CN104388459B - Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant - Google Patents
Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant Download PDFInfo
- Publication number
- CN104388459B CN104388459B CN201410589298.4A CN201410589298A CN104388459B CN 104388459 B CN104388459 B CN 104388459B CN 201410589298 A CN201410589298 A CN 201410589298A CN 104388459 B CN104388459 B CN 104388459B
- Authority
- CN
- China
- Prior art keywords
- microcell
- mind
- antibacterial
- mutant
- produced
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a kind of method making the self-produced microcell of antibacterial, the method is the suicide plasmid of the upstream and downstream homology arm of the nucleotide sequence by building the sequence iden containing nucleotide sequence shown in SEQ ID No.1 or with nucleotide sequence shown in SEQ ID No.1 with least 80%, and knock out described nucleotide sequence using methods of homologous recombination, thus suppressing being normally carried out of antibacterial division, antibacterial is made to disconnect at the two poles of the earth position, thus producing microcell.The method does not contain any resistance marker, meets the requirement of vaccine bio-safety, can promote application in subunit vaccine and antigen presentation carrier for the microcell.The present invention also provides the Salmonella typhimurium mutant of one plant of self-produced microcell preparing under this methodology, and Classification And Nomenclature isSalmonella entericaSerovar Typhimuriumi P0002, preserving number is CCTCC NO.M2014474, and the preservation time is on October 14th, 2014.
Description
Technical field
The invention belongs to technical field of bioengineering is and in particular to make antibacterial self-produced from the method for main product microcell and one plant
Minicell mutant.
Background technology
Bacterial minicells are a kind of nothings isolated and produced by bacillus the two poles of the earth after proper splitting activity is disturbed
Nuclear structure.First microcell producing bacterial strain is found when finding cell separation mutant by genomics research worker,
After they find this kind of structure, the microcell formation related content of various molecular levels and gene level is more
Out, people can be according to the generation mechanism of microcell, and to gene, clearly bacterial strain is transformed with bacterial strain structural context for report,
Microcell is enable preferably to use as vaccine carrier.Microcell has been used for transcription, translation, plasmid separation, cell
Duplication, plasmid backbone virulence factor expression analysis etc., because microcell does not have the characteristic of duplication, but can be big in submission antibacterial
Most materials, including proteantigen and plasmid DNA so as to a kind of efficient vaccine carrier platform can be become.
Microcell has following characteristics：1st, because microcell is considered the bacteria particles not containing hereditary material,
There are most of biological characteristicses of parent bacteria, exogenous plasmid and expression foreign protein can be carried, and can utilize
The excretory system of antibacterial is transforming secretion foreign protein, so in terms of as antigen presentation carrier, having and more widely select
Advantage；2nd, due to its do not have bacterial genomes etc. make antibacterial replicate material, internal body will not colonize for a long time bring latent
In harm；3rd, because microcell has the biofilm composition similar with antibacterial, body can be stimulated to produce efficient immunoreation
And immune protective efficiency, 4, the size due to microcell have difference with the parent bacteria that can replicate, we just can using letter
Just, microcell can efficiently be separated from parental cell by traditional separation method such as gradient centrifugation very much, purification
Method is simple and feasible.
At present although can be by certain methods so that the self-produced microcell of escherichia coli, but on other antibacterials, particularly
On salmonella, also do not find a kind of preferable method making its self-produced microcell.
Content of the invention
One of the technical problem to be solved in the present invention is to provide a kind of method making the self-produced microcell of antibacterial.The method bag
Include following steps：
1）Build containing nucleotide sequence shown in SEQ ID No.1 or have with nucleotide sequence shown in SEQ ID No.1
The suicide plasmid of the upstream and downstream homology arm of the nucleotide sequence of at least 80% sequence iden, described SEQ ID No.1 institute
The nucleotides sequence showing is classified as the minD gene order lacking last 18bp sequence；
2）By antibacterial and containing step 1）The λ pir coli strain natural combination of gained plasmid, by homologous recombination
Method, through chlorampenicol resistant screening and the screening of sucrose sensitivity, obtains lacking the mutant of the gene of regulation and control antibacterial division.
Described suicide plasmid is built with pRE112 for plasmid vector.
The construction step of described suicide plasmid is：
1）Design of primers
∆minD-1F：5’-TCACAAAAACGCGATTAATTGATG-3’
∆minD-1R：5’-ACCTGCAGGATGCGGCCGCGGTTAAAAAGGGATCAATTC-3’
∆minD-2F：5’-CCGCGGCCGCATCCTGCAGG CAAACGCCTGTTCG-3’
∆minD-2R：5’-GTTGCAGGAGTATCCGCTTTAACG-3’
2）Extract bacterial genomes DNA being in exponential phase as template, carried out with left and right homology arm primer respectively
Amplification, obtain the amplified production of homology arm around, recovery product carries out fusion DNA vaccine amplification, that is, use primer minD-1F and
MinD-2R is expanded, and obtains the left and right homology arm amplified production having merged；
3）Carry out+A base with+A reaction kit in fragment ends again to process, and obtain with after Adh 1 enzyme action
PRE112 digestion products are attached in the presence of T4 ligase and are transformed in λ pir escherichia coli, obtain the antibacterial containing regulation and control
The suicide plasmid pRE112-minD of the upstream and downstream homology arm of gene of division.
Restructuring suicide plasmid, due to can not replicate survival in Salmonella, will proceed to the λ pir escherichia coli of recombiant plasmid
Bacterial strain is engaged naturally with Salmonella, makes homologous fragment import salmonella gene group, and passes through homologous recombination, through first
Secondary exchange and resistance screening（Cm resistance）, obtain positive colony, then culture positive colony is so as to occur spontaneous mutation to produce two
Secondary exchange, with the Screening of Media containing sucrose, obtains the clone to sucrose resistance to antibiotic sensitive, the side of last PCR
Method screening obtains mutant strain.
As all knocked out minD gene, the normal work of minE can be affected, be easy to lead to antibacterial not produce microcell.
Only knock out nucleotide sequence or the sequence with nucleotide sequence shown in SEQ ID No.1 with least 80% shown in SEQ ID No.1
The nucleotide sequence of row homogeneity, so that the self-produced microcell of antibacterial.
It is a further object to provide the Salmonella enterica serovar of one plant of self-produced microcell
Typhimuriumi P002 mutant.Lack in minD gene in this mutant chromosomal DNA in addition to last 18bp sequence
All sequences, Classification And Nomenclature be Salmonella enterica serovar Typhimuriumi P0002, in being preserved in
State's Type Tissue Collection (wuchang, wuhan Luo Jia Shan, Wuhan University, postcode：430072), preserving number is CCTCC
NO.M2014474, the preservation time is on October 14th, 2014.This mutant can self-produced microcell, can be as a kind of efficient
The application of antigen presentation carrier and subunit vaccine provides precondition.
The invention has the beneficial effects as follows：
1st, the present invention can make the self-produced microcell of antibacterial, and microcell has non-reproduction due to it, and it is as subunit
If vaccine and antigen presentation carrier, lasting injury will not be produced to body, the present invention can promote microcell in subunit epidemic disease
Application on Seedling and antigen presentation carrier；
2nd, the method that the present invention provides, does not contain any resistance marker, meets the requirement of vaccine bio-safety.
Brief description
Fig. 1：The inventive method schematic diagram；
Fig. 2：Plasmid figure containing the suicide plasmid of upstream and downstream homology arm of minD gene lacking last 18bp sequence
Spectrum；
Fig. 3：It is the qualification result of the suicide plasmid that the present invention builds, in figure M：DNA marker Ⅲ 1：minD
Fig. 4：The PCR detection electrophoresis result of the different serotypes salmonella mutant of self-produced microcell, in figure M：DNA
marker Ⅲ 1：Parent minD；
Fig. 5：The activity checking of the microcell that the Salmonella typhimurtum mutant of self-produced microcell produces；
Fig. 6：The electron micrograph result of the microcell that the Salmonella typhimurtum mutant of self-produced microcell produces；
Fig. 7：Knock out the electron micrograph result of the Mus salmonella mutant of minD gene order, arrow indication completely
Part is long filamentous bacteria；
Fig. 8：Knock out the nucleotides sequence with the sequence iden with nucleotide sequence shown in SEQ ID No.1 with 80%
The electron micrograph result of the microcell that the Yersinia enterocolitica of row produces.
Specific embodiment
Below by embodiment, the present invention is specifically described it is necessary to it is pointed out here that be following examples be use
In being further detailed it is impossible to be interpreted as limiting the scope of the invention to the present invention, being skilled in technique of this field
Personnel made according to foregoing invention content some nonessential improve and adjust, still fall within protection scope of the present invention.
Embodiment 1
1）Structure containing the suicide plasmid of upstream and downstream homology arm of minD gene lacking last 18bp sequence
According to the Salmonella typhimurium UK-1 strain sequence reported for work（With reference to GenBank Serial No. CP002614.1）If
Meter two expands upstream homology arm and the downstream homology of the minD gene lacking last 18bp sequence respectively to fusion DNA vaccine primer
Arm, amplified fragments size is respectively 420bp and 360bp, and above-mentioned primer is synthesized by Beijing Huada gene company, and primer sequence is such as
Under：
∆minD-1F：5’-TCACAAAAACGCGATTAATTGATG-3’
∆minD-1R：5’-ACCTGCAGGATGCGGCCGCGGTTAAAAAGGGATCAATTC-3’
∆minD-2F：5’-CCGCGGCCGCATCCTGCAGG CAAACGCCTGTTCG-3’
∆minD-2R：5’-GTTGCAGGAGTATCCGCTTTAACG-3’
The Salmonella typhimurium UK-1 strain of lyophilizing is connected to incubated overnight in LB flat board, picking single bacterium colony inoculation in second day
In LB fluid medium, 37 DEG C of 180 r/min cultivates the genome that 8-12h extracts antibacterial, extract genome using be
The biochemical bacterial genomes extraction agent box of Tiangeng, operating procedure to specifications carries out the extracting of genome.
The amplified reaction of PCR is carried out in the system of 50 μ L, and reaction system is as follows：Template DNA 1 μ L, 2 × high-fidelity DNA
Enzyme premixed liquid, purchased from precious biological（Dalian）Company limited 25 μ L, forward primer 1 μ L, downstream primer 1 μ L, ddH2O 22μL.
Amplification condition is：Circulation is entered, loop parameter is 94 DEG C of 10 sec, 55 DEG C of 15 sec after 94 DEG C of degeneration 5min,
72℃ 10 sec.After 35 circulations, 72 DEG C of extension 10min.The PCR primer of amplification is analyzed through 1% agarose gel electrophoresiies, expands
Increase two clip size and be respectively 420bp and 360bp, with expected sizableness.
The fusion of upstream and downstream homology arm：By upstream and downstream homology arm according to molal quantity 1:1 ratio, total template amount is that 2 μ L make
Expand template for PCR, carried out under system as before and amplification condition using primer minD-1F and minD-2R
Amplification, obtain size be 800bp about fusion fragment.
The fusion obtaining before fragment is carried out+A process, using the plus A reaction kit that Tiangeng is biochemical, reactant
It is to be：Template 15 μ L, plus A buffer 4 μ L, Taq enzyme 1 μ L；Reaction condition is：72 DEG C of 30min, treat after the completion of reaction
With.
The preparation of suicide plasmid pRE112 endonuclease bamhi：Using Adh I enzyme action pRE112 plasmid, plasmid fragments enzyme action is gone out T
Cloning site, reclaims carrier pRE112, then uses T4 DNA ligase to connect, and 16 DEG C of water-baths overnight, convert λ pir large intestine bar
Bacterium competence cell, treats that it grows laggard performing PCR identification, thus obtaining suicide plasmid.Qualification result confirms the suicide matter building
Grain is correct, and as shown in Figure of description 3, the structure flow chart of suicide plasmid is as shown in Figure of description Fig. 2.
2）The structure of the Salmonella typhimurium mutant of self-produced microcell
The suicide plasmid building is converted to escherichia coli λ pir coli strain（This plasmid has lacked asd base
Cause, needs DAP can grow, and can be good at for the follow-up screening engaging transfer）, the λ of suicide plasmid will be carried
Pir escherichia coli and Salmonella typhimurium（Salmonella enterica serovar Typhimuriumi UK-1）, pig
Cholera Salmonella（Salmonella Choleraesuis）, Salmonella enteritidis（Salmonella Enteritidis）, chicken
Salmonella typhi（Salmonella Gallinarium）, salmonella dublin（Salmonella Dublin）And first
Type salmonella paratyphi（Salmonella paratyphi A）Carry out engaging transfer Deng bacterial strain, put down in the LB of chlorampenicol resistant
Positive bacterium colony is screened on plate, positive bacterium colony is cultivated propagation in the LB fluid medium without chlorampenicol resistant, in 10% sucrose
Screen, on flat board, the bacterium colony of resistance to sucrose, and picking single bacterium colony enters performing PCR identification.
PCR identifies：Extract minD mutant strain MinD-UK-1 genomic DNA, with primer minD-1F and minD-
Can 2R expands upstream and downstream homology arm fragment, use primer minD-1R and minD-2F to expand minD gene simultaneously, see and expand
Go out size be about 700bp about specific deficiency minD genetic fragment, if respective segments can not be amplified, show tie
Fruit is consistent with expection, and the identification of the present embodiment mutant successfully constructs, as shown in Figure of description Fig. 4.
Embodiment 2
Except build homology arm the structure of suicide plasmid when, the suicide plasmid of homology arm contains and has plenty of as SEQ ID
The upstream and downstream homology arm of the nucleotide sequence shown in No.2, and primer sequence is：
minD-1F：atcatcaacacgcctgtcc
minD-1R：cgcggccgccctgcagggaaatggattccttgtcaaaag
minD-2F：tccctgcagggcggccgcgggggataaaccatggctttg
minD-2R：ggattttcttgttttggctg
Outside, remaining step is in the same manner as in Example 1.
Embodiment 3
The purification of microcell and Activity determination：Mutant salmonella strain in the embodiment 1 of culture 500ml is to low-oxygen environment
Until OD value A600 reaches 1.1.By double low-speed centrifugal（2000 × g, 10mins）Remove microorganism impurity, receive
Collection supernatant, microcell is enriched in supernatant, by centrifugation（10000 × g, 30mins）Collect microcell, and with 1 × DPBS weigh
Hang, and obtain the microcell of purification using density gradient centrifugation, density gradient pattern is：The iodixanol of continuous 5-20%
Density centrifugation agent concentration is added to centrifuge tube by (OptiPrep, Axis-Shield PLC, Scotland) respectively from high to low
In, microcell is placed in top, is centrifuged after installing density centrifugation（2000 × g, 20min）, after the completion of centrifugation, collect different levels
Centrifugal liquid in 1.5ml centrifuge tube, collect microcell with 18000 × g, and with the suitable resuspended microcell of solvent, not dirty
The microcell of dye can be with 106Comprise only an antibacterial in microcell and be not contaminated judging it.
Reporter plasmid pUC-Mcherry containing red fluorescent protein is proceeded to Salmonella by the method that electricity converts dash forward
In mutant, and according to method described above by minicell purification out, can be seen by fluorescent electronic microscope and being purified
Minicell purity high, and red fluorescent protein can be expressed, show redness, as shown in Figure of description Fig. 5.
Embodiment 4
The electron microscopic observation of the microcell of spontaneous generation：For the mutant of embodiment 1 and embodiment 2, in culture to logarithm
The microcell of phase produces in mutant strain bacterium solution culture medium and takes 1 ml culture fluid, thalline is collected by centrifugation with 4000 × g, clear with PBS
Wash 2 times, with glutardialdehyde (2.5% in PBS), fix 2 hours for 4 degree, with identical buffer rinse 3 times, use
Ethylalcohol and isoamyl acetate solutions is dehydrated step by step, is put on silver spray support, complete with dry ice
After dehydration, one layer of argentum powder of spray increases the sensitivity of sample, is produced with Hitachi S-4800 scanning electron microscopic observation microcell mutant
The situation of raw microcell, the microcell that simultaneously can use after purification carries out electron microscopic observation after the as above process of step, result such as explanation
Shown in book accompanying drawing Fig. 6 and Fig. 8.
Comparative example 1
When building suicide plasmid, except upper and lower homology arm contains whole minD gene order, and primer sequence is：
MinD-1F：TCACAAAAACGCGATTAATTGATG
MinD-1R：ACCTGCAGGATGCGGCCGCGG TTAAAAAGGGATCAATTC
MinD-2F: CCGCGGCCGCATCCTGCAGGTATGGCATTACTGG
MinD-2R: GTTGCAGGAGTATCCGCTTTAACG
Outside, remaining step is consistent with embodiment 1.
As shown in Figure of description 7, MinD gene is knocked out completely, the function of MinE can be affected, thus forming arrow institute
Long filamentous bacteria at finger, does not have the situation that antibacterial disconnects at the two poles of the earth in division, thus not forming Minicells.
Sequence table
SEQUENCE LISTING
<110>Sichuan Agricultural University
<120>Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant
<130> 2014
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 795
<212> DNA
<213>Artificial sequence
<400> 1
atggcacgca ttattgttgt tacttcgggt aaagggggcg ttggcaagac cacctccagc 60
gcggccatcg ctacaggttt ggcccagaag ggaaagaaaa ctgtcgtcat tgattttgat 120
atcggactgc gtaacctcga tctgattatg gggtgcgaac gtcgtgtcgt ttacgatttt 180
gtaaacgtca ttcagggcga tgcgacactg aatcaggcgc tgatcaaaga taagcgtact 240
gaaaatctct tcattcttcc ggcgtcgcag acccgggata aagacgcgct aacgcgcgaa 300
ggcgtcgcta aggtactgga ctcactgaaa gcgatggact ttgagttcat cgtttgcgac 360
tcgccggcgg gtatcgaaac cggggcgctg atggcgctct attttgccga tgaagcgatc 420
atcacgacca acccggaagt ctcttctgtc cgtgactcgg accgtattct gggtattctg 480
gcatcgaaat ctcgtcgcgc agaaaatggc gaagaaccga ttaaagaaca tctcctgttg 540
acgcgctaca atccaggccg cgtcaataaa ggcgacatgc tcagcatgga agatgtactg 600
gagattctgc gtattaaact cgtcggtgtg atcccggaag atcaatccgt actgcgcgca 660
tcgaaccagg gcgaaccggt gattcttgac gccactgcgg atgcgggtaa agcctatgca 720
gataccgtag atcgtctgtt gggagaagaa cgtcctttcc gcttcattga agaagagaag 780
aaaggtttcc tcaaa 795
<210> 2
<211> 813
<212> DNA
<213>Artificial sequence
<400> 2
atggcacgca ttattgttgt tacatcgggt aaagggggcg ttggcaagac cacatcaagc 60
gcggctatcg caaccggctt ggcccaaaaa ggtaaaaaaa ccgttgttat cgattttgat 120
atcggactac ggaatctaga cttgattatg ggttgtgaac gccgggtagt ttacgatttt 180
gttaatgtga ttcaaggtga cgccacattg aaccaggcat taataaaaga taagcgcacg 240
gataatttgt atattctgcc cgcttctcag acccgtgaca aagacgctct gaccaaagag 300
ggtgtcgaaa agattttaaa cgatcttggc gaaatgaatt ttgagtttgt cgtgtgtgac 360
tcacctgccg gtatcgaaag cggtgcgttg atggcactgt attttgctga cgaagctgtc 420
atcacgacca accctgaagt ttcttcagtt cgtgactcag accgtatcct cgggatattg 480
tcatccaagt cacgccgagc tgagaatggt caggaaccaa ttaaagaaca tctgctgttg 540
actcgctaca acccagggcg tgttaatcgc ggcgatatgc ttagcatgga agatgtcctt 600
gatattctga ggataccact ggttggcgtt attccagaag atcagtctgt attgcgcgcc 660
tcgaaccaag gcgagcctgt gattctggac aaagagtcag atgccggtaa agcttatgac 720
gataccgttg accgtttgct aggagaagaa cgtcccttcc gcttcattga agaagagaag 780
aagggcttcc tgaaacgcct ttttggggga taa 813
Claims (2)
1. a kind of method making the self-produced microcell of antibacterial it is characterised in that：The method comprising the steps of：
1) suicide plasmid containing the upstream and downstream homology arm of nucleotide sequence shown in SEQ ID No.1, described SEQ ID are built
Nucleotides sequence shown in No.1 is classified as the minD gene order lacking last 18bp sequence；
2) by Salmonella with containing step 1) the λ pir coli strain natural combination of gained plasmid, by homologous recombination
Method, through chlorampenicol resistant screening and the screening of sucrose sensitivity, obtains lacking the mutant of the gene of regulation and control antibacterial division；
The construction step of described suicide plasmid is：
1) design of primers
ΔminD-1F：5’-TCACAAAAACGCGATTAATTGATG-3’
ΔminD-1R：5’-ACCTGCAGGATGCGGCCGCGGTTAAAAAGGGATCAATTC-3’
ΔminD-2F：5’-CCGCGGCCGCATCCTGCAGG CAAACGCCTGTTCG-3’
ΔminD-2R：5’-GTTGCAGGAGTATCCGCTTTAACG-3’
2) extract bacterial genomes DNA being in exponential phase as template, expanded with left and right homology arm primer respectively,
Obtain the amplified production of homology arm around, recovery product carries out fusion DNA vaccine amplification, that is, use primer Δ minD-1F and Δ
MinD-2R is expanded, and obtains the left and right homology arm amplified production having merged；
3) carry out+A base with+A reaction kit in fragment ends again to process, and obtain pRE112 enzyme with after Adh 1 enzyme action
Cut product to be attached in the presence of T4 ligase and be transformed in λ pir escherichia coli, obtain the base of the division of the antibacterial containing regulation and control
The suicide plasmid of the upstream and downstream homology arm of cause.
2. the Salmonella enterica of one plant of self-produced microcell being prepared by claim 1 methods described
Serovar Typhimuriumi P0002 mutant it is characterised in that：MinD base has been lacked in described mutant chromosomal DNA
Most of sequence of cause, but retain last 18bp sequence therein, Classification And Nomenclature is Salmonella enterica serovar
Typhimuriumi P0002, is preserved in China typical culture collection center, and preserving number is CCTCC NO.M2014474, protects
The Tibetan time is on October 14th, 2014.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410589298.4A CN104388459B (en) | 2014-10-29 | 2014-10-29 | Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410589298.4A CN104388459B (en) | 2014-10-29 | 2014-10-29 | Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104388459A CN104388459A (en) | 2015-03-04 |
| CN104388459B true CN104388459B (en) | 2017-03-08 |
Family
ID=52606416
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410589298.4A Expired - Fee Related CN104388459B (en) | 2014-10-29 | 2014-10-29 | Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388459B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105462907A (en) * | 2015-11-02 | 2016-04-06 | 四川农业大学 | Attenuation salmonella typhimurium and construction method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005079854A1 (en) * | 2004-02-02 | 2005-09-01 | Engeneic Molecular Delivery Pty Ltd. | Compositions and methods for targeted in vitro and in vivo drug delivery to mammalian cells via bacterially derived intact minicells |
-
2014
- 2014-10-29 CN CN201410589298.4A patent/CN104388459B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005079854A1 (en) * | 2004-02-02 | 2005-09-01 | Engeneic Molecular Delivery Pty Ltd. | Compositions and methods for targeted in vitro and in vivo drug delivery to mammalian cells via bacterially derived intact minicells |
| CN102028953A (en) * | 2004-02-02 | 2011-04-27 | 恩杰内克分子递送有限公司 | Compositions and methods for targeted in vitro and in vivo drug delivery to mammalian cells via bacterially derived intact minicells |
Non-Patent Citations (1)
| Title |
|---|
| A Division Inhibitor and a Topological Specificity Factor Coded for by the Minicell Locus Determine Proper Placement of the Division Septum in E. coli;Piet A. J. de Boer等;《Cell》;19890224;第56卷;641-649 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104388459A (en) | 2015-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109825532B (en) | Application of CRISPR/Cas12a gene editing system in physcomitrella patens gene editing | |
| CN102984955A (en) | Bifidobacterium longum | |
| US20220132834A1 (en) | Methods, apparatuses, and systems for improving microbial preservation yield through rescue and serial passage of preserved cells | |
| CN104388368B (en) | Low-endotoxin escherichia coli prokaryotic expression engineering bacterial mutant strain and construction method | |
| CN104593388B (en) | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof | |
| CN105132350B (en) | The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application | |
| CN110393798A (en) | African swine fever virus vaccine strain and vaccine containing vaccine strain | |
| CN109022476A (en) | A kind of bacillus licheniformis CRISPR-Cas9 gene editing system and its application | |
| CN101979598B (en) | Method for constructing HSV-1 BAC system carrying luciferase report genes | |
| CN101265457A (en) | Vaccine for differentiating porcine actinobacillus pleuropneumonia serum 7-type double-gene deletion mutant of vaccine immunity and virus infection animal and application thereof | |
| CN106929485A (en) | Pseudorabies virus genetic engineering gB recombinates attenuated vaccine strain and application | |
| CN104388459B (en) | Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant | |
| Ahmad et al. | Dynamic integration and excision of filamentous phage XacF1 in Xanthomonas citri pv. citri, the causative agent of citrus canker disease | |
| CN106939320A (en) | A kind of 2012 plants of infective cloned plasmids of Pseudorabies virus JS, construction method and application | |
| CN115094045B (en) | Heat-resistant chimeric gene VII type newcastle disease attenuated strain and application thereof | |
| CN106190943A (en) | A kind of dual-gene disappearance Salmonella enteritidis, its construction method and the vaccine containing this dual-gene disappearance Salmonella enteritidis | |
| CN105734072A (en) | alr (alanine racemase)-deficient lactobacillus plantarum NC8 | |
| CN114015718B (en) | Soybean Huang Qushe virus infectious cloning vector, construction method and application thereof | |
| CN101948857A (en) | Recombinant lactobacillus casei engineering strain and preparation method thereof | |
| CN104498417A (en) | Streptococcus suis chorismate-synthase gene deletion strain, and construction method and application thereof | |
| CN107513502A (en) | A kind of botrytis cinerea mutant strain Δ bcscd1 and its construction method for producing pillar spore ketone | |
| CN105624078B (en) | One plant of attenuation Salmonella choleraesuls and its preparation method and application | |
| CN108754019B (en) | Amplification method of porcine epidemic diarrhea virus ORF1 gene complete sequence | |
| CN107083375B (en) | Medium-temperature alpha-amylase and gene and application thereof | |
| CN106754592B (en) | Streptococcus suis 2-type Rex gene knockout mutant strain SS2-1 Δ Rex and its construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170308 Termination date: 20211029 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |