CN104556399B - A kind of method of purification of heavy metal ion - Google Patents
A kind of method of purification of heavy metal ion Download PDFInfo
- Publication number
- CN104556399B CN104556399B CN201410641010.3A CN201410641010A CN104556399B CN 104556399 B CN104556399 B CN 104556399B CN 201410641010 A CN201410641010 A CN 201410641010A CN 104556399 B CN104556399 B CN 104556399B
- Authority
- CN
- China
- Prior art keywords
- heavy metal
- metal ion
- purification
- microassembly robot
- days
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 229910001385 heavy metal Inorganic materials 0.000 title claims abstract description 55
- 238000000034 method Methods 0.000 title claims abstract description 27
- 238000000746 purification Methods 0.000 title claims abstract description 14
- 241000894006 Bacteria Species 0.000 claims abstract description 25
- 239000002689 soil Substances 0.000 claims abstract description 14
- 244000005700 microbiome Species 0.000 claims abstract description 13
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims abstract description 11
- 238000001179 sorption measurement Methods 0.000 claims abstract description 7
- 239000007788 liquid Substances 0.000 claims description 10
- QSHDDOUJBYECFT-UHFFFAOYSA-N mercury Chemical compound [Hg] QSHDDOUJBYECFT-UHFFFAOYSA-N 0.000 claims description 8
- 229910052753 mercury Inorganic materials 0.000 claims description 8
- 230000008569 process Effects 0.000 claims description 8
- 239000007787 solid Substances 0.000 claims description 8
- 235000015097 nutrients Nutrition 0.000 claims description 7
- 230000012010 growth Effects 0.000 claims description 6
- 238000012258 culturing Methods 0.000 claims description 4
- 238000004321 preservation Methods 0.000 claims description 4
- 239000010865 sewage Substances 0.000 claims description 4
- 230000028070 sporulation Effects 0.000 claims description 3
- 241000293001 Oxytropis besseyi Species 0.000 claims description 2
- 230000004913 activation Effects 0.000 claims description 2
- 230000008034 disappearance Effects 0.000 claims 1
- 150000002500 ions Chemical class 0.000 abstract description 19
- BQPIGGFYSBELGY-UHFFFAOYSA-N mercury(2+) Chemical compound [Hg+2] BQPIGGFYSBELGY-UHFFFAOYSA-N 0.000 abstract description 8
- 230000000694 effects Effects 0.000 abstract description 7
- 238000002360 preparation method Methods 0.000 abstract description 4
- 238000011161 development Methods 0.000 abstract description 3
- 238000005067 remediation Methods 0.000 abstract description 3
- 241000228143 Penicillium Species 0.000 abstract description 2
- 230000001580 bacterial effect Effects 0.000 description 18
- 108020004414 DNA Proteins 0.000 description 11
- 102000000584 Calmodulin Human genes 0.000 description 9
- 108010041952 Calmodulin Proteins 0.000 description 9
- 238000012408 PCR amplification Methods 0.000 description 6
- 238000011109 contamination Methods 0.000 description 6
- 108091023242 Internal transcribed spacer Proteins 0.000 description 5
- 241000228129 Penicillium janthinellum Species 0.000 description 5
- 230000001954 sterilising effect Effects 0.000 description 5
- 241000196324 Embryophyta Species 0.000 description 3
- 230000000877 morphologic effect Effects 0.000 description 3
- 239000000725 suspension Substances 0.000 description 3
- 230000001988 toxicity Effects 0.000 description 3
- 231100000419 toxicity Toxicity 0.000 description 3
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 229910052785 arsenic Inorganic materials 0.000 description 2
- RQNWIZPPADIBDY-UHFFFAOYSA-N arsenic atom Chemical compound [As] RQNWIZPPADIBDY-UHFFFAOYSA-N 0.000 description 2
- 229910052793 cadmium Inorganic materials 0.000 description 2
- BDOSMKKIYDKNTQ-UHFFFAOYSA-N cadmium atom Chemical compound [Cd] BDOSMKKIYDKNTQ-UHFFFAOYSA-N 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 229910052751 metal Inorganic materials 0.000 description 2
- 239000002184 metal Substances 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 241000208340 Araliaceae Species 0.000 description 1
- VYZAMTAEIAYCRO-UHFFFAOYSA-N Chromium Chemical compound [Cr] VYZAMTAEIAYCRO-UHFFFAOYSA-N 0.000 description 1
- 238000007476 Maximum Likelihood Methods 0.000 description 1
- JJWSNOOGIUMOEE-UHFFFAOYSA-N Monomethylmercury Chemical compound [Hg]C JJWSNOOGIUMOEE-UHFFFAOYSA-N 0.000 description 1
- 235000005035 Panax pseudoginseng ssp. pseudoginseng Nutrition 0.000 description 1
- 235000003140 Panax quinquefolius Nutrition 0.000 description 1
- 241000504304 Penicillium cremeogriseum Species 0.000 description 1
- ATJFFYVFTNAWJD-UHFFFAOYSA-N Tin Chemical compound [Sn] ATJFFYVFTNAWJD-UHFFFAOYSA-N 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 230000000274 adsorptive effect Effects 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- RCTYPNKXASFOBE-UHFFFAOYSA-M chloromercury Chemical compound [Hg]Cl RCTYPNKXASFOBE-UHFFFAOYSA-M 0.000 description 1
- 229910052804 chromium Inorganic materials 0.000 description 1
- 239000011651 chromium Substances 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 238000005138 cryopreservation Methods 0.000 description 1
- 238000001784 detoxification Methods 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000009246 food effect Effects 0.000 description 1
- 235000008434 ginseng Nutrition 0.000 description 1
- 239000011521 glass Substances 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 150000002736 metal compounds Chemical class 0.000 description 1
- 229910052752 metalloid Inorganic materials 0.000 description 1
- -1 metalloid ion Chemical class 0.000 description 1
- 150000002739 metals Chemical class 0.000 description 1
- 230000000813 microbial effect Effects 0.000 description 1
- 230000007483 microbial process Effects 0.000 description 1
- 230000002906 microbiologic effect Effects 0.000 description 1
- 239000012452 mother liquor Substances 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 239000000447 pesticide residue Substances 0.000 description 1
- 238000013081 phylogenetic analysis Methods 0.000 description 1
- 230000035790 physiological processes and functions Effects 0.000 description 1
- 230000008439 repair process Effects 0.000 description 1
- 238000012882 sequential analysis Methods 0.000 description 1
- 238000007711 solidification Methods 0.000 description 1
- 230000008023 solidification Effects 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000003756 stirring Methods 0.000 description 1
- QTENRWWVYAAPBI-YCRXJPFRSA-N streptomycin sulfate Chemical compound OS(O)(=O)=O.OS(O)(=O)=O.OS(O)(=O)=O.CN[C@H]1[C@H](O)[C@@H](O)[C@H](CO)O[C@H]1O[C@@H]1[C@](C=O)(O)[C@H](C)O[C@H]1O[C@@H]1[C@@H](N=C(N)N)[C@H](O)[C@@H](N=C(N)N)[C@H](O)[C@H]1O.CN[C@H]1[C@H](O)[C@@H](O)[C@H](CO)O[C@H]1O[C@@H]1[C@](C=O)(O)[C@H](C)O[C@H]1O[C@@H]1[C@@H](N=C(N)N)[C@H](O)[C@@H](N=C(N)N)[C@H](O)[C@H]1O QTENRWWVYAAPBI-YCRXJPFRSA-N 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 230000009897 systematic effect Effects 0.000 description 1
- 229910052718 tin Inorganic materials 0.000 description 1
- 231100000331 toxic Toxicity 0.000 description 1
- 230000002588 toxic effect Effects 0.000 description 1
- 238000012549 training Methods 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
- B09C—RECLAMATION OF CONTAMINATED SOIL
- B09C1/00—Reclamation of contaminated soil
- B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2101/00—Nature of the contaminant
- C02F2101/10—Inorganic compounds
- C02F2101/20—Heavy metals or heavy metal compounds
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Microbiology (AREA)
- Engineering & Computer Science (AREA)
- Environmental & Geological Engineering (AREA)
- Mycology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Health & Medical Sciences (AREA)
- Soil Sciences (AREA)
- Biomedical Technology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Hydrology & Water Resources (AREA)
- Water Supply & Treatment (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention discloses a kind of method of purification of heavy metal ion. Utilize class microassembly robot<i>penicillium? subjanthinellum</i>hG2014 makes corresponding microorganism remediation preparation, by this bacterium Adsorption of Heavy Metal Ions (Hg2+) effect, reduce the content of heavy metal in the environment such as soil, water body, and then protection of the environment, have development prospect.
Description
Technical field
The present invention relates to the applied technical field of microbial strains, particularly relate to a kind of method of purification of heavy metal ion.
Background technology
Current agricultural environment worsens with agricultural-food very serious by heavy metal contamination phenomenon, particularly in some developed areas. According to incompletely statistics, the contaminated area 2,667 ten thousand in the arable land of China hm2, wherein, industry/three-waste pollution 1,000 ten thousand hm2, 1,000 ten thousand hm are polluted in pesticide residue fertilising2. It is subject to nearly 2,000 ten thousand hm in arable land of the heavy metal contaminations such as cadmium, arsenic, lead, chromium, mercury2, account for the 1/5 of total area under cultivation, wherein cadmium pollution arable land 1,133 ten thousand hm2, it relates to economize 25 areas for 11; Mercury-contaminated 3,120,000 hm2, it relates to economize 21 areas for 15. Heavy metal not only can not bioavailable be degraded in water body, and some heavy metal also can be converted into the stronger heavy metal compound of toxicity under microbial process, such as methyl mercury. The physiological process of waterplant, after entering the ecosystem, can be caused very big impact by heavy metal ion. Especially seriously through the biomagnification effect of food chain, heavy metal is enrichment in more senior organism step by step, causes the untoward reaction of biology at different levels in the ecosystem, and even harm comprises health and the existence of the various life entities of human body. Therefore, various countries all give great attention for the pollution of heavy metal, and take the Preventing Countermeasures that heavy metal pollution of water body Sources controlling and engineering control combine. In order to meet people to the requirement of the increasingly stringent of environmental quality, the focus of research has concentrated on emerging coenocorrelation and has administered field. Many research shows, it is low that biological resuming technology has cost in improvement heavy metal contamination, easy, can not bring the advantages such as new pollution, have comparatively ideal effect, have a good application prospect. The microbiological treatment technology of heavy metal contamination, be utilize the effect of microorganism to cut down, the heavy metal that purifies in soil or water or reduce the toxicity of heavy metal. Some heavy metal ion accumulate for a long time in the environment, the microorganism of some in environment is made to define the ability of stronger resistance to heavy metal contamination, these microorganisms are as the special colony's long-term existence in the environment of a class, and toxic metal is defined certain resistance by them.For microorganism, it is a kind of detoxification, and it is a kind of well repair for environment, so that the metals such as mercury, lead, tin, arsenic or metalloid ion can reduce under the effect of microorganism or lose toxicity.
Summary of the invention
The object of the present invention is exactly a kind of method providing purification of heavy metal ion for above-mentioned Problems existing. Class microassembly robot PenicilliumsubjanthinellumHG2014 is utilized to make corresponding microorganism remediation preparation, by this bacterium Adsorption of Heavy Metal Ions (Hg2+) effect, reduce the content of heavy metal in the environment such as soil, water body, and then protection of the environment, have development prospect.
The method of a kind of purification of heavy metal ion of the present invention, it may also be useful to class microassembly robot PenicilliumsubjanthinellumHG2014 processes the water containing heavy metal ion or soil.
A kind microassembly robot bacterium of the present invention is in the center preservation of China Committee for Culture Collection of Microorganisms's common micro-organisms, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, postcode: 100101, its deposit number is: CGMCCNO.9730, the Latin title of bacterial classification is Penicilliumsubjanthinellum, the microorganism (strain) of ginseng certificate: HG2014, preservation date is on October 10th, 2014.
22-35 DEG C, when pH is 5-9, class microassembly robot PenicilliumsubjanthinellumHG2014 enlarged culturing is also inoculated in pending heavy metal ion sewage or soil and processes at least 5 days.
Preferably, 25 DEG C, pH is under 7 conditions, and by such microassembly robot bacteria strain on CYA, MEA, YES, PDA or DG18 solid medium after activation culture, enlarged culturing in PDB liquid nutrient medium is also inoculated in pending heavy metal ion sewage process 6 days.
Get such microassembly robot bacteria strain, it is transferred in the PDA culture dish containing heavy metal, cultivates 5-7 days, under aseptic condition, beat with 5mm punch tool and get bacterium cake, get 5 ferfas cakes join containing heavy metal Hg concentration be 20mg/L the 250mL Erlenmeyer flask of PDB liquid nutrient medium 100mL in, be placed in 120r/min, in the constant-temperature table of 25 DEG C, cultivate 6 days, filter with band filter paper funnel, get filtered liquid and clear up, survey heavy metal ion Hg2+Concentration, reaches 98% to the clearance of mercury.
This bacterial strain can grow on CYA, MEA, YES, PDA solid medium, and wherein 30 DEG C grow the fastest at CYA, and within 7 days, colony radius reaches 55 60 millimeters. Bacterium colony spreads growth radially at CYA substratum, and white is to canescence, and sporulation quantity is sparse. Perfect stage (ascus and shoestring) lacks. Conidiophore is main two verticillate, occasionally has an extra branch. Conidiophore is smooth, colourless, and length reaches 100-500 micron, and conidium is spherical or sub-spherical, smooth surface or micro-have coarse, and size is 2.5 3 microns.
30 DEG C, CYA, YES, PDA, DG18 substratum is cultivated 7 days colony growths vigorous, but sporulation quantity is sparse.
From the pure growth of such microassembly robot bacterium PenicilliumsubjanthinellumHG2014, genomic dna is extracted according to CTAB method, utilize rDNA internal transcribed spacer district (ITS) sequence specific primer ITS1/ITS4, obtaining ITS sequence by pcr amplification and sequencing analysis, its sequence is as shown in SEQIDNO.1:
TGTTTATTGTACCTTGTTGCTTCGGCAGGCCCGCCTCACGGCCGCCGGGGGGCTTTCCGCCCCCGGGCCCGCGCCTGCCGGAGACAATCTTGAACGCTGTCTGAAGAATGCAGTCTGAGCGATTAAGCAAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTGTTCCCCCGGGAACAGGCCCGAAAGGCAGTGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCCCCATCAATCTTTTTTTCAGGT��
Utilizing 'beta '-tubulin (��-tubulin) sequence specific primer Bt2a/Bt2b, obtain ��-tubulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQIDNO.2:
GGGGGCTGATGCACTGTCATCCCACTGCAGCAGATTATCTATTGTTGAGCACAGGACCTTTATACTGACTTGAGTCACAGGCAAAACATTGCTAGCGAGCATGGTCACGATGGCGAGGGCCAGTAAGTATCAATTTGGTTGGAATTGGGTGATATGAGAATGGCGGTCTGATATTTTTCTTAGCTTCACTGGCCAGTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACCACGTAAGTGTGGAAACCGACACTCGATACCTTTCCAACACGTCTAACATAATGGATCTTCATAGGCCAGCGGTGACCGTTACGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCAAGCTTTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCTGGTGCTGGTAACAACTGGGCCAAGGGTCATCCCTAGAGGGTAAAGTAGTCCTATTGGCCGGATGTTAACTTGTTTTCGCATTCATACTCCCCTCGCTATCACAGCCCGAATTCTCTTCATTTGTTCGGTGGAATAAGATCCGACCGTGCACTAGTATAGTGCACTTGTAATCTTTAATCTCCGAGCGTGCACATCACTCAGCACACCCCTCGCTAGGAGCGAATCTATAAATGGAGGACCATTTGTTGCAAAGGAAAGGTAGAGCAGACATGCCATAATGGTATTAAGACTATGCGCTCTGGGTGGTTTGCTCAACTTGGTCCTATGTTCTCAGGCTGAGAACATCACAGCCGATGCTCACCTTATACGCACTATCCCCTCGTGTCTATGCATCGCGTACGAGTCTCTCGTATTGATGATTTTAGACCAATGGATCCTTTTTCTAACCTCATCT
GGCCTACGCGATCTGGCACTGGAAACTGGGAATCCG��
Utilizing calmodulin (calmodulin) sequence specific primer cmd5/cmd6, obtain calmodulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQIDNO.3:
TGTTGCGCTCACGCATCGATTGGAGACCCGTGACCGGATTTAATGCTGATGGATATGTTCTCCGGCGATAGGACAAGGATGGTGATGGTTAGTGCGACCGTCGGCGATTTTTTTTTAATTCCATGCCGACTGGAGTATTCCCAACTGAGAGGACCGAATAACTGAGACCGATCGATCTATAGGACAAATCACCACCAAGGAGTTGGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCCGAGCTCCAGGACATGATTAACGAAGTCGATGCCGACAACAACGGTACCATTGACTTCCCTGGTACGATTTCCC
TCCCACTCGAATTATCCCGTACTCGCCTCCGGATATATGTTAACATGCGACACAGAGTTCCTTACCATGATGGCCCGTAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGTGAGGCATTCAAGGTTTTCGACCGTGACAACAACGGTTTCATTTCCGCCGCTGAGCTGCGCCACGTTATGAGTTTCTATCAGTCGACGGACTTATTTTCGCAGCCGAGCTTGGCCAGGTTGGCCAGCACTTGGGGAGCCCGGCCCGCCCGACCACATCCAGTGATGGTTGGTCAAGGACCCTGCTCACCAAACTGGCGGAAAAAAAC
CGCGGACCAGAAGATGCTGGACGACTACATGAGGCGGAGGACGGCGCCGGAGGACTTGAGGGTGATGACGCTGTTGTCGACGACGGTGACCATCTCACCCCTCTGGGTTTCCACGCGCAGCTTCTGCAACCGGGCAGCCCCCCCTGAGACGAGATTTTTGCCCATTGGGGGGCACCCCGCCGGGCGGCGTTAAACAGAATCACCCGCGCCTTGGTCGAGTCGATGTGCCGGAGTGCGCCCTTCAACGTGTGCTCGGCCAGCTCGGCGATCTGTCGGGCATTTCAACACCGGTGGGGCCAGCCCCGAAAAGGGAAAAGGCAATATTTGGGCTC��
By Blast software in GenBank, ITS sequence, ��-tubulin sequence and calmodulin sequence are compared, result display not with its homology higher than the bacterial strain of 99%, therefore infer that this bacterial strain is one newly plant.
GenBank database have chosen the representative gene order (ITS+ ��-tubulin) that part is higher with measuring sequence similarity, by ClustalW software and PAUP software with maximum parsimony method and maximum likelihood method constructing system evolutionary tree (see Figure of description Fig. 2), carry out Phylogenetic Analysis. As can be seen from phylogenetic tree, bacterial strain of the present invention shows with Penicilliumjanthinellum and Penicilliumcremeogriseum and compares high homology, wherein, the highest with the homology of Penicilliumjanthinellum, this result also obtain very high supporting rate, reliable results.
It is also similar to Penicilliumjanthinellum that Morphological comparison shows this kind, but, there is obvious difference in conidial morphological specificity of this kind and the form of microassembly robot bacterium, as conidial shape exists difference (spherical or the sub-spherical and usual oval of Penicilliumjanthinellum of Penicilliumsubjanthinellum and spore base portion point are thin), bacterial strain conidium of the present invention (2.5 3 microns) is also little than Penicilliumjanthinellum (3 3.5 microns). Therefore same species can not be thought. Therefore, combining form feature compares and ITS, 'beta '-tubulin systematics analytical results, newly plant Penicilliumsubjanthinellumsp.nov. for one that this bacterium is decided to be Penicillium.
At 25 DEG C, pH is in the PDB substratum of 7, and 120r/min shaking table training processes 6 days, and concentration is the Hg of 20mg/L by such microassembly robot PenicilliumsubjanthinellumHG20142+Adsorption rate reach 98% (Figure of description Fig. 3).
The useful effect of the present invention is: this bacterial strain, having easy cultivation on CYA, MEA, YES, PDA solid medium, grows fast feature, at Adsorption of Heavy Metal Ions (Hg2+) aspect can reach 98%, can not introduce new pollutent simultaneously. This bacterium is utilized to make corresponding microorganism remediation preparation, by this bacterium Adsorption of Heavy Metal Ions (Hg2+) effect, reduce the content of heavy metal in the environment such as soil, water body, and then protection of the environment, have development prospect.
Accompanying drawing illustrates:
Fig. 1 show under the upgrowth situation of bacterial strain of the present invention on CYA and opticmicroscope conidiophore and conidium feature (10 ��m, scale);
Fig. 2 show the phylogenetic tree that strain gene sequence of the present invention (ITS+ ��-tubulin) builds;
Fig. 3 show bacterial strain of the present invention and changes heavy metal ion (Hg in PDB liquid nutrient medium in time2+) adsorption rate.
Embodiment:
In order to understand the present invention better, the technical scheme of the present invention is described in detail below with specific examples.
Embodiment 1
The preparation of substratum:
A certain amount of HgCl is added respectively to the PDA substratum melted2Mother liquor stirs evenly, and namely the heavy metal content in solid medium is mercury ion (200mg/L).
The solid medium prepared is put into high-pressure sterilizing pot sterilizing 30min at 121 DEG C.
Solid medium after sterilizing being poured into about l/4-l/3 in culture dish highly locate, keep flat, cooled and solidified makes flat board. This operation aseptically carries out.
Embodiment 2
Bacterial strain purifying:
Take 10g(to increase and decrease as one sees fit because of the how much of soil sample water content) throughout the year by the soil sample (chemical industry plant area, Weifang, Shandong periphery soil) of mercury heavy metal contamination, add in the triangular flask filling 90mL aqua sterilisa, it is placed on shaking table by triangular flask 110-130r/min, vibrate 20 minutes, make soil particle be dispersed in distilled water, obtain the soil suspension that extension rate is 10;Therefrom drawing 1mL inserts in the test tube that 9mL aqua sterilisa is housed, for extension rate is 102Suspension. The substratum of sterilizing, when being cooled to about 45 DEG C, adds Streptomycin sulphate 30 �� g/mL, after pouring culture dish cooling solidification into, is 1 �� 10 by the extension rate obtained2Soil suspension fully shake even, draw 1mL, in each culture dish drip enter 4-6 drip, after it evenly being smeared with the curved glass stick of sterilizing, this culture dish is inverted in 21 DEG C-25 DEG C biochemical culture casees cultivate, after 6d-14d, stereoscopic Microscopic observation. Choose to get and vigorous, the form typical single spore to PDA substratum of growth is cultivated.
Bacterial strain is kept in the test tube of PDA medium slant, is chosen in the 2.5mL cryopreservation tube got and join in right amount containing 2.0mL sterilized water by the bacterial classification that purifying is cultivated simultaneously.
Embodiment 3
Extracting genomic dna according to CTAB method from the pure growth of bacterial strain of the present invention, utilize rDNA internal transcribed spacer district (ITS) sequence specific primer ITS1/ITS4, obtain ITS sequence by pcr amplification and sequencing analysis, its sequence is as shown in SEQIDNO.1. Utilizing 'beta '-tubulin (��-tubulin) sequence specific primer Bt2a/Bt2b, obtain ��-tubulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQIDNO.2. Utilizing calmodulin (calmodulin) sequence specific primer cmd5/cmd6, obtain calmodulin sequence by pcr amplification and order-checking, its sequence is as shown in SEQIDNO.3. By Blast software in GenBank, ITS sequence, ��-tubulin sequence and calmodulin sequence are compared, result display not with its homology higher than the bacterial strain of 99%, therefore infer that this bacterial strain is newly planted in order to one.
The primer sequence of ITS, 'beta '-tubulin, calmodulin is as follows:
ITS1:5��-TCCGTAGGTGAACCTGCGG-3��
ITS4:5��-TCCTCCGCTTATTGATATGC-3��
Bt2a:5��-GGTAACCAAATCGGTGCTGCTTTC-3��
Bt2b:5��-ACCCTCAGTGTAGTGACCCTTGGC-3��
Cmd5:5��-CCGAGTACAAGGCCTTC-3��
Cmd6:5��-CCGATAGAGGTCATAACGTGG-3��
In conjunction with various cultural characteristic and morphological specificity, ITS and the 'beta '-tubulin sequential analysis of this bacterium, this bacterium is decided to be class microassembly robot Penicilliumsubjanthinellum.
Embodiment 4
Bacterial strain heavy metal ion (Hg2+) absorption:
The class microassembly robot PenicilliumsubjanthinellumHG2014 bacterial strain of the present invention gone bail for and deposit, it is transferred in the PDA culture dish containing heavy metal, cultivate 5-7 days, under aseptic condition, beat with 5mm punch tool and get bacterium cake, getting 5 ferfas cakes joins containing in the 250mL Erlenmeyer flask of the PDB liquid nutrient medium 100mL of heavy metal Hg (20mg/L), separately get the same method of aseptic bacterium cake to process in contrast, it is placed in 120r/min, in the constant-temperature table of 25 DEG C, cultivates 6 days, filter with band filter paper funnel, mycelia is dried and weighs, and gets filtered liquid and clears up, and surveys heavy metal ion (Hg2+) concentration.
Described class microassembly robot bacteria strain not only has tolerance when mercury concentration (20mg/L) is higher, fast-growth can be carried out, there is again significant adsorptive power simultaneously, in liquid nutrient medium, mercury concentration obviously reduces, specifically asking for an interview Figure of description 3, the clearance of mercury is reached as high as 98% by bacterial strain of the present invention.
Sequence table
SEQUENCELISTING
<110>agricultural-food institute of Shandong Shanxi Academy of Agricultural Sciences
<120>a kind of method of purification of heavy metal ion
<130>nothing
<160>9
<170>PatentInversion3.3
<210>1
<211>454
<212>DNA
<213>Penicilliumsubjanthinellum
<400>1
tgtttattgtaccttgttgcttcggcaggcccgcctcacggccgccggggggctttccgc60
ccccgggcccgcgcctgccggagacaatcttgaacgctgtctgaagaatgcagtctgagc120
gattaagcaaaattagttaaaactttcaacaacggatctcttggttccggcatcgatgaa180
gaacgcagcgaaatgcgataattaatgtgaattgcagaattcagtgaatcatcgagtctt240
tgaacgcacattgcgccccctggtattccggggggcatgcctgtccgagcgtcattgctg300
ccctcaagcccggcttgtgtgttgggccctgttcccccgggaacaggcccgaaaggcagt360
ggcggcaccgcgtccgatcctcgagcgtatggggctttgtcacccgctctgtaggcccgg420
ccggcgcttgcccccatcaatctttttttcaggt454
<210>2
<211>916
<212>DNA
<213>Penicilliumsubjanthinellum
<400>2
gggggctgatgcactgtcatcccactgcagcagattatctattgttgagcacaggacctt60
tatactgacttgagtcacaggcaaaacattgctagcgagcatggtcacgatggcgagggc120
cagtaagtatcaatttggttggaattgggtgatatgagaatggcggtctgatatttttct180
tagcttcactggccagtccgacctccagctcgagcgcatgaacgtctacttcaaccacgt240
aagtgtggaaaccgacactcgatacctttccaacacgtctaacataatggatcttcatag300
gccagcggtgaccgttacgttccccgtgccgtcctggtcgacttggagcccggtaccatg360
gacgctgtccgtgccggtcctttcggcaagcttttccgtcccgacaacttcgtcttcggt420
cagtctggtgctggtaacaactgggccaagggtcatccctagagggtaaagtagtcctat480
tggccggatgttaacttgttttcgcattcatactcccctcgctatcacagcccgaattct540
cttcatttgttcggtggaataagatccgaccgtgcactagtatagtgcacttgtaatctt600
taatctccgagcgtgcacatcactcagcacacccctcgctaggagcgaatctataaatgg660
aggaccatttgttgcaaaggaaaggtagagcagacatgccataatggtattaagactatg720
cgctctgggtggtttgctcaacttggtcctatgttctcaggctgagaacatcacagccga780
tgctcaccttatacgcactatcccctcgtgtctatgcatcgcgtacgagtctctcgtatt840
gatgattttagaccaatggatcctttttctaacctcatctggcctacgcgatctggcact900
ggaaactgggaatccg916
<210>3
<211>972
<212>DNA
<213>Penicilliumsubjanthinellum
<400>3
tgttgcgctcacgcatcgattggagacccgtgaccggatttaatgctgatggatatgttc60
tccggcgataggacaaggatggtgatggttagtgcgaccgtcggcgatttttttttaatt120
ccatgccgactggagtattcccaactgagaggaccgaataactgagaccgatcgatctat180
aggacaaatcaccaccaaggagttgggcactgtcatgcgctccctcggccagaacccctc240
cgagtccgagctccaggacatgattaacgaagtcgatgccgacaacaacggtaccattga300
cttccctggtacgatttccctcccactcgaattatcccgtactcgcctccggatatatgt360
taacatgcgacacagagttccttaccatgatggcccgtaagatgaaggacaccgactccg420
aggaggagatccgtgaggcattcaaggttttcgaccgtgacaacaacggtttcatttccg480
ccgctgagctgcgccacgttatgagtttctatcagtcgacggacttattttcgcagccga540
gcttggccaggttggccagcacttggggagcccggcccgcccgaccacatccagtgatgg600
ttggtcaaggaccctgctcaccaaactggcggaaaaaaaccgcggaccagaagatgctgg660
acgactacatgaggcggaggacggcgccggaggacttgagggtgatgacgctgttgtcga720
cgacggtgaccatctcacccctctgggtttccacgcgcagcttctgcaaccgggcagccc780
cccctgagacgagatttttgcccattggggggcaccccgccgggcggcgttaaacagaat840
cacccgcgccttggtcgagtcgatgtgccggagtgcgcccttcaacgtgtgctcggccag900
ctcggcgatctgtcgggcatttcaacaccggtggggccagccccgaaaagggaaaaggca960
atatttgggctc972
<210>4
<211>19
<212>DNA
<213>synthesize
<400>4
tccgtaggtgaacctgcgg19
<210>5
<211>20
<212>DNA
<213>synthesize
<400>5
tcctccgcttattgatatgc20
<210>6
<211>24
<212>DNA
<213>synthesize
<400>6
ggtaaccaaatcggtgctgctttc24
<210>7
<211>24
<212>DNA
<213>synthesize
<400>7
accctcagtgtagtgacccttggc24
<210>8
<211>17
<212>DNA
<213>synthesize
<400>8
ccgagtacaaggccttc17
<210>9
<211>21
<212>DNA
<213>synthesize
<400>9
ccgatagaggtcataacgtgg21
Claims (7)
1. the method for a purification of heavy metal ion, it is characterized in that, class microassembly robot PenicilliumsubjanthinellumHG2014 is used to process the water containing heavy metal ion or soil, described class microassembly robot bacterium PenicilliumsubjanthinellumHG2014, it is in the center preservation of China Committee for Culture Collection of Microorganisms's common micro-organisms, its deposit number is CGMCCNO.9730, preservation date is on October 10th, 2014, 22-35 DEG C, when pH is 5-9, class microassembly robot PenicilliumsubjanthinellumHG2014 enlarged culturing is also inoculated in pending heavy metal ion sewage or soil and processes at least 5 days.
2. the method for a kind of purification of heavy metal ion according to claim 1, it is characterized in that, 25 DEG C, pH is under 7 conditions, by such microassembly robot bacteria strain at CYA, MEA, YES, on PDA or DG18 solid medium after activation culture, enlarged culturing in PDB liquid nutrient medium is also inoculated in pending heavy metal ion sewage and processes 6 days.
3. the method for a kind of purification of heavy metal ion according to claim 1, it is characterized in that, get such microassembly robot bacteria strain, it is transferred in the PDA culture dish containing heavy metal, cultivate 5-7 days, under aseptic condition, beat with 5mm punch tool and get bacterium cake, get 5 ferfas cakes join containing heavy metal Hg concentration be 20mg/L the 250mL Erlenmeyer flask of PDB liquid nutrient medium 100mL in, be placed in 120r/min, in the constant-temperature table of 25 DEG C, cultivate 6 days, filter with band filter paper funnel, get filtered liquid and clear up, survey concentration of heavy metal ion, the clearance of mercury is reached 98%.
4. the method for a kind of purification of heavy metal ion according to claim 1, it is characterised in that, such microassembly robot bacteria strain is at CYA, MEA, YES, PDA or DG18 solid medium grows, wherein 30 DEG C grow the fastest at CYA, and within 7 days, colony radius reaches 55 60 millimeters.
5. the method for a kind of purification of heavy metal ion according to claim 1, it is characterised in that, such microassembly robot bacteria strain bacterium colony spreads growth radially at CYA substratum, white to canescence, sporulation quantity is sparse, the perfect stage ascus and shoestring disappearance.
6. the method for a kind of purification of heavy metal ion according to claim 1, it is characterized in that, such microassembly robot bacteria strain conidiophore is main two verticillate, occasionally having an extra branch, conidiophore is smooth, colourless, length reaches 100-500 micron, conidium is spherical or sub-spherical, smooth surface or micro-have coarse, and size is 2.5 3 microns.
7. the method for a kind of purification of heavy metal ion according to claim 1, it is characterised in that, concentration is the Hg of 20mg/L by such microassembly robot PenicilliumsubjanthinellumHG20142+Adsorption rate reach 98%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410641010.3A CN104556399B (en) | 2014-11-14 | 2014-11-14 | A kind of method of purification of heavy metal ion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410641010.3A CN104556399B (en) | 2014-11-14 | 2014-11-14 | A kind of method of purification of heavy metal ion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104556399A CN104556399A (en) | 2015-04-29 |
| CN104556399B true CN104556399B (en) | 2016-06-08 |
Family
ID=53073601
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410641010.3A Expired - Fee Related CN104556399B (en) | 2014-11-14 | 2014-11-14 | A kind of method of purification of heavy metal ion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104556399B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105750326A (en) * | 2016-04-21 | 2016-07-13 | 绍兴文理学院 | Method for remedying cadmium-polluted soil |
| CN109909294B (en) * | 2019-04-18 | 2021-03-23 | 山东省食品药品检验研究院 | Microbial remediation method for heavy metal contaminated soil |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008263972A (en) * | 2007-03-29 | 2008-11-06 | Kitakyushu Foundation For The Advancement Of Industry Science & Technology | Mixed culture method of fungi and bacteria |
| CN102191181A (en) * | 2010-03-11 | 2011-09-21 | 中国农业科学院农业环境与可持续发展研究所 | Screening method of penicillium janthinellum and application thereof |
| CN103910437A (en) * | 2014-04-18 | 2014-07-09 | 湖南大学 | Method for removing heavy metal ions out of water |
-
2014
- 2014-11-14 CN CN201410641010.3A patent/CN104556399B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008263972A (en) * | 2007-03-29 | 2008-11-06 | Kitakyushu Foundation For The Advancement Of Industry Science & Technology | Mixed culture method of fungi and bacteria |
| CN102191181A (en) * | 2010-03-11 | 2011-09-21 | 中国农业科学院农业环境与可持续发展研究所 | Screening method of penicillium janthinellum and application thereof |
| CN103910437A (en) * | 2014-04-18 | 2014-07-09 | 湖南大学 | Method for removing heavy metal ions out of water |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104556399A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104450552B (en) | A kind of sulfate reducing bacteria phosphate solubilizing bacteria and its application in combined repair of cadmium polluted soil | |
| CN107090413B (en) | Glyphosate degradation bacterium and its processing heavy metal-glyphosate combined pollution in apply | |
| CN104531537B (en) | A kind of aspergillus flavus strain and its application | |
| CN110713946B (en) | Sphingosine bacteria capable of degrading bisphenol A and triphenyl phosphate | |
| CN106916765B (en) | A method of heavy metal in waste water zinc is adsorbed using penicillium janthinellum | |
| CN104805036A (en) | Applications of Microbacterium sp. J-1 in degradation of plurality of phthalic acid esters | |
| CN104556399B (en) | A kind of method of purification of heavy metal ion | |
| CN104805033A (en) | Microbacterium sp. J-1 used for degrading plurality of phthalic acid esters | |
| CN104531565A (en) | Achromobacter denitrificans zjut1104 and application thereof | |
| CN107058189B (en) | Bacillus megaterium and its processing heavy metal-glyphosate combined pollution in apply | |
| CN105567575A (en) | New Purpureocillium sp strain F1 and application thereof | |
| CN109516869A (en) | Complex function microorganism formulation and its preparation method and application | |
| CN105969668A (en) | Trichoderma asperellum having lead-tolerant capability | |
| CN106244501B (en) | One plant of anti-antimony bacterium NXH1 and its application | |
| CN106434446B (en) | One plant of anti-antimony bacterium NXH3 and its application | |
| CN104845899A (en) | Application of Rhodococcus sp. 2G in degradation of phthalate | |
| CN104805035A (en) | Rhodococcus sp. 2G used for simultaneous degradation of plurality of phthalic acid esters | |
| CN112280694A (en) | Endophytic fungus phomopsis D2G7 and application thereof | |
| CN108130281B (en) | Aspergillus terreus DDT98801 and its screening technique and the application in degradation of dichloro-diphenyl-trichloroethane | |
| CN104805018B (en) | Earth mould (Agromyces sp.) MT E of one plant of a variety of phthalic acid ester that can degrade simultaneously | |
| CN114196570B (en) | Chryseobacterium and application thereof in degrading glyphosate | |
| CN104673678A (en) | Penicillium subjanthinellum HG2014 | |
| CN104845890A (en) | Application of Agromyces sp. MT-E in degradation of various phthalates | |
| CN107603893A (en) | It is a kind of that there is resistance purple born of the same parents bacterium and extracting method and application to cadmium | |
| CN104805034B (en) | A method of it is degraded a variety of phthalic acid esters using microbacterium |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| ASS | Succession or assignment of patent right |
Owner name: CROP INSTITUTE, HUNAN ACADEMY OF AGRICULTURAL SCIE Effective date: 20150427 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhou Qingxin Inventor after: Chen Xiangyan Inventor after: Chen Leilei Inventor after: Ding Zili Inventor after: Wang Yifen Inventor after: Qiu Jiying Inventor after: Liu Xiaoyong Inventor after: Wang Junhua Inventor before: Zhou Qingxin Inventor before: Chen Xiangyan Inventor before: Chen Leilei Inventor before: Qiu Jiying Inventor before: Liu Xiaoyong Inventor before: Wang Junhua |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: ZHOU QINGXIN CHEN XIANGYAN CHEN LEILEI QIU JIYING LIU XIAOYONG WANG JUNHUA TO: ZHOU QINGXIN CHEN XIANGYAN CHEN LEILEI DING ZILI WANG YIFEN QIU JIYING LIU XIAOYONG WANG JUNHUA |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20150427 Address after: Industrial Road Licheng District, Ji'nan city of Shandong Province, No. 202 250100 Applicant after: Agricultural Products Research Institute, Shandong Academy of Agricultural Sciences Applicant after: Crop Institute, Hunan Academy of Agricultural Sciences Address before: Industrial Road Licheng District, Ji'nan city of Shandong Province, No. 202 250100 Applicant before: Agricultural Products Research Institute, Shandong Academy of Agricultural Sciences |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160608 Termination date: 20201114 |