CN104556399A - Method for purifying heavy metal ions - Google Patents

Method for purifying heavy metal ions Download PDF

Info

Publication number
CN104556399A
CN104556399A CN201410641010.3A CN201410641010A CN104556399A CN 104556399 A CN104556399 A CN 104556399A CN 201410641010 A CN201410641010 A CN 201410641010A CN 104556399 A CN104556399 A CN 104556399A
Authority
CN
China
Prior art keywords
heavy metal
metal ion
purification
penicillium
days
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410641010.3A
Other languages
Chinese (zh)
Other versions
CN104556399B (en
Inventor
周庆新
陈相艳
陈蕾蕾
裘纪莹
刘孝永
王军华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Crop Institute, Hunan Academy of Agricultural Sciences
Original Assignee
Institute of Agro Food Science and Technology of Shandong Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Agro Food Science and Technology of Shandong Academy of Agricultural Sciences filed Critical Institute of Agro Food Science and Technology of Shandong Academy of Agricultural Sciences
Priority to CN201410641010.3A priority Critical patent/CN104556399B/en
Publication of CN104556399A publication Critical patent/CN104556399A/en
Application granted granted Critical
Publication of CN104556399B publication Critical patent/CN104556399B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F3/00—Biological treatment of water, waste water, or sewage
    • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
    • B09C—RECLAMATION OF CONTAMINATED SOIL
    • B09C1/00—Reclamation of contaminated soil
    • B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2101/00—Nature of the contaminant
    • C02F2101/10—Inorganic compounds
    • C02F2101/20—Heavy metals or heavy metal compounds

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Environmental & Geological Engineering (AREA)
  • Mycology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Health & Medical Sciences (AREA)
  • Soil Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Hydrology & Water Resources (AREA)
  • Water Supply & Treatment (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a method for purifying heavy metal ions. A corresponding microbial remediation agent is prepared from analogous penicillium janthinellum HG2014; the content of heavy metals in the environments such as soil and a water body is reduced through the adsorption action of the bacterium on the heavy metal ion (Hg<2+>), so that the environment is protected, and the method has development and application prospects.

Description

A kind of method of purification of heavy metal ion
Technical field
The present invention relates to the applied technical field of microorganism fungus kind, particularly relate to a kind of method of purification of heavy metal ion.
Background technology
Current agricultural environment worsens with agricultural product very serious by heavy metal pollution phenomenon, particularly in some developed areas.According to incompletely statistics, the contaminated area 2,667 ten thousand in the arable land of China hm 2, wherein, industry/three-waste pollution 1,000 ten thousand hm 2, residues of pesticides fertilising pollution 1,000 ten thousand hm 2.Be subject to nearly 2,000 ten thousand hm in arable land of the heavy metal pollutions such as cadmium, arsenic, lead, chromium, mercury 2, account for 1/5 of total area under cultivation, wherein cadmium pollution arable land 1,133 ten thousand hm 2, relate to 11 and economize 25 areas; Mercury-contaminated 3,120,000 hm 2, relate to 15 and economize 21 areas.Heavy metal not only can not bioavailablely be degraded in water body, and some heavy metal also can be converted into the stronger heavy metal compound of toxicity, as methyl mercury under microbial action.Heavy metal ion, after entering the ecosystem, can cause extreme influence to the physiology course of water plant.Especially seriously through the biological magnification of food chain, heavy metal is enrichment in higher organism step by step, causes the bad reaction of biology at different levels in the ecosystem, and even harm comprises health and the existence of the various life entities of human body.Therefore, various countries all give great attention for the pollution of heavy metal, and take the Preventing Countermeasures that heavy metal pollution of water body Sources controlling and engineering control combine.In order to meet the requirement of people to the increasingly stringent of environmental quality, the focus of research has concentrated on emerging biotic environment and has administered field.Many research shows, it is low, easy that biological resuming technology has cost in improvement heavy metal pollution, can not bring the advantages such as new pollution, have comparatively ideal effect, have a good application prospect.The microbiological treatment technology of heavy metal pollution utilizes the effect of microorganism to cut down, purifies heavy metal in soil or water or reduce the toxicity of heavy metal.Some heavy metal ion accumulate for a long time in the environment, some microorganisms in environment are made to define the ability of stronger resistance to heavy metal pollution, these microorganisms are as the special colony's long-term existence in the environment of a class, and they define certain resistance to toxic metals.For microorganism, be a kind of detoxication, and be a kind of well repair for environment, thus make the metals such as mercury, lead, tin, arsenic or metalloid ion to reduce under the effect of microorganism or to lose toxicity.
Summary of the invention
Object of the present invention is exactly a kind of method providing purification of heavy metal ion for above-mentioned Problems existing.Utilize class microassembly robot penicillium subjanthinellumhG2014 makes corresponding microorganism remediation preparation, by this bacterium Adsorption of Heavy Metal Ions (Hg 2+) effect, reduce the content of heavy metal in the environment such as soil, water body, and then protection of the environment, have development prospect.
The method of a kind of purification of heavy metal ion of the present invention, uses class microassembly robot penicillium subjanthinellumhG2014 process contains water or the soil of heavy metal ion.
A kind penicillium janthinellum of the present invention is in the center preservation of China Committee for Culture Collection of Microorganisms's common micro-organisms, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, postcode: 100101, its deposit number is: CGMCC NO.9730, and the Latin title of bacterial classification is penicillium subjanthinellum, the microorganism (strain) of ginseng certificate: HG2014, preservation date is on October 10th, 2014.
22-35 DEG C, pH are under 5-9 condition, class microassembly robot penicillium subjanthinellumhG2014 expansion is cultivated and is inoculated in pending heavy metal ion sewage or soil and processes at least 5 days.
Preferably, 25 DEG C, pH is under 7 conditions, by such microassembly robot bacteria strain on CYA, MEA, YES, PDA or DG18 solid medium after activation culture, expands and cultivate and to be inoculated in pending heavy metal ion sewage process 6 days in PDB fluid nutrient medium.
Get such microassembly robot bacteria strain, be transferred in the PDA culture dish containing heavy metal, cultivate 5-7 days, under aseptic condition, beat with 5 mm card punch and get bacterium cake, get 5 ferfas cakes to join containing heavy metal Hg concentration to be in the 250mL conical flask of PDB fluid nutrient medium 100 mL of 20mg/L, to be placed in 120 r/min, in the constant-temperature table of 25 DEG C, cultivate 6 days, filter with band filter paper funnel, get filtered fluid and clear up, check weighing metal ion Hg 2+concentration, reaches 98% to the clearance of mercury.
This bacterial strain can at CYA, MEA, YES, PDA cultured on solid medium, and wherein 30 DEG C grow the fastest at CYA, and within 7 days, colony radius reaches 55 – 60 millimeters.Bacterium colony spreads growth radially at CYA culture medium, and white is to canescence, and sporulation quantity is sparse.Perfect stage (ascus and shoestring) lacks.Conidiophore is main two verticillate, occasionally has the branch that extra.Conidiophore is smooth, colourless, and length reaches 100-500 micron, and conidium is spherical or sub-spherical, smooth surface or micro-ly have coarse, and size is 2.5 – 3 microns.
30 DEG C, CYA, YES, PDA, DG18 culture medium is cultivated 7 days colony growths vigorous, but sporulation quantity is sparse.
According to CTAB method from such penicillium janthinellum penicillium subjanthinellumextract genomic DNA in the pure culture of HG2014, utilize rDNA the Internal Transcribed Spacer (ITS) sequence specific primer ITS1/ITS4, obtain ITS sequence by pcr amplification and sequencing analysis, its sequence is as shown in SEQ ID NO.1:
TGTTTATTGTACCTTGTTGCTTCGGCAGGCCCGCCTCACGGCCGCCGGGGGGCTTTCCGCCCCCGGGCCCGCGCCTGCCGGAGACAATCTTGAACGCTGTCTGAAGAATGCAGTCTGAGCGATTAAGCAAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTGTTCCCCCGGGAACAGGCCCGAAAGGCAGTGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCCCCATCAATCTTTTTTTCAGGT。
Utilize 'beta '-tubulin (β-tubulin) sequence specific primer Bt 2a/Bt 2b, obtain β-tubulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQ ID NO.2:
GGGGGCTGATGCACTGTCATCCCACTGCAGCAGATTATCTATTGTTGAGCACAGGACCTTTATACTGACTTGAGTCACAGGCAAAACATTGCTAGCGAGCATGGTCACGATGGCGAGGGCCAGTAAGTATCAATTTGGTTGGAATTGGGTGATATGAGAATGGCGGTCTGATATTTTTCTTAGCTTCACTGGCCAGTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACCACGTAAGTGTGGAAACCGACACTCGATACCTTTCCAACACGTCTAACATAATGGATCTTCATAGGCCAGCGGTGACCGTTACGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCAAGCTTTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCTGGTGCTGGTAACAACTGGGCCAAGGGTCATCCCTAGAGGGTAAAGTAGTCCTATTGGCCGGATGTTAACTTGTTTTCGCATTCATACTCCCCTCGCTATCACAGCCCGAATTCTCTTCATTTGTTCGGTGGAATAAGATCCGACCGTGCACTAGTATAGTGCACTTGTAATCTTTAATCTCCGAGCGTGCACATCACTCAGCACACCCCTCGCTAGGAGCGAATCTATAAATGGAGGACCATTTGTTGCAAAGGAAAGGTAGAGCAGACATGCCATAATGGTATTAAGACTATGCGCTCTGGGTGGTTTGCTCAACTTGGTCCTATGTTCTCAGGCTGAGAACATCACAGCCGATGCTCACCTTATACGCACTATCCCCTCGTGTCTATGCATCGCGTACGAGTCTCTCGTATTGATGATTTTAGACCAATGGATCCTTTTTCTAACCTCATCT
GGCCTACGCGATCTGGCACTGGAAACTGGGAATCCG。
Utilize calmodulin (calmodulin) sequence specific primer cmd5/cmd6, obtain calmodulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQ ID NO.3:
TGTTGCGCTCACGCATCGATTGGAGACCCGTGACCGGATTTAATGCTGATGGATATGTTCTCCGGCGATAGGACAAGGATGGTGATGGTTAGTGCGACCGTCGGCGATTTTTTTTTAATTCCATGCCGACTGGAGTATTCCCAACTGAGAGGACCGAATAACTGAGACCGATCGATCTATAGGACAAATCACCACCAAGGAGTTGGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCCGAGCTCCAGGACATGATTAACGAAGTCGATGCCGACAACAACGGTACCATTGACTTCCCTGGTACGATTTCCC
TCCCACTCGAATTATCCCGTACTCGCCTCCGGATATATGTTAACATGCGACACAGAGTTCCTTACCATGATGGCCCGTAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGTGAGGCATTCAAGGTTTTCGACCGTGACAACAACGGTTTCATTTCCGCCGCTGAGCTGCGCCACGTTATGAGTTTCTATCAGTCGACGGACTTATTTTCGCAGCCGAGCTTGGCCAGGTTGGCCAGCACTTGGGGAGCCCGGCCCGCCCGACCACATCCAGTGATGGTTGGTCAAGGACCCTGCTCACCAAACTGGCGGAAAAAAAC
CGCGGACCAGAAGATGCTGGACGACTACATGAGGCGGAGGACGGCGCCGGAGGACTTGAGGGTGATGACGCTGTTGTCGACGACGGTGACCATCTCACCCCTCTGGGTTTCCACGCGCAGCTTCTGCAACCGGGCAGCCCCCCCTGAGACGAGATTTTTGCCCATTGGGGGGCACCCCGCCGGGCGGCGTTAAACAGAATCACCCGCGCCTTGGTCGAGTCGATGTGCCGGAGTGCGCCCTTCAACGTGTGCTCGGCCAGCTCGGCGATCTGTCGGGCATTTCAACACCGGTGGGGCCAGCCCCGAAAAGGGAAAAGGCAATATTTGGGCTC。
By Blast software in GenBank, ITS sequence, β-tubulin sequence and calmodulin sequence are compared, result display not with its homology higher than the bacterial strain of 99%, therefore infer that this bacterial strain is a novel species.
The representative gene order (ITS+ β-tubulin) that part is higher with measuring sequence similarity is have chosen in GenBank database, by ClustalW software and PAUP software with maximum parsimony method and maximum likelihood method constructing system chadogram (see Figure of description Fig. 2), carry out Phylogenetic Analysis.As can be seen from phylogenetic tree, bacterial strain of the present invention with penicillium janthinellumwith penicillium cremeogriseumshow higher homology, wherein, with penicillium janthinellumhomology the highest, this result also obtain very high supporting rate, reliable results.
Morphological comparison show this kind also with penicillium janthinellumsimilar, but there is significant difference in conidial morphological feature of this kind and the form of penicillium janthinellum, as conidial shape exist difference ( penicillium subjanthinellumspherical or sub-spherical and penicillium janthinellumusual oval and spore base portion is tapering), bacterial strain conidium of the present invention (2.5 – 3 microns) also than penicillium janthinellumlittle (3 – 3.5 microns).Therefore same species can not be thought.Therefore, combining form feature compares and ITS, 'beta '-tubulin Phylogenetic Analysis result, this bacterium is decided to be a novel species of Penicillium penicillium subjanthinellumsp. nov..
At 25 DEG C, pH is in the PDB culture medium of 7,120r/min shaking table training process 6 days, such microassembly robot penicillium subjanthinellumhG2014 is the Hg of 20mg/L to concentration 2+adsorption rate reach 98% (Figure of description Fig. 3).
Beneficial effect of the present invention is: this bacterial strain has easy cultivation on CYA, MEA, YES, PDA solid medium, grows fast feature, at Adsorption of Heavy Metal Ions (Hg 2+) aspect can reach 98%, can not introduce new pollutant simultaneously.This bacterium is utilized to make corresponding microorganism remediation preparation, by this bacterium Adsorption of Heavy Metal Ions (Hg 2+) effect, reduce the content of heavy metal in the environment such as soil, water body, and then protection of the environment, have development prospect.
accompanying drawing illustrates:
Figure 1 shows that conidiophore and conidium feature (10 μm, engineer's scale) under the upgrowth situation of bacterial strain of the present invention on CYA and light microscope;
Figure 2 shows that the phylogenetic tree that strain gene sequence of the present invention (ITS+ β-tubulin) builds;
Figure 3 shows that bacterial strain of the present invention changes heavy metal ion (Hg in time in PDB fluid nutrient medium 2+) adsorption rate.
detailed description of the invention:
In order to understand the present invention better, describe technical scheme of the present invention in detail with instantiation below.
Embodiment 1
The preparation of culture medium:
A certain amount of HgCl is added respectively to the PDA culture medium melted 2mother liquor stirs, and the content of beary metal namely in solid medium is mercury ion (200mg/L).
The solid medium prepared is put into high-pressure sterilizing pot sterilizing 30 min at 121 DEG C.
Solid medium after sterilizing is poured into about l/4-l/3 At The Height in culture dish, and keep flat, cooled and solidified makes flat board.This operation is aseptically carried out.
Embodiment 2
Bacterial strain purifying:
Take 10g(to increase and decrease as one sees fit because of the how much of soil sample water content) throughout the year by the soil sample of mercury heavy metal pollution (chemical industry plant area, Weifang, Shandong Soil Surrounding), add in the triangular flask filling 90 mL aqua sterilisas, triangular flask is placed in 110-130 r/min on shaking table, vibrate 20 minutes, make soil particle be dispersed in distilled water, obtain the Soil Slurry that extension rate is 10; Therefrom drawing 1 mL inserts in the test tube that 9 mL aqua sterilisas are housed, for extension rate is 10 2suspension.The culture medium of sterilizing, when being cooled to about 45 DEG C, adds streptomysin 30 μ g/mL, after pouring culture dish cooling solidification into, is 1 × 10 by the extension rate obtained 2soil Slurry fully shake up, draw 1 mL, in each culture dish, instill 4-6 drip, with the curved glass bar of sterilizing by after its uniform application, this culture dish is inverted in 21 DEG C of-25 DEG C of biochemical cultivation cases and cultivates, after 6d-14d, stereoscopic Microscopic observation.Picking growth is vigorous, the typical single spore of form is cultivated to PDA culture medium.
Bacterial strain is kept in the test tube of PDA medium slant, is joined in right amount in the 2.5 mL cryopreservation tubes containing 2.0 mL sterilized waters by the bacterial classification picking that purifying is cultivated simultaneously.
Embodiment 3
From the pure culture of bacterial strain of the present invention, extract genomic DNA according to CTAB method, utilize rDNA the Internal Transcribed Spacer (ITS) sequence specific primer ITS1/ITS4, obtain ITS sequence by pcr amplification and sequencing analysis, its sequence is as shown in SEQ ID NO.1.Utilize 'beta '-tubulin (β-tubulin) sequence specific primer Bt 2a/Bt 2b, obtain β-tubulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQ ID NO.2.Utilize calmodulin (calmodulin) sequence specific primer cmd5/cmd6, obtain calmodulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQ ID NO.3.By Blast software in GenBank, ITS sequence, β-tubulin sequence and calmodulin sequence are compared, result display not with its homology higher than the bacterial strain of 99%, therefore infer that this bacterial strain is in order to a novel species.
The primer sequence of ITS, 'beta '-tubulin, calmodulin is as follows:
ITS1: 5’-TCCGTAGGTGAACCTGCGG-3’
ITS4: 5’-TCCTCCGCTTATTGATATGC-3’
Bt2a: 5’-GGTAACCAAATCG GTGCTGCTTTC-3’
Bt2b: 5’-ACCCTCAGTGTAGT GACCCTTGGC-3’
Cmd5: 5’-CCGAGTACAAGGCCTTC -3’
Cmd6: 5’-CCGATAGAGGTCATAACGTGG-3’
In conjunction with various cultural characteristic and morphological feature, ITS and the 'beta '-tubulin sequence analysis of this bacterium, this bacterium is decided to be class microassembly robot penicillium subjanthinellum.
Embodiment 4
Bacterial strain heavy metal ion (Hg 2+) absorption:
To go bail for the class microassembly robot of the present invention deposited penicillium subjanthinellumhG2014 bacterial strain, is transferred in the PDA culture dish containing heavy metal, cultivates 5-7 days, under aseptic condition, beat with 5 mm card punch and get bacterium cake, get in the 250mL conical flask that 5 ferfas cakes join containing PDB fluid nutrient medium 100 mL of heavy metal Hg (20mg/L), separately get the same method process of aseptic bacterium cake in contrast, be placed in 120 r/min, in the constant-temperature table of 25 DEG C, cultivate 6 days, filter with band filter paper funnel, mycelia is dried and weighs, and gets filtered fluid and clears up, check weighing metal ion (Hg 2+) concentration.
Described class microassembly robot bacteria strain not only has tolerance when mercury concentration (20mg/L) is higher, can grow fast, there is again significant adsorption capacity simultaneously, in fluid nutrient medium, mercury concentration obviously reduces, specifically ask for an interview Figure of description 3, the clearance of bacterial strain of the present invention to mercury reaches as high as 98%.
Sequence table
SEQUENCE LISTING
<110> Agricultural Products Research Institute, Shandong Academy of Agricultural Sciences
The method of a <120> purification of heavy metal ion
<130> without
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 454
<212> DNA
<213> Penicillium subjanthinellum
<400> 1
tgtttattgt accttgttgc ttcggcaggc ccgcctcacg gccgccgggg ggctttccgc 60
ccccgggccc gcgcctgccg gagacaatct tgaacgctgt ctgaagaatg cagtctgagc 120
gattaagcaa aattagttaa aactttcaac aacggatctc ttggttccgg catcgatgaa 180
gaacgcagcg aaatgcgata attaatgtga attgcagaat tcagtgaatc atcgagtctt 240
tgaacgcaca ttgcgccccc tggtattccg gggggcatgc ctgtccgagc gtcattgctg 300
ccctcaagcc cggcttgtgt gttgggccct gttcccccgg gaacaggccc gaaaggcagt 360
ggcggcaccg cgtccgatcc tcgagcgtat ggggctttgt cacccgctct gtaggcccgg 420
ccggcgcttg cccccatcaa tctttttttc aggt 454
<210> 2
<211> 916
<212> DNA
<213> Penicillium subjanthinellum
<400> 2
gggggctgat gcactgtcat cccactgcag cagattatct attgttgagc acaggacctt 60
tatactgact tgagtcacag gcaaaacatt gctagcgagc atggtcacga tggcgagggc 120
cagtaagtat caatttggtt ggaattgggt gatatgagaa tggcggtctg atatttttct 180
tagcttcact ggccagtccg acctccagct cgagcgcatg aacgtctact tcaaccacgt 240
aagtgtggaa accgacactc gatacctttc caacacgtct aacataatgg atcttcatag 300
gccagcggtg accgttacgt tccccgtgcc gtcctggtcg acttggagcc cggtaccatg 360
gacgctgtcc gtgccggtcc tttcggcaag cttttccgtc ccgacaactt cgtcttcggt 420
cagtctggtg ctggtaacaa ctgggccaag ggtcatccct agagggtaaa gtagtcctat 480
tggccggatg ttaacttgtt ttcgcattca tactcccctc gctatcacag cccgaattct 540
cttcatttgt tcggtggaat aagatccgac cgtgcactag tatagtgcac ttgtaatctt 600
taatctccga gcgtgcacat cactcagcac acccctcgct aggagcgaat ctataaatgg 660
aggaccattt gttgcaaagg aaaggtagag cagacatgcc ataatggtat taagactatg 720
cgctctgggt ggtttgctca acttggtcct atgttctcag gctgagaaca tcacagccga 780
tgctcacctt atacgcacta tcccctcgtg tctatgcatc gcgtacgagt ctctcgtatt 840
gatgatttta gaccaatgga tcctttttct aacctcatct ggcctacgcg atctggcact 900
ggaaactggg aatccg 916
<210> 3
<211> 972
<212> DNA
<213> Penicillium subjanthinellum
<400> 3
tgttgcgctc acgcatcgat tggagacccg tgaccggatt taatgctgat ggatatgttc 60
tccggcgata ggacaaggat ggtgatggtt agtgcgaccg tcggcgattt ttttttaatt 120
ccatgccgac tggagtattc ccaactgaga ggaccgaata actgagaccg atcgatctat 180
aggacaaatc accaccaagg agttgggcac tgtcatgcgc tccctcggcc agaacccctc 240
cgagtccgag ctccaggaca tgattaacga agtcgatgcc gacaacaacg gtaccattga 300
cttccctggt acgatttccc tcccactcga attatcccgt actcgcctcc ggatatatgt 360
taacatgcga cacagagttc cttaccatga tggcccgtaa gatgaaggac accgactccg 420
aggaggagat ccgtgaggca ttcaaggttt tcgaccgtga caacaacggt ttcatttccg 480
ccgctgagct gcgccacgtt atgagtttct atcagtcgac ggacttattt tcgcagccga 540
gcttggccag gttggccagc acttggggag cccggcccgc ccgaccacat ccagtgatgg 600
ttggtcaagg accctgctca ccaaactggc ggaaaaaaac cgcggaccag aagatgctgg 660
acgactacat gaggcggagg acggcgccgg aggacttgag ggtgatgacg ctgttgtcga 720
cgacggtgac catctcaccc ctctgggttt ccacgcgcag cttctgcaac cgggcagccc 780
cccctgagac gagatttttg cccattgggg ggcaccccgc cgggcggcgt taaacagaat 840
cacccgcgcc ttggtcgagt cgatgtgccg gagtgcgccc ttcaacgtgt gctcggccag 900
ctcggcgatc tgtcgggcat ttcaacaccg gtggggccag ccccgaaaag ggaaaaggca 960
atatttgggc tc 972
<210> 4
<211> 19
<212> DNA
<213> synthesizes
<400> 4
tccgtaggtg aacctgcgg 19
<210> 5
<211> 20
<212> DNA
<213> synthesizes
<400> 5
tcctccgctt attgatatgc 20
<210> 6
<211> 24
<212> DNA
<213> synthesizes
<400> 6
ggtaaccaaa tcggtgctgc tttc 24
<210> 7
<211> 24
<212> DNA
<213> synthesizes
<400> 7
accctcagtg tagtgaccct tggc 24
<210> 8
<211> 17
<212> DNA
<213> synthesizes
<400> 8
ccgagtacaa ggccttc 17
<210> 9
<211> 21
<212> DNA
<213> synthesizes
<400> 9
ccgatagagg tcataacgtg g 21

Claims (9)

1. a method for purification of heavy metal ion, is characterized in that, uses class microassembly robot penicillium subjanthinellumhG2014 process contains water or the soil of heavy metal ion.
2. the method for a kind of purification of heavy metal ion according to claim 1, is characterized in that, described class penicillium janthinellum penicillium subjanthinellumhG2014, it is in the center preservation of China Committee for Culture Collection of Microorganisms's common micro-organisms, and its deposit number is CGMCC NO.9730, and preservation date is on October 10th, 2014.
3. the method for a kind of purification of heavy metal ion according to claim 1, is characterized in that, 22-35 DEG C, pH are under 5-9 condition, class microassembly robot penicillium subjanthinellumhG2014 expansion is cultivated and is inoculated in pending heavy metal ion sewage or soil and processes at least 5 days.
4. the method for a kind of purification of heavy metal ion according to claim 3, it is characterized in that, 25 DEG C, pH is under 7 conditions, by such microassembly robot bacteria strain at CYA, MEA, YES, on PDA or DG18 solid medium after activation culture, in PDB fluid nutrient medium, expansion is cultivated and is inoculated in pending heavy metal ion sewage and processes 6 days.
5. the method for a kind of purification of heavy metal ion according to claim 1, it is characterized in that, get such microassembly robot bacteria strain, be transferred in the PDA culture dish containing heavy metal, cultivate 5-7 days, under aseptic condition, beat with 5 mm card punch and get bacterium cake, get 5 ferfas cakes and join containing heavy metal Hg concentration to be in the 250mL conical flask of PDB fluid nutrient medium 100 mL of 20mg/L, to be placed in 120 r/min, in the constant-temperature table of 25 DEG C, cultivate 6 days, filter with band filter paper funnel, get filtered fluid and clear up, check weighing concentration of metal ions, reaches 98% to the clearance of mercury.
6. the method for a kind of purification of heavy metal ion according to claim 1, is characterized in that, such microassembly robot bacteria strain is at CYA, MEA, YES, PDA or DG18 cultured on solid medium, wherein 30 DEG C grow the fastest at CYA, and within 7 days, colony radius reaches 55 – 60 millimeters.
7. the method for a kind of purification of heavy metal ion according to claim 1, is characterized in that, such microassembly robot bacteria strain bacterium colony spreads growth radially at CYA culture medium, white to canescence, sporulation quantity is sparse, the perfect stage ascus and shoestring disappearance.
8. the method for a kind of purification of heavy metal ion according to claim 1, it is characterized in that, such microassembly robot bacteria strain conidiophore is main two verticillate, occasionally have the branch that extra, conidiophore is smooth, colourless, length reaches 100-500 micron, conidium is spherical or sub-spherical, smooth surface or micro-ly have coarse, and size is 2.5 – 3 microns.
9. the method for a kind of purification of heavy metal ion according to claim 1, is characterized in that, such microassembly robot penicillium subjanthinellumhG2014 is the Hg of 20mg/L to concentration 2+adsorption rate reach 98%.
CN201410641010.3A 2014-11-14 2014-11-14 A kind of method of purification of heavy metal ion Expired - Fee Related CN104556399B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410641010.3A CN104556399B (en) 2014-11-14 2014-11-14 A kind of method of purification of heavy metal ion

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410641010.3A CN104556399B (en) 2014-11-14 2014-11-14 A kind of method of purification of heavy metal ion

Publications (2)

Publication Number Publication Date
CN104556399A true CN104556399A (en) 2015-04-29
CN104556399B CN104556399B (en) 2016-06-08

Family

ID=53073601

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410641010.3A Expired - Fee Related CN104556399B (en) 2014-11-14 2014-11-14 A kind of method of purification of heavy metal ion

Country Status (1)

Country Link
CN (1) CN104556399B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105750326A (en) * 2016-04-21 2016-07-13 绍兴文理学院 Method for remedying cadmium-polluted soil
CN109909294A (en) * 2019-04-18 2019-06-21 山东省食品药品检验研究院 A kind of repairing method of microorganism of heavy-metal contaminated soil

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008263972A (en) * 2007-03-29 2008-11-06 Kitakyushu Foundation For The Advancement Of Industry Science & Technology Mixed culture method of fungi and bacteria
CN102191181A (en) * 2010-03-11 2011-09-21 中国农业科学院农业环境与可持续发展研究所 Screening method of penicillium janthinellum and application thereof
CN103910437A (en) * 2014-04-18 2014-07-09 湖南大学 Method for removing heavy metal ions out of water

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008263972A (en) * 2007-03-29 2008-11-06 Kitakyushu Foundation For The Advancement Of Industry Science & Technology Mixed culture method of fungi and bacteria
CN102191181A (en) * 2010-03-11 2011-09-21 中国农业科学院农业环境与可持续发展研究所 Screening method of penicillium janthinellum and application thereof
CN103910437A (en) * 2014-04-18 2014-07-09 湖南大学 Method for removing heavy metal ions out of water

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105750326A (en) * 2016-04-21 2016-07-13 绍兴文理学院 Method for remedying cadmium-polluted soil
CN109909294A (en) * 2019-04-18 2019-06-21 山东省食品药品检验研究院 A kind of repairing method of microorganism of heavy-metal contaminated soil

Also Published As

Publication number Publication date
CN104556399B (en) 2016-06-08

Similar Documents

Publication Publication Date Title
CN104450552B (en) A kind of sulfate reducing bacteria phosphate solubilizing bacteria and its application in combined repair of cadmium polluted soil
CN111235076B (en) Bacillus anethoides, microbial inoculum thereof and application thereof in heavy metal remediation field
CN107090413B (en) Glyphosate degradation bacterium and its processing heavy metal-glyphosate combined pollution in apply
CN112094760B (en) Plant endophytic fungus Echinospora terrestris D2G24 and application thereof
CN110551654B (en) Bacillus aryabhattai, metabolite thereof and application thereof
CN104531537B (en) A kind of aspergillus flavus strain and its application
CN105255782A (en) Cellulosimicrobium cellulans with reducing capacity on hexavalent chromium and application
CN114107092B (en) Endophyte Gordonia L191 for degrading phthalate and application thereof
CN109369226A (en) A kind of bio-bacterial manure and application of fortification of plants cadmium pollution soil repair
CN110129208A (en) One plant of phosphorus decomposing penicillium oxalicum with wide spectrum characteristic of lactic acid production
CN106916765B (en) A method of heavy metal in waste water zinc is adsorbed using penicillium janthinellum
CN103923659A (en) Method of intensifying festuca arundinacea to repair heavy metals in soil in sewage irrigation area by NTA (Nitrilotriacetic Acid) and microbial agent
CN106244500B (en) One plant of anti-antimony bacterium NXH2 and its application
CN104498403B (en) The general bacterium and its application of a kind of degrading organic phosphor and Phos
CN104805036A (en) Applications of Microbacterium sp. J-1 in degradation of plurality of phthalic acid esters
CN109439569A (en) Heterotrophic nitrification-biological aerobic denitrification comamonas, the liquid bacterial agent containing the bacterium and its application in membrane bioreactor
CN104805033A (en) Microbacterium sp. J-1 used for degrading plurality of phthalic acid esters
CN103937731A (en) Separation, extraction and verification method of air-dried sludge beneficial microorganism components
CN113862199B (en) Degrading strain of benzonitrile herbicide and microbial inoculum produced by degrading strain
CN104556399B (en) A kind of method of purification of heavy metal ion
CN107502568B (en) Bacillus pumilus and application thereof in cadmium pollution remediation
CN109516869A (en) Complex function microorganism formulation and its preparation method and application
CN106244501B (en) One plant of anti-antimony bacterium NXH1 and its application
CN106434446B (en) One plant of anti-antimony bacterium NXH3 and its application
CN115433694B (en) Application of radiation-resistant methyl bacillus L321 in degradation of phthalate and growth promotion

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
ASS Succession or assignment of patent right

Owner name: CROP INSTITUTE, HUNAN ACADEMY OF AGRICULTURAL SCIE

Effective date: 20150427

C41 Transfer of patent application or patent right or utility model
C53 Correction of patent of invention or patent application
CB03 Change of inventor or designer information

Inventor after: Zhou Qingxin

Inventor after: Chen Xiangyan

Inventor after: Chen Leilei

Inventor after: Ding Zili

Inventor after: Wang Yifen

Inventor after: Qiu Jiying

Inventor after: Liu Xiaoyong

Inventor after: Wang Junhua

Inventor before: Zhou Qingxin

Inventor before: Chen Xiangyan

Inventor before: Chen Leilei

Inventor before: Qiu Jiying

Inventor before: Liu Xiaoyong

Inventor before: Wang Junhua

COR Change of bibliographic data

Free format text: CORRECT: INVENTOR; FROM: ZHOU QINGXIN CHEN XIANGYAN CHEN LEILEI QIU JIYING LIU XIAOYONG WANG JUNHUA TO: ZHOU QINGXIN CHEN XIANGYAN CHEN LEILEI DING ZILI WANG YIFEN QIU JIYING LIU XIAOYONG WANG JUNHUA

TA01 Transfer of patent application right

Effective date of registration: 20150427

Address after: Industrial Road Licheng District, Ji'nan city of Shandong Province, No. 202 250100

Applicant after: Agricultural Products Research Institute, Shandong Academy of Agricultural Sciences

Applicant after: Crop Institute, Hunan Academy of Agricultural Sciences

Address before: Industrial Road Licheng District, Ji'nan city of Shandong Province, No. 202 250100

Applicant before: Agricultural Products Research Institute, Shandong Academy of Agricultural Sciences

C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20160608

Termination date: 20201114