing

Deposit date: December 1, 2014

Registration number of the collection center: CGMCC No.10096

Description of drawings

Figure 1 shows the results of PCR identification.

Fig. 2 is the identification result of Westren-Blotting.

detailed description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

pGL-U6-gRNA plasmid: The recombinant plasmid formed by artificially inserting gRNA into the plasmid has a guiding effect, and can be combined with the corresponding position in the genome to be edited to play the role of Guiding. Recorded in "Ma Y, Ma J, Zhang X, Chen W, Yu L, Lu Y, Bai L, Shen B, Huang X, Zhang L. 2014.Generation of eGFPand Cre knockin rats by CRISPR/Cas9.FEBS J.Jul 17.doi:10.1111/febs.12935.” The article is available to the public from the Institute of Microbiology, Chinese Academy of Sciences.

Cas9 plasmid: it has the function of endonuclease, and the Cas9 plasmid can reach the position of the genome to be edited to realize its cutting function on the genome by combining with pGL-U6-gRNA. Recorded in "Ma Y, Zhang X, ShenB, Lu Y, Chen W, Ma J, Bai L, Huang X, Zhang L. 2014. Generating rats with conditional alleles using CRISPR/Cas9. Cell Res. Jan; 24(1): 122-5.", publicly available from the Institute of Microbiology, Chinese Academy of Sciences.

Both the pGL-U6-gRNA plasmid and the Cas9 plasmid have drug resistance, and through drug screening, gene knockout cell lines can be obtained.

Escherichia coli TOP10: purchased from Invitrogen Company and Cat. No. C4040-10.

293T cells: described in "Sh Cao, X-L Liu, M-R Yu, J Li, X-J Jia, Y-H Bi, L Sun, George F.Gao, W-J Liu*.2012.A Nuclear Export Signal in the Matrix Protein of Influenza A Virus Is Required for the Efficient Virus Replication. Journal of Virology, 86(9):4883-91." The article is available to the public from the Institute of Microbiology, Chinese Academy of Sciences.

Embodiment 1, the construction of the 293T cell line of knocking out IFN-β gene

1. Determination of the target sequence of the gene to be knocked out and the design of DNA oligo primers

1. Determination of the target sequence of the gene to be knocked out

Taking the HuIFN-β gene sequence (sequence 1, without intron) as the gene to be knocked out, the Editseq software in the DNAStar software was used to analyze the HuIFN-β gene sequence, and on this basis, the appropriate target sequence was manually screened. For the complete sequence of the HuIFN-β gene, the inventors of the present invention finally designed two target sequences, which are respectively No. 216-235 of Sequence 1 in the sequence table (GAGGCTTGAATACTGCCTCA, denoted as target sequence 1) and No. 545-562 of Sequence 1 bit (AGGAGTACAGTCACTGTG, denoted as target sequence 2).

When determining the target sequence, the inventors of the present invention carried out according to the following principles:

(1) Preferentially select the HuIFN-β gene complete sequence (sequence 1) that conforms to 5'-GG-18N-NGG-3' (N stands for A or T or C or G) or 5'-GG-20N-NGG-3 'The sequence shown by "18N" or "20N" in the regular sequence sequence is used as the target sequence. If the above two sequences do not exist in the complete sequence of the gene to be knocked out, the complementary sequence 5'-CCN-18N-CC-3' or 5'-CCN-20N-CC-3' of the above two sequences can also be selected order, use it after its direction is complementary.

(2) Generally, the sequence on the exon that meets the requirements in (1) is selected as the target sequence. Generally, two pairs of target sequences that meet the requirements are established at the same time in the same knockout cell line.

(3) When selecting two pairs of target sequences that meet the requirements, it is best to have a certain distance between them (>200bp).

(4) The selected target sequence is preferably located in a more important functional domain of the translated protein, which can better ensure the knockout effect.

2. Design of DNA oligo primers

According to the target sequence determined in step 1, design two pairs of DNA oligo primers, the specific sequences are as follows:

Two pairs of oligonucleotide primers were synthesized for the preparation of gRNA, the sequences are as follows:

DNA oligo primers for target sequence 1:

HuIFNβ-gRNA-UP1: 5'-ACCGGAGGCTTGAATACTGCCTCA-3' (SEQ ID NO: 2);

HuIFNβ-gRNA-DOWN1: 5'-AAACTGAGGCAGTATTCAAGCCTC-3' (SEQ ID NO: 3).

DNA oligo primers for target sequence 2:

HuIFNβ-gRNA-UP2: 5'-ACCGCACAGTGACTGTACTCCT-3' (SEQ ID NO: 4);

HuIFNβ-gRNA-DOWN2: 5'-AAACAGGAGTACAGTCACTGTG-3' (SEQ ID NO: 5).

2. Construction of recombinant plasmids expressing gRNA

1. Single-stranded oligonucleotides are annealed to obtain double-stranded oligonucleotides

The two DNA oligo single strands (SEQ2 and SEQUENCE3) synthesized against the target sequence 1 were annealed to obtain double-stranded double-stranded oligonucleotide 1.

The two DNA oligo single strands (SEQ ID NO:4 and ID NO:5) synthesized against target sequence 2 were annealed to obtain double-stranded double-stranded oligonucleotide 2.

The annealing reaction system and the annealing reaction conditions are as follows:

Annealing reaction system: HuIFNβ-gRNA-UP1 or HuIFNβ-gRNA-UP2 (concentration 10mM) 20μl; HuIFNβ-gRNA-DOWN1 or HuIFNβ-gRNA-DOWN 2 (concentration 10mM) 20μl; NEB buffer 210μl.

Annealing reaction conditions: After mixing the above system evenly, put the PCR instrument at 97°C for 7 minutes, then shut down the machine, and cool down naturally. After 1 hour, take out the sample for 2% agarose gel electrophoresis detection and cut the gel to recover the annealed product. The recovery kit used It is an oligonucleotide recovery kit (Tiangen Company), and the specific operation steps are carried out strictly according to its instructions.

2. Enzyme digestion and ligation reaction

The pGL-U6-gRNA plasmid was extracted with an endotoxin-free plasmid extraction kit, and then digested with restriction endonuclease BSAI at 37°C for 4 hours. The digested plasmid was subjected to 1% agarose gel electrophoresis to detect the effect of the enzyme digestion, and the gel was recovered. The kit used for the gel recovery was a product of Bomed Company.

Since the annealed product directly contains sticky ends complementary to the pGL-U6-gRNA vector restriction site, it can be directly used for ligation experiments.

The enzyme-cut plasmid recovered from the gel and the annealed product recovered from the gel were ligated. The specific system and conditions are as follows:

Ligation system: 6 μl of the annealed product (double-stranded oligonucleotide 1 or double-stranded oligonucleotide 2) recovered from the gel; 2 μl of the digested pGL-U6-gRNA vector recovered from the gel; 1 μl of ligase; 10× ligase Buffer 1μl.

Ligation conditions: ligate overnight at 16°C in a PCR instrument.

3. Conversion

Add 10 μl of the ligation product to 50 μl of Escherichia coli TOP10 competent cells in an ultra-clean workbench, ice-bath for 30 minutes, then heat shock in a water bath at 42°C for 90 seconds, then ice-bath for 5 minutes, and then add 500 μl of anti-LB liquid medium, 37 After incubation at 200 rpm for 40 min with shaking at °C, coat an ampicillin-resistant LB solid plate and culture overnight in a 37°C incubator. After a single colony appeared, pick 5 moderately sized colonies, extract the plasmid, and send it to Biomed for sequencing.

Inserted at the restriction site BSAI of the pGL-U6-gRNA plasmid through sequencing

The recombinant plasmid of the DNA fragment shown in "5'-GAGGCTTGAATACTGCCTCA-3'" was named

pGL-U6-gRNA-IFNβ1; will be inserted at the restriction site BSAI of the pGL-U6-gRNA plasmid by sequencing

The recombinant plasmid of the DNA fragment indicated by "5'-CACAGTGACTGTACTCCT-3'" is named

pGL-U6-gRNA-IFNβ2.

4. Extraction of recombinant plasmids

The clones with correct sequencing were expanded and cultivated, and the recombinant plasmid was extracted with an endotoxin-free plasmid extraction kit (Tiangen Company) and the concentration of the plasmid was measured. The specific operation steps of the recombinant plasmid were strictly followed the instructions.

3. Transfection and screening of monoclonal

Cotransfect 293T cells with the recombinant plasmid pGL-U6-gRNA-IFNβ1 (or pGL-U6-gRNA-IFNβ2) constructed in step 2 and the Cas9 plasmid. The specific steps are as follows:

(1) Divide the 293T cells into 10 cm cell culture dishes and culture them overnight. The medium used is DMEM medium containing 10% (volume fraction) FBS. The next morning, when the cell confluency reaches about 70%, proceed to the next step.

(2) The cells whose confluence reached 70% were transferred to opti-MEM, and transfected 2 hours later. Then dilute the two plasmids and Lip2000 into 250μl of opti-MEM respectively, then add the diluted Lip2000 into the diluted mixed plasmid, mix gently, let it stand for 20min, then gently drop it and change to opti-MEM in advance The cells in the MEM medium were placed in a cell culture incubator at 37° C. for culturing, and after 4-6 hours, the cells were replaced with DMEM medium containing 10% (volume fraction) FBS to continue culturing. The concentration of the two plasmids to be transfected is 12μg/10cm dish, and the ratio of plasmid to Lip is 1:2.5, that is, if 24μg of mixed plasmid is added, the amount of Lip2000 to be used is 60μl.

(3) 24 hours after the addition of the plasmid, the cells were replaced with 10% (volume fraction) FBS DMEM medium containing 3 μg puromycin and 3 μg blasticidin, and cultured for 3-5 days, 24 hours each Replace with fresh resistant medium.

(4) After 3-5 days when monoclonals appear, change to the medium with half the resistance for 2-3 days, and then change to the medium without adding resistance and containing 10% (volume fraction) FBS DMEM for culture .

(5) After the cells formed monoclones, the cells were diluted into a 96-well plate by the limiting dilution method, and after 7 days of culture, the monoclonal wells were picked and passaged to a 24-well plate for expanded culture. After 4-5 days of culture in a 24-well plate, trypsinization was passed to a 12-well plate, and each single clone was passed to 2 wells, one well was used to expand the culture to a 6-well plate to facilitate subsequent PCR detection, and one well was used for retain.

(6) PCR identified positive clones

The monoclonal expanded to 6-well plate was used to extract the genomic DNA of the cells, and the kit used was produced by Tiangen Company.

The primer sequences used for PCR identification of 293T cells co-transfected with recombinant plasmid pGL-U6-gRNA-IFNβ1 and Cas9 plasmid are as follows:

PCR-KOIFN-β-up1: 5'-TCTAACTGCAACCTTTCGAAGCC-3' (position 5-27 of Sequence 1);

PCR-KOIFN-β-down1: 5'-CCAGGACTGTCTTCAGATGGTTT-3' (reverse complement of positions 423-445 of Sequence 1).

Clones that cannot amplify the target band (position 5-445 of sequence 1) with a size of 441 bp using PCR-KOIFN-β-up1/PCR-KOIFN-β-down1 primer pair are positive.

The primer sequences used for PCR identification of 293T cells co-transfected with recombinant plasmid pGL-U6-gRNA-IFNβ2 and Cas9 plasmid are as follows:

PCR-KOIFN-β-up2: 5'-GCATTGACCATCTATGAGATGCT-3' (position 304-326 of Sequence 1);

PCR-KOIFN-β-down2: 5'-CTTCTAGTGTCCTTTCATATGCAG-3' (reverse complement of positions 731-754 of Sequence 1).

Clones that cannot amplify the target band (position 304-754 of sequence 1) with a size of 451 bp using PCR-KOIFN-β-up2/PCR-KOIFN-β-down2 primer pair are positive.

At the same time, the wild-type 293T cell line genome was used as the template for the control group.

The results showed that the PCR-KOIFN-β-up1/PCR-KOIFN-β-down1 primer pair was used to amplify the control group using the genome of the wild-type 293T cell line as a template to obtain a 441bp target band (the first sequence of sequence 1). 5-445 positions), PCR-KOIFN-β-up2/PCR-KOIFN-β-down2 primer pair was used to amplify the target band with a size of 451bp (positions 304-754 of sequence 1). Positive clones were obtained in 293T cells co-transfected with recombinant plasmid pGL-U6-gRNA-IFNβ1 and Cas9 plasmid, and in 293T cells co-transfected with recombinant plasmid pGL-U6-gRNA-IFNβ2 and Cas9 plasmid. Among them, some PCR-KOIFN-β-up1/PCR-KOIFN-β-down1 primer pairs were used to identify positive clones of 293T cells co-transfected with the recombinant plasmid pGL-U6-gRNA-IFNβ1 and the Cas9 plasmid. The results are shown in Figure 1 , Lane 1 is the control group using the wild-type 293T cell line genome as a template; Lane 2 is the positive clone of the 293T cell line after knocking out part of the HuIFN-β gene (that is, the preserved cell 293T-KO-IFN- β) Amplification results.

(7) Western-blot identification of the expression of IFN-β

① Passage the cell line to be identified and wild-type 293T cells into a 24-well plate, culture overnight, the medium used is DMEM medium containing 10% (volume fraction) FBS, and the next morning the cell confluence reaches 70% When left and right, proceed to the next step.

②Using the PR8 strain of influenza A virus (A/H1N1/PR8) (recorded in "Zhong Juying, Cui Xiaolan, Shi Yujing et al. Experimental study on the prevention and treatment of pneumonia in mice infected with influenza A H1N1 influenza virus PR8 strain by Jinchai Antiviral Capsules . World Journal of Integrated Traditional Chinese and Western Medicine, 2010, Volume 5, Issue 4" article) infected the cell line to be detected, the infection dose was MOI=0.1, and samples were taken before infection and 12 hours after infection. Add pre-cooled Lysis buffer (recipe: 1% volume fraction of Triton X100, 150mM NaCl, 20mM Hepes, 10% volume fraction of glycerol, 1mM EDTA, pH7.4) to the cell pellet, 100 μl per well, and use After scraping the cells, put them into a 1.5ml EP tube, discard the cell pellet after centrifugation, and use the supernatant for later use.

③The prepared samples were analyzed by Western-blot. The specific operation steps are:

A. Carry out SDS-PAGE according to the method described in "Molecular Cloning". Use pre-stained protein molecular weight markers. After the electrophoresis, the gel was placed in the electrotransfer buffer to equilibrate for 2 minutes and then transferred to the membrane.

B. Cut six pieces of 3mm thick filter paper according to the size of the gel and soak them in the transfer buffer. Cut a piece of PVDF membrane slightly larger than the filter paper, soak it in methanol for more than 5 minutes, and use it after the electrotransfer solution is equilibrated for 10 minutes. Place 3 layers of thick filter paper, transfer membrane, gel, and 3 layers of filter paper in sequence in the semi-dry transfer membrane apparatus, pay attention to drive away the air bubbles between the layers. 15V electricity for 20min.

C. Do not let the transferred transfer membrane dry out, and quickly place it in an appropriate amount of blocking solution to seal after the transfer is completed. Shake gently at room temperature for 1 h.

D. Put the transfer membrane into the hybridization bag, and add mouse anti-HuIFNβ primary antibody (product of Santa Cruz Company, catalog number: sc-17565, diluted 1:1000) appropriately diluted with blocking solution according to the amount of 0.1ml/cm ² , remove all air bubbles, and seal. Place on a decolorizing shaker at room temperature and incubate with gentle shaking for about 2 hours (or shake overnight at 4°C) to fully bind the antibodies. After removing the membrane, put it into TBST solution, wash the membrane 3 times, 7min each time.

E. Put the membrane into the hybridization bag, and add the corresponding goat anti-mouse IgG secondary antibody (product of Santa Cruz Company, catalog number: sc-166261, 1:5000) labeled with horseradish peroxidase (HRP) prepared in blocking solution dilution). Remove air bubbles and seal, shake at room temperature for 2h.

F. Take out the transfer membrane and wash it three times with TBST for 10 minutes each time.

G. Take luminescence solution (Tiangen company product) A solution, B solution 0.5ml each in equal volume and mix evenly. Lightly touch the transfer membrane to the filter paper to absorb the liquid, and put the protein side up on the plastic wrap. Add the ECL mixture dropwise onto the transfer membrane and react for 3 minutes. Immediately wrap the PVDF membrane with plastic wrap, pay attention to the smooth surface, and put it into the CLINX chemical gel imager for imaging.

The results are shown in Figure 2. Swimming lane 1 is the result of 0h before infection of the 293T cell line after knocking out part of the HuIFN-β gene (no target band), and lane 2 is the result of 293T cells after knocking out part of the HuIFN-β gene The result of 12h after infection (no object band), swimming lane 3 is the result of 0h before the infection of the wild-type 293T cell line (no object band), and swimming lane 4 is the result of 12h after the infection of the wild-type 293T cell line (obtained The target band is about 21KD in size, which is consistent with the expected size). It can be seen from the results that the 293T cell line after knocking out part of the HuIFN-β gene (that is, the preserved cell 293T-KO-IFN-β finally obtained in the present invention) still cannot detect the expression of HuIFN-β protein 12 hours after virus stimulation , indicating that the cell line was successfully knocked out.

The inventors of the present invention made one of the clones (293T cells co-transfected with recombinant plasmid pGL-U6-gRNA-IFNβ1 and Cas9 plasmid) positive through the above PCR identification and Western-blot identification on December 1, 2014. Preserved in the General Microbiology Center of China Committee for the Collection of Microbial Cultures (CGMCC for short, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), the reference biological material: 293T-KO-IFN-β, scientific description: human Embryonic kidney cells, registration number of the collection center: CGMCC No.10096.

Claims (7)

1. A method for constructing a 293T cell line that knocks out the IFN-β gene based on CRISPR-Cas9, characterized in that: the method conforms to 5'-GG-18N in the IFN-β gene sequence shown in sequence 1 in the sequence listing -NGG-3' or 5'-GG-20N-NGG-3' or 5'-CCN-18N-CC-3' or 5'-CCN-20N-CC-3' in the sequence of the sequence arrangement rules "18N " or "20N" as the target sequence; N is A or T or C or G. 2 . The method according to claim 1 , wherein the target sequence is the 216-235th or 545-562th position of the IFN-β gene sequence shown in Sequence 1 in the sequence listing. 3. The method according to claim 2, characterized in that: the method is as follows (A) or (B): (A) includes the following steps (a1)-(a4): (a1) Synthesize two single-stranded DNAs named forward single-stranded DNA1 and reverse single-stranded DNA1; the sequence of the forward single-stranded DNA1 is shown in sequence 2 in the sequence table; the reverse single-stranded The sequence of DNA1 is shown as sequence 3 in the sequence listing; (a2) annealing the forward single-stranded DNA1 and the reverse single-stranded DNA1 to obtain double-stranded DNA1; (a3) connecting the double-stranded DNA1 to the cleavage site of the restriction endonuclease BsaI of the pGL-U6-gRNA plasmid, and the resulting recombinant plasmid is denoted as pGL-U6-gRNA-IFNβ-1; (a4) co-transfecting 293T cells with the pGL-U6-gRNA-IFNβ-1 and Cas9 plasmids, and obtaining a 293T cell line in which the IFN-β gene has been knocked out from the transfected 293T cells; (B) includes the following steps (b1)-(b4): (b1) Synthesizing two single-stranded DNAs named forward single-stranded DNA2 and reversed single-stranded DNA2; the sequence of the forward single-stranded DNA2 is shown in sequence 4 in the sequence table; the reversed single-stranded The sequence of DNA2 is shown as sequence 5 in the sequence listing; (b2) annealing the forward single-stranded DNA2 and the reverse single-stranded DNA2 to obtain double-stranded DNA2; (b3) connecting the double-stranded DNA 2 to the cleavage site of the restriction endonuclease BsaI of the pGL-U6-gRNA plasmid, and the resulting recombinant plasmid is denoted as pGL-U6-gRNA-IFNβ-2; (b4) Co-transfect 293T cells with the pGL-U6-gRNA-IFNβ-2 and Cas9 plasmids, and obtain a 293T cell line in which the IFN-β gene has been knocked out from the transfected 293T cells. 4. The method according to claim 3, characterized in that: in step (a2) and step (b2), the conditions of the annealing reaction are: 97 ° C for 7 minutes, natural cooling for 1 hour; or In step (a4), when described pGL-U6-gRNA-IFNβ-1 and Cas9 plasmid co-transfect 293T cells, the mass ratio of described pGL-U6-gRNA-IFNβ-1 and described Cas9 plasmid is 1: 1; or In step (b4), when described pGL-U6-gRNA-IFNβ-2 and Cas9 plasmid co-transfect 293T cells, the mass ratio of described pGL-U6-gRNA-IFNβ-2 and described Cas9 plasmid is 1: 1. 5. A complete set of plasmids, consisting of pGL-U6-gRNA-IFNβ-1 and the Cas9 plasmid described in claim 4, or by pGL-U6-gRNA-IFNβ-2 and the Cas9 plasmid described in claim 4 composition. 6. The use of the set of plasmids according to claim 5, characterized in that: the use is to knock out the IFN-β gene in 293T cells based on CRISPR-Cas9. 7. A kit for constructing a 293T cell line that knocks out the IFN-β gene based on CRISPR-Cas9, containing the complete set of plasmids and instructions according to claim 5; the instructions described in any one of claims 1-4 method.