CN105462907A - Attenuation salmonella typhimurium and construction method and application - Google Patents
Attenuation salmonella typhimurium and construction method and application Download PDFInfo
- Publication number
- CN105462907A CN105462907A CN201510726833.0A CN201510726833A CN105462907A CN 105462907 A CN105462907 A CN 105462907A CN 201510726833 A CN201510726833 A CN 201510726833A CN 105462907 A CN105462907 A CN 105462907A
- Authority
- CN
- China
- Prior art keywords
- primer
- pya4278
- salmonella typhimurium
- homology arm
- rfbk
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides an attenuation Salmonella typhimurium S116. The attenuation Salmonella typhimurium S116 has no rfbK or cpsG genes. The classification and name of the attenuation strain is Salmonella typhimurium S116, the attenuation Salmonella typhimurium S116 is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC M 2015635, and the preservation date is October 23rd, 2015. The invention further provides a construction method of the attenuation Salmonella typhimurium. The construction method comprises the following steps that a suicide plasmid mediated homologous recombination method is utilized for knocking rfbK or rfbM genes and cpsG or cpsB genes out of attenuation Salmonella typhimurium bacterial genomes, and a mutant strain without rfbK or rfbM genes and cpsG or cpsB genes is obtained. The invention further provides application of the attenuation Salmonella typhimurium S116 in vaccines.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to attenuated salmonella typhimurium and construction process thereof and application.
Background technology
Lipopolysaccharides (Lipopolysaccharide, LPS) be moiety important on most of Gram-negative bacteria adventitia, it is the important virulence factor of bacterium, with regard to Salmonella typhimurium, complete LPS invades host cell to it, and be present in various types of cells (as DC cell with the form stable of sramana's corpusculum (Salmonella-containingvacuole (SCV)), scavenger cell) etc. play a part important promotion, it is directly connected to the infection ability of pathogenic bacterium to host.CA is a kind of sugar unit polycomplex being similar to O antigen; usually only under bacterium meets with unfavourable condition; as low temperature, hypotonic, lack nutritive substance etc.; just can be induced and great expression; and be mainly distributed in outside born of the same parents, form the main component of biofilm, protection is play a part to bacterium and supports; freely what sometimes can loosen is connected with bacterial outer membrane, and O antigen and lipidA can be replaced once in a while to carry out being connected to form a kind of new composition M
lPS.The virulence factor of CA and Salmonellas has nothing to do, and immunogenicity is extremely low, but there are some researches show, the disappearance of CA contributes to attenuation salmonella vaccine and produces more for the immune antibody of its exogenous antigen sent, excite better immune response, especially mucosa-immune, is conducive to the further exploitation of attenuation salmonella vaccine.
Generally speaking; the attenuation salmonella vaccine that one strain is desirable or the carrier sending exogenous antigen should be attenuation while, remain with opposing host hydrochloric acid in gastric juice, the cholate suitable with wild strain and successfully can adhere to, invade intestinal epithelial cells and then can surely grow in shallow-layer and the adenoid ability of deep layer; excite host to produce corresponding immune response, play corresponding immanoprotection action.
But for Salmonella typhimurium, in LPS, the biosynthetic metabolism approach of O antigen is once be obstructed, and its virulence can weaken greatly, all kinds of resistibilitys of attenuated strain to host will decline simultaneously, and then have a strong impact on bacterial immune response level; Therefore how to find and the immunne response level of obtained strains can be made unaffected, and the good mouse injury Salmonellas of attenuating effects is an important and problem demanding prompt solution.
Summary of the invention
The object of the present invention is to provide a strain attenuated salmonella typhimurium SalmonellatypimuriumS116, it is characterized in that, described attenuated salmonella typhimurium SalmonellatypimuriumS116 lacks rfbK and cpsG gene; The Classification And Nomenclature of described attenuated strain is SalmonellatypimuriumS116, be preserved in China typical culture collection center (Wuhan University) China typical culture collection center of Luo Jia Shan, wuchang, wuhan, preserving number is CCTCCM2015635, and the preservation time is: on October 23rd, 2015.
And in the present invention, obtained strains has lacked rfbK and cpsG gene, it all can produce phosphomamlose carbohydrase, all can participate in the biosynthesizing of mannose monosaccharide in O antigen poly sugar chain, so, after disappearance falls rfbK and cpsG gene, LPS and CA of Salmonella typhimurium all can not normally synthesize, and bacterium more can had a strong impact in the face of all kinds of resistivities from host body.But the present inventor finds only to need simple substratum in vitro to add seminose, just can make can synthesize complete LPS and CA normally during its growth in vitro, like this can while Salmonella typhimurium carry out effective attenuation, maintain its corresponding resistibility to host.
The present inventor gropes through a large amount of experiments, and Late Cambrian is in the biosynthetic process of Salmonella typhimurium O antigen, cpsG and the cpsB gene participating in CA synthesis functionally can the gene function of complete complementary rfbK and rfbM.Therefore, the synthesis that can block Salmonellas LPS and CA is completely lacked while rfbK and cpsG gene or rfbM and cpsB gene.Additionally during the vitro culture stage be in early days added to seminose, attenuated salmonella typhimurium just can utilize external seminose to synthesize complete LPS and CA, makes bacterium possess the ability of the opposing host survival pressure the same with wild strain at the infection host initial stage.After bacterial colonization enters host body, due to the shortage of seminose in body, LPS and CA just not resynthesis, virulence is significantly reduced.
Therefore, those skilled in the art should be appreciated that the mutant strain simultaneously lacking rfbM and cpsB gene, have good attenuating effects equally.
Second object of the present invention is the construction process providing above-mentioned attenuated salmonella typhimurium, and this construction process comprises the steps:
Utilize the methods of homologous recombination that suicide plasmid mediates, by the rfbK gene in Salmonella typhimurium bacterial genomes and cpsG gene or rfbM gene and cpsB gene knockout, obtain not containing rfbK gene and cpsG gene or the mutant strain not containing rfbM gene and cpsB gene.
The methods of homologous recombination of described suicide plasmid mediation comprises the steps:
(1) suicide plasmid pYA4278-rfbK or pYA4278-rfbM is built; PYA4278-cpsG or pYA4278-cpsB;
(2) step (1) gained suicide plasmid electricity is transduceed into λ pir intestinal bacteria, and carry out nature mixed culture with Salmonella typhimurium, suicide plasmid is transferred in Salmonella typhimurium from intestinal bacteria, and carry out intersecting interworking with the homology region in Salmonella typhimurium genome, whole suicide plasmid is finally made to be integrated in the middle of genome, through Cm+ resistance screening, obtain the positive colony bacterium after first time homologous recombination;
(3) (be not with Cm+ resistance) in LB liquid medium to continue to cultivate positive colony bacterium, the generation second time homologous recombination making it spontaneous, with containing 10% sucrose and the solid medium of non-sodium chloride-containing screening, obtain clone Chloramphenicol-sensitive being had to resistance to sucrose;
(4) obtained not containing rfbK and cpsG gene or not containing the mutant strain of rfbM and cpsG gene by PCR screening.
Described suicide plasmid pYA4278-rfbK; PYA4278-cpsG; The construction step of pYA4278-rfbM and pYA4278-cpsB is as follows:
The structure of the suicide plasmid pYA4278-rfbK containing rfbK gene upstream and downstream homology arm:
According to the Salmonella typhimurium UK-1 whole genome sequence that NCBIGenbank announces, sequence number is: CP002614, the upstream homology arm of design amplification rfbK gene and the primer sequence of downstream homology arm, uses SnapGene software design following primer:
DrfbK-1F:5’ACAGACGCTTTACTGGTGGC3’
DrfbK-1R:5’CCTCTGACCTTAACTACGTTCATTAGTCC3’
DrfbK-2F:5’ACGTAGTTAAGGTCAGAGGGTGAGGATTA3’
DrfbK-2R:5’AACGCTATCAGAGCCAAATC3’
Extraction is in logarithmic phase S100 genomic dna as template, utilize primer DrfbK-1F and DrfbK-1R, carry out pcr amplification, obtain upstream homology arm product, recycling primer DrfbK-2F and DrfbK-2R increases, obtain downstream homology arm product, finally utilize primer DrfbK-1F and DrfbK-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-rfbK, recombinant plasmid is proceeded to the λ pir intestinal bacteria needing DAP to grow to carry out the structure of follow-up mutant strain,
The structure of the suicide plasmid pYA4278-cpsG containing cpsG gene upstream and downstream homology arm:
According to the Salmonella typhimurium UK-1 whole genome sequence that NCBIGenbank announces, sequence number is: CP002614, the upstream homology arm of design amplification cpsG gene and the primer sequence of downstream homology arm, uses SnapGene software design following primer:
DcpsG-1F:5’ACATGCACCGCGAGGTTTAC3’
DcpsG-1R:5’TCTGACGTTATTACCGGGCATAATTGCAGGCG3’
DcpsG-2F:5’GCCCGGTAATAACGTCAGATCTCCCCTTACCG3’
DcpsG-2R:5’GCCAGGTGGCGAGGCGGTTG3’
Extraction is in logarithmic phase S100 genomic dna as template, utilize primer DcpsG-1F and DcpsG-1R, carry out pcr amplification, obtain upstream homology arm product, recycling primer DcpsG-2F and DcpsG-2R increases, obtain downstream homology arm product, finally utilize primer DcpsG-1F and DcpsG-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-cpsG, recombinant plasmid is proceeded to the λ pir intestinal bacteria needing DAP to grow to carry out the structure of follow-up mutant strain.
The structure of the suicide plasmid pYA4278-rfbM containing rfbM gene upstream and downstream homology arm:
According to the Salmonella typhimurium UK-1 whole genome sequence that NCBIGenbank announces, sequence number is: CP002614, the upstream homology arm of design amplification rfbM gene and the primer sequence of downstream homology arm, uses SnapGene software design following primer:
DrfbM-1F:5’GCTGCCTATCGCCGTTCCG3’
DrfbM-1R:5’GGTGCGCCCAATCCAGCCGCCAGCCATAATTACGGGAAGAAAAGACAT3’
DrfbM-2F:5’TGGATTGGGCGCACCCGTTCTGGATTTTCGAAGGAGTGGAC3’
DrfbM-2R:5’GGATCGCAGCCTCATCATG3’
Extraction is in logarithmic phase S100 genomic dna as template, utilize primer DrfbM-1F and DrfbM-1R, carry out pcr amplification, obtain upstream homology arm product, recycling primer DrfbM-2F and DrfbM-2R increases, obtain downstream homology arm product, finally utilize primer DrfbM-1F and DrfbM-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-rfbM, recombinant plasmid is proceeded to the λ pir intestinal bacteria needing DAP to grow to carry out the structure of follow-up mutant strain,
Containing the structure of cpsB because of the suicide plasmid pYA4278-cpsB of upstream and downstream homology arm:
According to the Salmonella typhimurium UK-1 whole genome sequence that NCBIGenbank announces, sequence number is: CP002614, the upstream homology arm of design amplification cpsB gene and the primer sequence of downstream homology arm, uses SnapGene software design following primer:
DcpsB-1F:5’CGCGGAACGATTACGCGATCG3’
DcpsB-1R:5’CGGCTTATCCGTAGGACGTCATCCCCGAATATCTGCAATAAATTGGCG3’
DcpsB-2F:5’CGTCCTACGGATAAGCCGCGCCTGCAATTATGCCCGGTAAGC3’
DcpsB-2R:5’CGCGCACCAGCTTCATACCG3’
Extraction is in logarithmic phase S100 genomic dna as template, utilize primer DcpsB-1F and DcpsB-1R, carry out pcr amplification, obtain upstream homology arm product, recycling primer DcpsB-2F and DcpsB-2R increases, obtain downstream homology arm product, finally utilize primer DcpsB-1F and DcpsB-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-cpsG, recombinant plasmid is proceeded to the λ pir intestinal bacteria needing DAP to grow to carry out the structure of follow-up mutant strain.
The λ pir intestinal bacteria and Salmonella typhimurium that proceed to restructuring suicide plasmid are carried out nature mixed culture, suicide plasmid is transferred in Salmonella typhimurium from intestinal bacteria, because restructuring suicide plasmid is with special replicon, independently self-replacation survival can not be carried out in Salmonellas, but can carry out intersecting interworking with the homology region in Salmonella typhimurium genome, whole suicide plasmid is finally made to be integrated in the middle of genome, screen through the solid medium not containing DAP but containing chlorampenicol resistant, obtain the positive colony bacterium after first time homologous recombination, in LB liquid medium, (be not with Cm+ resistance) continue to cultivate positive colony bacterium, the generation second time homologous recombination making it spontaneous, with containing 10% sucrose and the solid medium of non-sodium chloride-containing screening, obtain clone Chloramphenicol-sensitive being had to resistance to sucrose,
Use our structure of the method for homologous recombination to obtain the Typhic Salmonella lines lacking rfbK and cpsG gene, and disappearance have the Typhic Salmonella lines of rfbM and cpsB gene.
Present invention also offers the application of attenuated salmonella typhimurium SalmonellatypimuriumS116 on vaccine.
Beneficial effect of the present invention:
1) gained attenuated strain has lacked rfbK and cpsG gene, has obvious attenuating effects;
2) obtained strains of the present invention, can in vitro cultivation stage time add seminose, make Salmonellas can normally synthesize complete LPS and CA in vitro, keep the ability of the opposing host gastrointestinal tract interior severe living environment suitable with wild strain and invade the adenoid colonization ability of intestinal epithelial cells and shallow-layer and deep layer normally; After Salmonellas grows host body surely, due to the shortage of seminose in host, the O antigen in Salmonellas LPS and CA biosynthesis block, bacterium is able to slowly effective attenuation, and then produces permanent and lasting immunne response ability; Under the condition lacking seminose; bacterial outer membrane LPS is no longer connected with complete O antigen; this just make originally not easily the immunogenic conservative property outer membrane protein that has that identifies by host body immunity system be able to manyly to expose more fully, and then produce better immune protective effect.
Accompanying drawing explanation
Fig. 1 be the present invention be correlated with PCR identify electrophorogram, wherein, A be S100 Δ rfbK mutant strain in the present invention PCR identify electrophoresis result, M represents MarkerIII, and 1 represents mutant strain 2 represents wild strain; B is that the PCR of S100 Δ cpsG mutant strain in the present invention identifies electrophoresis result, and M represents MarkerIII, and 1 represents mutant strain 2 represents wild strain; C is that the PCR of S100 Δ rfbK Δ cpsG mutant strain in the present invention identifies electrophoresis result, and M represents MarkerIII, and 1 and 3 represent mutant strain, and 2 and 4 represent wild strain;
Fig. 2 is that the LPS phenotype of S100 Δ rfbK, S100 Δ cpsG of the present invention and S100 Δ rfbK Δ cpsG mutant strain and LPS cover phenotype and western result figure; Wherein, A is LPS phenotype and the LPS covering phenotype of S100 Δ rfbK, S100 Δ cpsG and S100 Δ rfbK Δ cpsG mutant strain in the present invention, 1:S100,2:S100 Δ rfbK in figure, 3:S100 Δ cpsG, 4:S100 Δ rfbK Δ cpsG; 5:S100 Δ rfbK (p15a-rfbK); 6:S100 Δ rfbK (p15a-cpsG); 7:S100 Δ rfbK Δ cpsG (p15a-rfbK); 8:S100 Δ rfbK Δ cpsG (p15a-cpsG); B schemes corresponding western to scheme with A in the present invention, 1:S100,2:S100 Δ rfbK in figure, 3:S100 Δ cpsG, 4:S100 Δ rfbK Δ cpsG; 5:S100 Δ rfbK (p15a-rfbK); 6:S100 Δ rfbK (p15a-cpsG); 7:S100 Δ rfbK Δ cpsG (p15a-rfbK); 8:S100 Δ rfbK Δ cpsG (p15a-cpsG).
Fig. 3 be the present invention be correlated with PCR identify electrophorogram, wherein, A be S100 Δ rfbM mutant strain in the present invention PCR identify electrophoresis result, M represents MarkerIII, and 1 represents mutant strain 2 represents wild strain; B is that the PCR of S100 Δ cpsB mutant strain in the present invention identifies electrophoresis result, and M represents MarkerIII, and 1 represents mutant strain 2 represents wild strain; C is that the PCR of S100 Δ rfbM Δ cpsB mutant strain in the present invention identifies electrophoresis result, and M represents MarkerIII, and 1 and 3 represent mutant strain, and 2 and 4 represent wild strain;
Fig. 4 is that in the present invention, S100 Δ rfbM, S100 Δ cpsB and S100 Δ rfbM Δ cpsB mutant strain LPS phenotype and LPS cover phenotype and western result figure; Wherein, A is LPS phenotype and the LPS covering phenotype of S100 Δ rfbM, S100 Δ cpsB and S100 Δ rfbM Δ cpsB mutant strain in the present invention, 1:S100,2:S100 Δ cpsB in figure, 3:S100 Δ rfbM, 4:S100 Δ rfbM Δ cpsB; 5:S100 Δ rfbM Δ cpsB (p15a-cpsB); B schemes corresponding western to scheme with A in the present invention, 1:S100,2:S100 Δ rfbM in figure, 3:S100 Δ cpsB, 4:S100 Δ rfbM Δ cpsB; 5:S100 Δ rfbM Δ cpsB (p15a-cpsB).
Embodiment
Below by embodiment, the present invention is specifically described; what be necessary to herein means out is that following examples are just for being further detailed the present invention; limiting the scope of the invention can not be interpreted as; some nonessential improvement and adjustment that the person skilled in the art in this field makes according to foregoing invention content, still belong to protection scope of the present invention.
Embodiment 1
1, rfbK design of primers
According to the Salmonella typhimurium UK-1 whole genome sequence (sequence number: CP002614) that NCBIGenbank announces, design two pairs of primers to increase respectively the upstream and downstream homology arm of rfbK gene, amplified fragments size is respectively 462bp, 340bp, above-mentioned primer is by the synthesis of Beijing Hua Da genome company, and primer sequence is as follows:
DrfbK-1F:5’ACAGACGCTTTACTGGTGGC3’
DrfbK-1R:5’CCTCTGACCTTAACTACGTTCATTAGTCC3’
DrfbK-2F:5’ACGTAGTTAAGGTCAGAGGGTGAGGATTA3’
DrfbK-2R:5’AACGCTATCAGAGCCAAATC3’
2, the amplification of the upstream and downstream homology arm of rfbK gene and fusion
The mono-bacterium colony of picking Salmonella typhimurium S100 is incubated overnight (37 DEG C, 180rpm) in 5mLLB liquid nutrient medium, and with the bacterial genomes extraction agent box of Tian Gen biochemical technology company limited, operation steps to specifications carries out genome extracting.
Pcr amplification reaction carries out in the system of 20 μ L, and reaction system is as follows: template DNA 0.4 μ L, 2 × primeSTARMax (precious biological company limited) 10 μ L, upstream primer 0.4 μ L, downstream primer 0.4 μ L, ddH
2o8.8 μ L.
Amplification condition is: enter circulation after 98 DEG C of sex change 2min, and loop parameter is 98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 20sec.After 30 circulations, 72 DEG C extend 5min.Amplification PCR primer through 1% agarose gel electrophoresis analysis, two clip size that increases are respectively 462bp and 340bp, with expect size conform to.
The fusion of upstream and downstream homology arm: purify with the DNA of Tian Gen biochemical technology company limited and reclaim test kit, the product of upstream and downstream homology arm is mixed laggard performing PCR liquid to reclaim, with above-mentioned recovery product for template, utilize primer DrfbK-1F and DrfbK-2R with same system and amplification condition before under increase, obtain the fusion fragment that size is about 800bp.
3, the structure of pYA4278-rfbK suicide plasmid
Fusion fragment is carried out adding A(A base) process.Utilize the plusA reaction kit of Tian Gen biochemical technology company limited, reaction system is: template 15 μ L, plusAbuffer4 μ L, Taq enzyme 1 μ L; Reaction conditions is: 72 DEG C of 30min.
The preparation of suicide plasmid pYA4278 endonuclease bamhi: incubated overnight, containing the Host Strains of pYA4278 plasmid, is got 4ml bacterium liquid, utilized the plasmid extraction kit of Tian Gen biochemical technology company limited to carry out plasmid extraction, finally use the ddH of 50ul
2o carries out wash-out, carries out enzyme cut at the AhdI enzyme of NEBCutSmart10Xbuffer and 1ul adding 6ul, reclaims carrier pYA4278.
Be connected by the pYA4278 plasmid T4DNAligase of fusion fragment after cutting through enzyme adding A process, 16 DEG C of water-baths are spent the night, and are transformed into λ pir competent escherichia coli cell, treat that it grows the qualification of laggard performing PCR, obtain positive restructuring suicide plasmid pYA4278-rfbK.Checking order being sent to the handsome Bioisystech Co., Ltd in Shanghai after plasmid extraction, confirming that the suicide plasmid built is correct.
4, the Construction and identification of S100 Δ rfbK mutant strain
The restructuring suicide plasmid pYA4278-rfbK built is converted in λ pir coli strain (this bacterial strain has lacked asd gene, DAP is needed to grow, screening for follow-up conjugal transfer), the λ pir intestinal bacteria and Salmonella typhimurium S100 that carry suicide plasmid pYA4278-rfbK are carried out conjugal transfer, the LB flat board of chlorampenicol resistant screens positive bacteria fall, positive bacteria is dropped on and does not cultivate propagation containing in the LB liquid nutrient medium of chlorampenicol resistant, finally dilute the sucrose plate of painting 10%, 10% sucrose plate screens the bacterium colony of resistance to sucrose, and picking list bacterium colony carries out PCR qualification.
PCR identifies: with bacterium colony to be checked for template, carry out pcr amplification with primer DrfbK-1F/DrfbK-2R.After bacterial strain disappearance rfbK, primer DrfbK-1F/DrfbK-2R amplified production size is the size (802bp) that upstream and downstream homology arm merges.If do not lack successfully, PCR primer stripe size is 2273bp.As a result, gene-deleted strain PCR identifies that stripe size conforms to theory, shows that rfbK gene-deleted strain successfully constructs.By mutant strain called after S100 Δ rfbK, as Figure 1A.
Embodiment 2
1, cpsG design of primers
According to the Salmonella typhimurium UK-1 whole genome sequence (sequence number is: CP002614) that NCBIGenbank announces, design two pairs of primers to increase respectively the upstream and downstream homology arm of cpsG gene, amplified fragments size is respectively 369bp, 393bp, above-mentioned primer is by the synthesis of Beijing Hua Da genome company, and primer sequence is as follows:
DcpsG-1F:5’ACATGCACCGCGAGGTTTAC3’
DcpsG-1R:5’TCTGACGTTATTACCGGGCATAATTGCAGGCG3’
DcpsG-2F:5’GCCCGGTAATAACGTCAGATCTCCCCTTACCG3’
DcpsG-2R:5’GCCAGGTGGCGAGGCGGTTG3’
2, the amplification of the upstream and downstream homology arm of cpsG gene and fusion
The mono-bacterium colony of picking Salmonella typhimurium S100 is incubated overnight (37 DEG C, 180rpm) in 5mLLB liquid nutrient medium, and with the bacterial genomes extraction agent box of Tian Gen biochemical technology company limited, operation steps to specifications carries out genome extracting.
Pcr amplification reaction carries out in the system of 20 μ L, and reaction system is as follows: template DNA 0.4 μ L, 2 × primeSTARMax (precious biological company limited) 10 μ L, upstream primer 0.4 μ L, downstream primer 0.4 μ L, ddH
2o8.8 μ L.
Amplification condition is: enter circulation after 98 DEG C of sex change 2min, and loop parameter is 98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 20sec.After 30 circulations, 72 DEG C extend 5min.Amplification PCR primer through 1% agarose gel electrophoresis analysis, two clip size that increases are respectively 369bp and 393bp, with expect size conform to.
The fusion of upstream and downstream homology arm: purify with the DNA of Tian Gen biochemical technology company limited and reclaim test kit, the product of upstream and downstream homology arm is mixed laggard performing PCR liquid to reclaim, with above-mentioned recovery product for template, utilize primer DcpsG-1F and DcpsG-2R with same system and amplification condition before under increase, obtain the fusion fragment that size is about 750bp.
3, the structure of pYA4278-cpsG suicide plasmid
Fusion fragment is carried out adding A(A base) process.Utilize the plusA reaction kit of Tian Gen biochemical technology company limited, reaction system is: template 15 μ L, plusAbuffer4 μ L, Taq enzyme 1 μ L; Reaction conditions is: 72 DEG C of 30min.
The preparation of suicide plasmid pYA4278 endonuclease bamhi: incubated overnight, containing the Host Strains of pYA4278 plasmid, is got 4ml bacterium liquid, utilized the plasmid extraction kit of Tian Gen biochemical technology company limited to carry out plasmid extraction, finally use the ddH of 50ul
2o carries out wash-out, carries out enzyme cut at the AhdI enzyme of NEBCutSmart10Xbuffer and 1ul adding 6ul, reclaims carrier pYA4278.
Be connected by the pYA4278 plasmid T4DNAligase of fusion fragment after cutting through enzyme adding A process, 16 DEG C of water-baths are spent the night, and are transformed into λ pir competent escherichia coli cell, treat that it grows the qualification of laggard performing PCR, obtain positive restructuring suicide plasmid pYA4278-cpsG.Checking order being sent to the handsome Bioisystech Co., Ltd in Shanghai after plasmid extraction, confirming that the suicide plasmid built is correct.
4, the Construction and identification of S100 Δ cpsG mutant strain
The restructuring suicide plasmid pYA4278-cpsG built is converted in λ pir coli strain (this bacterial strain has lacked asd gene, DAP is needed to grow, screening for follow-up conjugal transfer), the λ pir intestinal bacteria and Salmonella typhimurium S100 that carry suicide plasmid pYA4278-cpsG are carried out conjugal transfer, the LB flat board of chlorampenicol resistant screens positive bacteria fall, positive bacteria is dropped on and does not cultivate propagation containing in the LB liquid nutrient medium of chlorampenicol resistant, finally dilute the sucrose plate of painting 10%, 10% sucrose plate screens the bacterium colony of resistance to sucrose, and picking list bacterium colony carries out PCR qualification.
PCR identifies: with bacterium colony to be checked for template, carry out pcr amplification with primer DcpsG-1F/DcpsG-2R.After bacterial strain disappearance cpsG, primer DcpsG-1F/DcpsG-2R amplified production size is the size (759bp) that upstream and downstream homology arm merges.If do not lack successfully, PCR primer stripe size is 2218bp.As a result, gene-deleted strain PCR identifies that stripe size conforms to theory, as Figure 1B.Show that cpsG gene-deleted strain successfully constructs.By mutant strain called after S100 Δ cpsG.
Embodiment 3
1, rfbM design of primers
According to the Salmonella typhimurium UK-1 whole genome sequence (sequence number: CP002614) that NCBIGenbank announces, design two pairs of primers to increase respectively the upstream and downstream homology arm of rfbM gene, amplified fragments size is respectively 495bp, 440bp, above-mentioned primer is by the synthesis of Beijing Hua Da genome company, and primer sequence is as follows:
DrfbM-1F:5’GCTGCCTATCGCCGTTCCG3’
DrfbM-1R:5’GGTGCGCCCAATCCAGCCGCCAGCCATAATTACGGGAAGAAAAGACAT3’
DrfbM-2F:5’TGGATTGGGCGCACCCGTTCTGGATTTTCGAAGGAGTGGAC3’
The amplification of the upstream and downstream homology arm of DrfbM-2R:5 ' GGATCGCAGCCTCATCATG3 ' 2, rfbK gene and fusion
The mono-bacterium colony of picking Salmonella typhimurium S100 is incubated overnight (37 DEG C, 180rpm) in 5mLLB liquid nutrient medium, and with the bacterial genomes extraction agent box of Tian Gen biochemical technology company limited, operation steps to specifications carries out genome extracting.
Pcr amplification reaction carries out in the system of 20 μ L, and reaction system is as follows: template DNA 0.4 μ L, 2 × primeSTARMax (precious biological company limited) 10 μ L, upstream primer 0.4 μ L, downstream primer 0.4 μ L, ddH
2o8.8 μ L.
Amplification condition is: enter circulation after 98 DEG C of sex change 2min, and loop parameter is 98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec.After 30 circulations, 72 DEG C extend 5min.Amplification PCR primer through 1% agarose gel electrophoresis analysis, two clip size that increases are respectively 495bp and 440bp, with expect size conform to.
The fusion of upstream and downstream homology arm: purify with the DNA of Tian Gen biochemical technology company limited and reclaim test kit, the product of upstream and downstream homology arm is mixed laggard performing PCR liquid to reclaim, with above-mentioned recovery product for template, utilize primer DrfbM-1F and DrfbM-2R with same system and amplification condition before under increase, obtain the fusion fragment that size is about 900bp.
3, the structure of pYA4278-rfbM suicide plasmid
Fusion fragment is carried out adding A(A base) process.Utilize the plusA reaction kit of Tian Gen biochemical technology company limited, reaction system is: template 15 μ L, plusAbuffer4 μ L, Taq enzyme 1 μ L; Reaction conditions is: 72 DEG C of 30min.
The preparation of suicide plasmid pYA4278 endonuclease bamhi: incubated overnight, containing the Host Strains of pYA4278 plasmid, is got 4ml bacterium liquid, utilized the plasmid extraction kit of Tian Gen biochemical technology company limited to carry out plasmid extraction, finally use the ddH of 50ul
2o carries out wash-out, carries out enzyme cut at the AhdI enzyme of NEBCutSmart10Xbuffer and 1ul adding 6ul, reclaims carrier pYA4278.
Be connected by the pYA4278 plasmid T4DNAligase of fusion fragment after cutting through enzyme adding A process, 16 DEG C of water-baths are spent the night, and are transformed into λ pir competent escherichia coli cell, treat that it grows the qualification of laggard performing PCR, obtain positive restructuring suicide plasmid pYA4278-rfbM.Checking order being sent to the handsome Bioisystech Co., Ltd in Shanghai after plasmid extraction, confirming that the suicide plasmid built is correct.
4, the Construction and identification of S100 Δ rfbM mutant strain
The restructuring suicide plasmid pYA4278-rfbM built is converted in λ pir coli strain (this bacterial strain has lacked asd gene, DAP is needed to grow, screening for follow-up conjugal transfer), the λ pir intestinal bacteria and Salmonella typhimurium S100 that carry suicide plasmid pYA4278-rfbM are carried out conjugal transfer, the LB flat board of chlorampenicol resistant screens positive bacteria fall, positive bacteria is dropped on and does not cultivate propagation containing in the LB liquid nutrient medium of chlorampenicol resistant, finally dilute the sucrose plate of painting 10%, 10% sucrose plate screens the bacterium colony of resistance to sucrose, and picking list bacterium colony carries out PCR qualification.
PCR identifies: with bacterium colony to be checked for template, carry out pcr amplification with primer DrfbM-1F/DrfbM-2R.After bacterial strain disappearance rfbM, primer DrfbM-1F/DrfbM-2R amplified production size is the size (935bp) that upstream and downstream homology arm merges.If do not lack successfully, PCR primer stripe size is 2273bp.As a result, gene-deleted strain PCR identifies that stripe size conforms to theory, shows that rfbM gene-deleted strain successfully constructs.By mutant strain called after S100 Δ rfbM, as Fig. 3 A.
Embodiment 4
1, cpsB design of primers
According to the Salmonella typhimurium UK-1 whole genome sequence (sequence number is: CP002614) that NCBIGenbank announces, design two pairs of primers to increase respectively the upstream and downstream homology arm of cpsB gene, amplified fragments size is respectively 469bp, 444bp, above-mentioned primer is by the synthesis of Beijing Hua Da genome company, and primer sequence is as follows:
DcpsB-1F:5’CGCGGAACGATTACGCGATCG3’
DcpsB-1R:5’CGGCTTATCCGTAGGACGTCATCCCCGAATATCTGCAATAAATTGGCG3’
DcpsB-2F:5’CGTCCTACGGATAAGCCGCGCCTGCAATTATGCCCGGTAAGC3’
DcpsB-2R:5’CGCGCACCAGCTTCATACCG3’
2, the amplification of the upstream and downstream homology arm of cpsB gene and fusion
The mono-bacterium colony of picking Salmonella typhimurium S100 is incubated overnight (37 DEG C, 180rpm) in 5mLLB liquid nutrient medium, and with the bacterial genomes extraction agent box of Tian Gen biochemical technology company limited, operation steps to specifications carries out genome extracting.
Pcr amplification reaction carries out in the system of 20 μ L, and reaction system is as follows: template DNA 0.4 μ L, 2 × primeSTARMax (precious biological company limited) 10 μ L, upstream primer 0.4 μ L, downstream primer 0.4 μ L, ddH
2o8.8 μ L.
Amplification condition is: enter circulation after 98 DEG C of sex change 2min, and loop parameter is 98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec.After 30 circulations, 72 DEG C extend 5min.Amplification PCR primer through 1% agarose gel electrophoresis analysis, two clip size that increases are respectively 469bp and 444bp, with expect size conform to.
The fusion of upstream and downstream homology arm: purify with the DNA of Tian Gen biochemical technology company limited and reclaim test kit, the product of upstream and downstream homology arm is mixed laggard performing PCR liquid to reclaim, with above-mentioned recovery product for template, utilize primer DcpsB-1F and DcpsB-2R with same system and amplification condition before under increase, obtain the fusion fragment that size is about 913bp.
3, the structure of pYA4278-cpsB suicide plasmid
Fusion fragment is carried out adding A(A base) process.Utilize the plusA reaction kit of Tian Gen biochemical technology company limited, reaction system is: template 15 μ L, plusAbuffer4 μ L, Taq enzyme 1 μ L; Reaction conditions is: 72 DEG C of 30min.
The preparation of suicide plasmid pYA4278 endonuclease bamhi: incubated overnight, containing the Host Strains of pYA4278 plasmid, is got 4ml bacterium liquid, utilized the plasmid extraction kit of Tian Gen biochemical technology company limited to carry out plasmid extraction, finally use the ddH of 50ul
2o carries out wash-out, carries out enzyme cut at the AhdI enzyme of NEBCutSmart10Xbuffer and 1ul adding 6ul, reclaims carrier pYA4278.
Be connected by the pYA4278 plasmid T4DNAligase of fusion fragment after cutting through enzyme adding A process, 16 DEG C of water-baths are spent the night, and are transformed into λ pir competent escherichia coli cell, treat that it grows the qualification of laggard performing PCR, obtain positive restructuring suicide plasmid pYA4278-cpsB.Checking order being sent to the handsome Bioisystech Co., Ltd in Shanghai after plasmid extraction, confirming that the suicide plasmid built is correct.
4, the Construction and identification of S100 Δ cpsB mutant strain
The restructuring suicide plasmid pYA4278-cpsB built is converted in λ pir coli strain (this bacterial strain has lacked asd gene, DAP is needed to grow, screening for follow-up conjugal transfer), the λ pir intestinal bacteria and Salmonella typhimurium S100 that carry suicide plasmid pYA4278-cpsB are carried out conjugal transfer, the LB flat board of chlorampenicol resistant screens positive bacteria fall, positive bacteria is dropped on and does not cultivate propagation containing in the LB liquid nutrient medium of chlorampenicol resistant, finally dilute the sucrose plate of painting 10%, 10% sucrose plate screens the bacterium colony of resistance to sucrose, and picking list bacterium colony carries out PCR qualification.
PCR identifies: with bacterium colony to be checked for template, carry out pcr amplification with primer DcpsB-1F/DcpsB-2R.After bacterial strain disappearance cpsB, primer DcpsB-1F/DcpsB-2R amplified production size is the size (913bp) that upstream and downstream homology arm merges.If do not lack successfully, PCR primer stripe size is 2352bp.As a result, gene-deleted strain PCR identifies that stripe size conforms to theory, as Fig. 3 B.Show that cpsB gene-deleted strain successfully constructs.By mutant strain called after S100 Δ cpsB.
Embodiment 5
The Construction and identification of attenuated salmonella typhimurium SalmonellatypimuriumS116
The λ pir intestinal bacteria and Salmonella typhimurium S100 Δ rfbK that carry suicide plasmid pYA4278-cpsG are carried out conjugal transfer, the LB flat board of chlorampenicol resistant screens positive bacteria fall, positive bacteria is dropped on and does not cultivate propagation containing in the LB liquid nutrient medium of chlorampenicol resistant, 10% sucrose plate screens the bacterium colony of resistance to sucrose, and picking list bacterium colony carries out PCR qualification.
PCR identifies: with bacterium colony to be checked for template, carry out pcr amplification with primer DrfbK-1F/DrfbK-2R and DcpsG-1F/DcpsG-2R.After bacterial strain disappearance rfbK, primer DrfbK-1F/DrfbK-2R amplified production size is the size (802bp) that upstream and downstream homology arm merges, if do not lack successfully, PCR primer stripe size is 2273bp; After bacterial strain disappearance cpsG gene, primer DcpsG-1F/DcpsG-2R amplified production size is the size (759bp) that upstream and downstream homology arm merges.If do not lack successfully, PCR primer stripe size is 2218bp.PCR primer is through 1% agarose electrophoresis, and gene-deleted strain stripe size conforms to theory, as Fig. 1 C.Show that rfbK, cpsG Gene Double gene-deleted strain successfully constructs, by mutant strain called after SalmonellatypimuriumS116.
Embodiment 6
The Construction and identification of disappearance rfbM and cpsB transgenation strain
The λ pir intestinal bacteria and Salmonella typhimurium S100 Δ rfbM that carry suicide plasmid pYA4278-cpsB are carried out conjugal transfer, the LB flat board of chlorampenicol resistant screens positive bacteria fall, positive bacteria is dropped on and does not cultivate propagation containing in the LB liquid nutrient medium of chlorampenicol resistant, 10% sucrose plate screens the bacterium colony of resistance to sucrose, and picking list bacterium colony carries out PCR qualification.
PCR identifies: with bacterium colony to be checked for template, carry out pcr amplification with primer DrfbmM-1F/DrfbM-2R and DcpsB-1F/DcpsB-2R.After bacterial strain disappearance rfbM, primer DrfbM-1F/DrfbM-2R amplified production size is the size (935bp) that upstream and downstream homology arm merges, if do not lack successfully, PCR primer stripe size is 2300bp; After bacterial strain disappearance cpsG gene, primer DcpsB-1F/DcpsB-2R amplified production size is the size (913bp) that upstream and downstream homology arm merges.If do not lack successfully, PCR primer stripe size is 2352bp.PCR primer is through 1% agarose electrophoresis, and gene-deleted strain stripe size conforms to theory, as Fig. 3 C.Show that rfbM, cpsB Gene Double gene-deleted strain successfully constructs, by mutant strain called after S100 (Δ rfbM Δ cpsB).
Embodiment 7
1.rfbK, cpsG gene-deleted strain LPS phenotype collection of illustrative plates
Sample preparation: picking wild strain S100 and mutant strain S100 (Δ rfbK), S100 (Δ cpsG) and S100 (Δ rfbK Δ cpsG) single bacterium colony incubated overnight in 3mL liquid LB respectively, next day, bacterium liquid surveys OD
600after, the thalline getting equal quantities respectively (generally gets OD
600when being 1, the biomass in 1mL bacterium liquid) in EP pipe, centrifugal (4000rpm, 10min), outwells supernatant, with the resuspended thalline of PBS, more centrifugal, repeated washing 2 times.150 μ L bacterial lysates are added, resuspended and cracking thalline in each EP pipe.After boiling 10min, be cooled to room temperature, centrifugal (12,000rpm, 10min).Get in the EP pipe that supernatant 10 μ L adds containing 90 μ L sample-loading buffers, then add 1 μ L Proteinase K in each EP pipe, fully after mixing, be placed in 37 DEG C of constant incubators and hatch 1h.
SDS-GAGE: after prepared by the separation gel being undertaken 12.5% by filling a prescription and the concentrated glue of 5%, press bacterial strain S100, S100 (Δ rfbK), S100 (Δ cpsG), S100 (Δ rfbK Δ cpsG), S100 (Δ rfbK (p15a-rfbK)), S100 (Δ rfbK (p15a-cpsG)), S100 (Δ rfbK Δ cpsG (p15a-rfbK)), the loading order of S100 (Δ rfbK Δ cpsG (p15a-cpsG)), Xiang Kongzhong adds 10 μ L samples, the sample-loading buffer of equivalent is added in unnecessary hole, complete to electrophoresis to change 120V into after 80V electrophoresis 20min.
Silver dye: the glue after SDS-PAGE is processed in the following order.Fixing: in clean beaker, to add the freshly prepared stationary liquid of 200mL, then the glue after PAGE is put into beaker, after preservative film sealing, be placed on horizontal shaker and fix 4h; Oxidation: after being outwelled by stationary liquid, add freshly prepared oxidation solution in beaker, is placed in horizontal shaker shake 7min; Rinsing: outwell oxidation solution, with 200mL milli-Q water 3 times, 15min/ time; Silver dye: freshly prepared silver-colored dye liquor is added in beaker, horizontal shaker shake 10min; Rinsing: outwell silver-colored dye liquor, with 200mL milli-Q water 3 times, 15min/ time; Development: freshly prepared developing solution is added in beaker, is placed in horizontal shaker, shake limit, limit is observed, and develops to band; Stop: outwell developing solution, add 200mL ultrapure water and stop development; Take a picture: taken out by glue, being positioned in gel imaging system takes a picture preserves.
Western-blot-transferring film (half-dried transfer printing): after electrophoresis, takes out glue, is placed on sheet glass, after measuring size, is invaded and steeps in the glass dish that transferring film liquid is housed.Then cut out thick filter paper and pvdf membrane according to the length of glue and width, the pvdf membrane after cutting out is invaded bubble methyl alcohol 1-2min, and filter paper is invaded and is steeped in transferring film liquid.Stack successively by order from top to bottom: filter paper, pvdf membrane, glue, filter paper.Finally, put it in transferring film instrument and carry out 10V constant voltage transferring film 30min; Close: pvdf membrane is taken out, is placed in glass dish, after 1 × TBST drip wash 3 times, adds freshly prepared confining liquid, be placed in 4 DEG C, close and spend the night; Washing: next day, after being reclaimed by confining liquid, adds 1 × TBST of proper volume, shaken at room temperature rinsing 3 times, 10min/ time in glass dish; Hatch primary antibodie: in 5mL confining liquid (3%BSA), add Salmonellas rabbit source O4 serum in 1:200 ratio, be poured in sample sack after mixing, then the pvdf membrane after washing is put into sample sack, after discharging bubble, sample sack is sealed, is placed on horizontal shaker, incubated at room 1h.Hatch two after washing to resist: in 5mL1 × TBST, add biotin labeled goat anti-rabbit igg two in the ratio of 1:20000 resist, hatch 1h altogether with film.After washing, hatch the Streptavidin of AP mark: the Streptavidin adding AP mark in 5mL1 × TBST in the ratio of 1:1000, hatch 1h altogether with film.Develop the color after washing: take out pvdf membrane, be placed in glass dish.Developer 1 × APbuffer, A liquid, B liquid are added in EP pipe after mixing by the volume of 1000 μ L, 50 μ L, 50 μ L, be added drop-wise on pvdf membrane, lucifuge colour developing manifests to causing band.Take a picture: the pvdf membrane of color development stopping is placed in gel imaging system, photograph saving result.
Above silver dye and western result are respectively as shown in Figure 2 A and 2B.Show that the disappearance of cpsG gene does not affect the synthesis of LPS, the synthesis impact of disappearance on LPS of rfbK gene is comparatively large, but can not block its synthesis completely, sees Fig. 2 B, and lacks while rfbK and cpsG gene, then can block the synthesis of LPS completely.
2.rfbM, cpsB gene-deleted strain LPS phenotype collection of illustrative plates
Sample preparation: picking wild strain S100 and mutant strain S100 (Δ rfbM), S100 (Δ cpsB) and S100 (Δ rfbM Δ cpsB) single bacterium colony incubated overnight in 3mL liquid LB respectively, next day, bacterium liquid surveys OD
600after, the thalline getting equal quantities respectively (generally gets OD
600when being 1, the biomass in 1mL bacterium liquid) in EP pipe, centrifugal (4000rpm, 10min), outwells supernatant, with the resuspended thalline of PBS, more centrifugal, repeated washing 2 times.150 μ L bacterial lysates are added, resuspended and cracking thalline in each EP pipe.After boiling 10min, be cooled to room temperature, centrifugal (12,000rpm, 10min).Get in the EP pipe that supernatant 10 μ L adds containing 90 μ L sample-loading buffers, then add 1 μ L Proteinase K in each EP pipe, fully after mixing, be placed in 37 DEG C of constant incubators and hatch 1h.
SDS-GAGE: after prepared by the separation gel being undertaken 12.5% by filling a prescription and the concentrated glue of 5%, press bacterial strain S100, S100 (Δ cpsB), S100 (Δ rfbM), S100 (Δ rfbM Δ cpsB), S100 (Δ rfbM Δ cpsB (p15a-cpsG)), loading order (silver-colored dye order) or press bacterial strain S100, S100 (Δ rfbM), S100 (Δ cpsB), S100 (Δ rfbM Δ cpsB), the loading order (western order) of S100 (Δ rfbM Δ cpsB (p15a-cpsG)), Xiang Kongzhong adds 10 μ L samples, the sample-loading buffer of equivalent is added in unnecessary hole, complete to electrophoresis to change 120V into after 80V electrophoresis 20min.
Silver dye: the glue after SDS-PAGE is processed in the following order.Fixing: in clean beaker, to add the freshly prepared stationary liquid of 200mL, then the glue after PAGE is put into beaker, after preservative film sealing, be placed on horizontal shaker and fix 4h; Oxidation: after being outwelled by stationary liquid, add freshly prepared oxidation solution in beaker, is placed in horizontal shaker shake 7min; Rinsing: outwell oxidation solution, with 200mL milli-Q water 3 times, 15min/ time; Silver dye: freshly prepared silver-colored dye liquor is added in beaker, horizontal shaker shake 10min; Rinsing: outwell silver-colored dye liquor, with 200mL milli-Q water 3 times, 15min/ time; Development: freshly prepared developing solution is added in beaker, is placed in horizontal shaker, shake limit, limit is observed, and develops to band; Stop: outwell developing solution, add 200mL ultrapure water and stop development; Take a picture: taken out by glue, being positioned in gel imaging system takes a picture preserves.
Western-blot-transferring film (half-dried transfer printing): after electrophoresis, takes out glue, is placed on sheet glass, after measuring size, is invaded and steeps in the glass dish that transferring film liquid is housed.Then cut out thick filter paper and pvdf membrane according to the length of glue and width, the pvdf membrane after cutting out is invaded bubble methyl alcohol 1-2min, and filter paper is invaded and is steeped in transferring film liquid.Stack successively by order from top to bottom: filter paper, pvdf membrane, glue, filter paper.Finally, put it in transferring film instrument and carry out 10V constant voltage transferring film 30min; Close: pvdf membrane is taken out, is placed in glass dish, after 1 × TBST drip wash 3 times, adds freshly prepared confining liquid, be placed in 4 DEG C, close and spend the night; Washing: next day, after being reclaimed by confining liquid, adds 1 × TBST of proper volume, shaken at room temperature rinsing 3 times, 10min/ time in glass dish; Hatch primary antibodie: in 5mL confining liquid (3%BSA), add Salmonellas rabbit source O4 serum in 1:200 ratio, be poured in sample sack after mixing, then the pvdf membrane after washing is put into sample sack, after discharging bubble, sample sack is sealed, is placed on horizontal shaker, incubated at room 1h.Hatch two after washing to resist: in 5mL1 × TBST, add biotin labeled goat anti-rabbit igg two in the ratio of 1:20000 resist, hatch 1h altogether with film.After washing, hatch the Streptavidin of AP mark: the Streptavidin adding AP mark in 5mL1 × TBST in the ratio of 1:1000, hatch 1h altogether with film.Develop the color after washing: take out pvdf membrane, be placed in glass dish.Developer 1 × APbuffer, A liquid, B liquid are added in EP pipe after mixing by the volume of 1000 μ L, 50 μ L, 50 μ L, be added drop-wise on pvdf membrane, lucifuge colour developing manifests to causing band.Take a picture: the pvdf membrane of color development stopping is placed in gel imaging system, photograph saving result.
Above silver dye and western result are respectively as shown in figs.3 a and 3b.Show that the disappearance of cpsB gene does not affect the synthesis of LPS, the synthesis impact of disappearance on LPS of rfbM gene is comparatively large, but can not block its synthesis completely, sees Fig. 3 B, and lacks while rfbM and cpsB gene, then can block the synthesis of LPS completely.
Embodiment 8
S100 Δ rfbK; The covering of SalmonellatypimuriumS116 and phenotypic evaluation
1. design of primers
According to the Salmonella typhimurium UK-1 whole genome sequence (sequence number is: CP002614) that NCBIGenbank announces, design two pairs of primers to increase respectively rfbK and cpsG gene, amplified fragments size is respectively 1445bp, 1374bp, above-mentioned primer is by the synthesis of Beijing Hua Da genome company, and primer sequence is as follows:
rfbK-F-BamHI：5’CGC
GGATCCTGAACGTAGTTAATAATAGC3’
rfbK-R-PstI：5’ATC
CTGCAGTCAATTTTTTTACAGCAAGC3’
cpsG-F-BamHI：5’CGC
GGATCCTGACAAAATTAACCTGTTTC3’
cpsG-R-PstI：5’ATC
CTGCAGGACGTTACTGATTCAGCAGC3’
2. cover the structure of plasmid p15a-rfbK and p15a-cpsG
With wild strain S100 genome for template, expand rfbK gene and cpsG gene with primer rfbK-F-BamHI/rfbK-R-PstI and cpsG-F-BamHI/cpsG-R-PstI respectively.RfbK and the cpsG gene fragment reclaim amplification and low copy plasmid p15a restriction enzyme BamHI, PstI carry out double digestion.Enzyme is cut rear rfbK with cpsG gene fragment to cut rear plasmid p15a T4DNAligase with enzyme and be connected, 16 DEG C of water-baths are spent the night, transformation of E. coli competent cell DH5 α, treats that it grows the qualification of laggard performing PCR, obtains positive recombinant plasmid p15a-rfbK and p15a-cpsG.Checking order being sent to the handsome Bioisystech Co., Ltd in Shanghai after plasmid extraction, confirming that the covering plasmid built is correct.
3.S100 Δ rfbK; SalmonellatypimuriumS116 covers the phenotypic evaluation of strain
The mode that the covering plasmid calcium built in 2. transforms is transformed in gene-deleted strain competence S100 Δ rfbK and SalmonellatypimuriumS116 respectively.According to the operation steps in embodiment 7, wild strain S100, SalmonellatypimuriumS116 and plasmid covering strain are carried out LPS phenotypic evaluation.The display of LPS silver dye result, S100 (Δ rfbK) and SalmonellatypimuriumS116 can not synthesize complete LPS, and after plasmid p15a-rfbK and p15a-cpsG covers, all can synthesize the LPS with wild strain S100 same level; Show, no matter the covering of the covering of rfbK gene or cpsG gene, bacterium can be made to recover to synthesize the ability of LPS simultaneously, cpsG gene functionally can complete complementary, replacement rfbK gene.
Embodiment 9
The covering of S100 Δ rfbM Δ cpsB and phenotypic evaluation
1. design of primers
According to the Salmonella typhimurium UK-1 whole genome sequence (sequence number is: CP002614) that NCBIGenbank announces, design two pairs of primer amplification cpsB genes, amplified fragments size is 1452bp, and above-mentioned primer is by the synthesis of Beijing Hua Da genome company, and primer sequence is as follows:
cpsB-F-BamHI：5’CGCGGATCCTGATAATGCGTCAGAC3’
cpsB-R-HindIII：5’CGCAAGCTTATTGCAGGCGTCAGA3’
2. cover the structure of plasmid p15a-cpsB
With wild strain S100 genome for template, with primer cpsB-F-BamHI/cpsB-R-HindIII amplification cpsB gene.The cpsB gene fragment reclaim amplification and low copy plasmid p15a restriction enzyme BamHI, HindIII carry out double digestion.Enzyme is cut rear cpsB gene fragment to cut rear plasmid p15a T4DNAligase with enzyme and be connected, 16 DEG C of water-baths are spent the night, transformation of E. coli competent cell DH5 α, treat that it grows the qualification of laggard performing PCR, obtain positive recombinant plasmid p15a-cpsB.Checking order being sent to the handsome Bioisystech Co., Ltd in Shanghai after plasmid extraction, confirming that the covering plasmid built is correct.
3.S100 Δ rfbM Δ cpsB covers the phenotypic evaluation of strain
The mode that the covering plasmid calcium built in 2. transforms is transformed in gene-deleted strain competence S100 Δ rfbM Δ cpsB respectively.According to the operation steps in embodiment 7 by wild strain S100, S100 Δ rfbM, S100 Δ cpsB and S100 Δ rfbM Δ cpsB(p15a-cpsB) plasmid covering strain carry out LPS phenotypic evaluation.The display of LPS silver dye result, S100 (Δ rfbB) and S100 Δ rfbM Δ cpsB can not synthesize complete LPS, and S100 Δ rfbM Δ cpsB can synthesize the LPS with wild strain S100 same level after plasmid p15a-cpsB covers; Show, the covering of cpsB gene, bacterium can be made to recover the ability of synthesis LPS, cpsB gene functionally can complete complementary, replacement rfbM gene.
Claims (5)
1. a strain attenuated salmonella typhimurium SalmonellatypimuriumS116, is characterized in that, described attenuated salmonella typhimurium SalmonellatypimuriumS116 lacks rfbK and cpsG gene; The Classification And Nomenclature of described attenuated strain is SalmonellatypimuriumS116, is preserved in China typical culture collection center, and preserving number is CCTCCM2015635, and the preservation time is: on October 23rd, 2015.
2. a construction process for attenuated salmonella typhimurium, is characterized in that, described construction process comprises the steps:
Utilize the methods of homologous recombination that suicide plasmid mediates, by rfbK or the rfbM gene in Salmonella typhimurium bacterial genomes and cpsG or cpsB gene knockout, obtain the mutant strain not containing rfbK or rfbM gene and cpsG or cpsB gene.
3. construction process according to claim 2, is characterized in that, the methods of homologous recombination of described suicide plasmid mediation comprises the steps:
(1) suicide plasmid pYA4278-rfbK or pYA4278-rfbM is built; PYA4278-cpsG or pYA4278-cpsB;
(2) step (1) gained suicide plasmid electricity is transduceed into λ pir intestinal bacteria, and carry out nature mixed culture with Salmonella typhimurium, suicide plasmid is transferred in Salmonella typhimurium from intestinal bacteria, and carry out intersecting interworking with the homology region in Salmonella typhimurium genome, whole suicide plasmid is finally made to be integrated in the middle of genome, through Cm+ resistance screening, obtain the positive colony bacterium after first time homologous recombination;
(3) in LB liquid medium, (be not with Cm+ resistance) and continue culturing step 2) gained positive colony bacterium, the generation second time homologous recombination making it spontaneous, with containing 10% sucrose and the solid medium of non-sodium chloride-containing screening, obtain clone Chloramphenicol-sensitive being had to resistance to sucrose;
(4) obtained not containing the mutant strain of rfbK and cpsG by PCR screening.
4. construction process according to claim 3, is characterized in that, the construction process of described suicide plasmid pYA4278-rfbK is:
Design primer:
DrfbK-1F:5’ACAGACGCTTTACTGGTGGC3’
DrfbK-1R:5’CCTCTGACCTTAACTACGTTCATTAGTCC3’
DrfbK-2F:5’ACGTAGTTAAGGTCAGAGGGTGAGGATTA3’
DrfbK-2R:5’AACGCTATCAGAGCCAAATC3’
With Salmonella typhimurium genome for template, utilize primer DrfbK-1F and DrfbK-1R, pcr amplification, obtain upstream homology arm product, recycling primer DrfbK-2F and DrfbK-2R increases, obtain downstream homology arm product, finally utilize primer DrfbK-1F and DrfbK-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-rfbK,
Described suicide plasmid pYA4278-cpsG is configured to:
Design primer:
DcpsG-1F:5’ACATGCACCGCGAGGTTTAC3’
DcpsG-1R:5’TCTGACGTTATTACCGGGCATAATTGCAGGCG3’
DcpsG-2F:5’GCCCGGTAATAACGTCAGATCTCCCCTTACCG3’
DcpsG-2R:5’GCCAGGTGGCGAGGCGGTTG3’
With Salmonella typhimurium genome for template, utilize primer DcpsG-1F and DcpsG-1R, pcr amplification, obtain upstream homology arm product, recycling primer DcpsG-2F and DcpsG-2R increases, obtain downstream homology arm product, finally utilize primer DcpsG-1F and DcpsG-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-cpsG,
Described suicide plasmid pYA4278-rfbM is configured to:
Design primer:
DrfbM-1F:5’GCTGCCTATCGCCGTTCCG3’
DrfbM-1R:5’GGTGCGCCCAATCCAGCCGCCAGCCATAATTACGGGAAGAAAAGACAT3’
DrfbM-2F:5’TGGATTGGGCGCACCCGTTCTGGATTTTCGAAGGAGTGGAC3’
DrfbM-2R:5’GGATCGCAGCCTCATCATG3’
With Salmonella typhimurium genome for template, utilize primer DrfbM-1F and DrfbM-1R, pcr amplification, obtain upstream homology arm product, recycling primer DrfbM-2F and DrfbM-2R increases, obtain downstream homology arm product, finally utilize primer DrfbM-1F and DrfbM-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-rfbM,
Described suicide plasmid pYA4278-cpsB is configured to:
Design primer:
DcpsB-1F:5’CGCGGAACGATTACGCGATCG3’
DcpsB-1R:5’CGGCTTATCCGTAGGACGTCATCCCCGAATATCTGCAATAAATTGGCG3’
DcpsB-2F:5’CGTCCTACGGATAAGCCGCGCCTGCAATTATGCCCGGTAAGC3’
DcpsB-2R:5’CGCGCACCAGCTTCATACCG3’
With Salmonella typhimurium genome for template, utilize primer DcpsB-1F and DcpsB-1R, pcr amplification, obtain upstream homology arm product, recycling primer DcpsB-2F and DcpsB-2R increases, obtain downstream homology arm product, finally utilize primer DcpsB-1F and DcpsB-2R, with upstream and downstream homology arm mix products for template, increase, obtain the upstream and downstream homology arm amplified production merged, recycling adds A(A base) reaction kit carries out adding A process at PCR primer fragment ends, and with cut with AhdI enzyme after obtain pYA4278 digestion products and be connected under the effect of T4 ligase enzyme, finally proceed in λ pir intestinal bacteria, obtain recombinant plasmid pYA4278-cpsB.
5. attenuated salmonella typhimurium according to claim 1 or the application of attenuated salmonella typhimurium on vaccine by construction process structure described in any one of claim 2-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510726833.0A CN105462907A (en) | 2015-11-02 | 2015-11-02 | Attenuation salmonella typhimurium and construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510726833.0A CN105462907A (en) | 2015-11-02 | 2015-11-02 | Attenuation salmonella typhimurium and construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105462907A true CN105462907A (en) | 2016-04-06 |
Family
ID=55601069
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510726833.0A Pending CN105462907A (en) | 2015-11-02 | 2015-11-02 | Attenuation salmonella typhimurium and construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105462907A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116478895A (en) * | 2023-03-28 | 2023-07-25 | 湖南大学 | Recombinant salmonella typhimurium genetically engineered bacterium HCS1, microbial inoculum and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998002523A1 (en) * | 1996-07-17 | 1998-01-22 | The Minister Of Agriculture Fisheries And Food In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain And Northern Ireland | Vaccine preparations |
| WO2010141143A2 (en) * | 2009-04-21 | 2010-12-09 | Vivocure, Inc. | Engineered avirulent bacteria strains and use in medical treatments |
| CN104388459A (en) * | 2014-10-29 | 2015-03-04 | 四川农业大学 | Method for self-production of microcells in bacteria and bacterial mutation strain capable of implementing self production of the microcells |
-
2015
- 2015-11-02 CN CN201510726833.0A patent/CN105462907A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998002523A1 (en) * | 1996-07-17 | 1998-01-22 | The Minister Of Agriculture Fisheries And Food In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain And Northern Ireland | Vaccine preparations |
| WO2010141143A2 (en) * | 2009-04-21 | 2010-12-09 | Vivocure, Inc. | Engineered avirulent bacteria strains and use in medical treatments |
| CN104388459A (en) * | 2014-10-29 | 2015-03-04 | 四川农业大学 | Method for self-production of microcells in bacteria and bacterial mutation strain capable of implementing self production of the microcells |
Non-Patent Citations (2)
| Title |
|---|
| GORDON STEVENSON ET AL.: "The cps gene cluster of Salmonella strain LT2 includes a second mannose pathway：sequence of two genes and relationship to genes in the rfb gene cluster", 《MOL GEN GENET》 * |
| QINGKE KONG ET AL.: "Effect of Deletion of Genes Involved in Lipopolysaccharide Core and O-Antigen Synthesis on Virulence and Immunogenicity of Salmonella enterica Serovar Typhimurium", 《INFECTION AND IMMUNITY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116478895A (en) * | 2023-03-28 | 2023-07-25 | 湖南大学 | Recombinant salmonella typhimurium genetically engineered bacterium HCS1, microbial inoculum and application thereof |
| CN116478895B (en) * | 2023-03-28 | 2024-03-19 | 湖南大学 | Recombinant salmonella typhimurium genetically engineered bacterium HCS1, microbial inoculum and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105821020B (en) | A kind of 'beta '-mannase mRmMan5A and its encoding gene and application | |
| Pantin-Jackwood et al. | Phylogenetic analysis of turkey astroviruses reveals evidence of recombination | |
| CN104846013B (en) | A kind of 55 type adenovirus vector of replication deficient human and its preparation method and application | |
| CN105132350B (en) | The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application | |
| CN104330572A (en) | Kit for indirect ELISA (Enzyme-Linked Immunosorbent Assay) detection of IgG or IgA antibodies of PRRSV (Porcine reproductive and respiratory syndrome virus) of pigs | |
| CN111808765B (en) | Bacillus subtilis capable of efficiently degrading vomitoxin and application thereof | |
| CN103555754B (en) | A kind of lactobacterium casei bacterium shadow and its preparation method and application | |
| Macpherson et al. | An aerolysin‐like enterotoxin from Vibrio splendidus may be involved in intestinal tract damage and mortalities in turbot, Scophthalmus maximus (L.), and cod, Gadus morhua L., larvae | |
| CN105602865A (en) | Bacillus subtilis, fermentation method, powder and application | |
| CN114774372B (en) | Coxsackie virus A10 type strain and vaccine and application thereof | |
| CN102776220B (en) | Construction of brucellosis A19 molecular marker vaccine strain and determination of virulence and immunogenicity | |
| CN116333957A (en) | Recombinant bacillus for displaying streptococcus suis prophage lyase, construction method and application thereof | |
| CN105462907A (en) | Attenuation salmonella typhimurium and construction method and application | |
| Park et al. | Molecular detection and characterization of unclassified bovine enteric caliciviruses in South Korea | |
| CN103333849A (en) | Staphylococcus aureus mutant strain, and preparation method and applications thereof | |
| CN102406098A (en) | Method for degrading zearalenone | |
| CN102327606A (en) | Brucella live vaccine and production method thereof | |
| CN104448005B (en) | The fusion rotein antigen of duck hepatitis A virus (HAV) 3 type VP1 albumen and LTB and application thereof | |
| CN104530230A (en) | Duck hepatitis A virus VP1 protein gene and application thereof | |
| CN104328135B (en) | Duck Tembusu virus E protein-LTB fusion protein and application thereof | |
| CN110331122A (en) | A kind of Escherichia coli of secreting, expressing algin catenase and its application | |
| CN107988130A (en) | Stablize lactic acid bacteria genetic engineering subunit vaccine strain of expression porcine rotavirus VP4 albumen and preparation method thereof | |
| CN107723269A (en) | Recombinate construction method and gained strain and the application of Salmonella typhimurtum bivalent vaccine strain | |
| CN103421731B (en) | A kind of haemophilus parasuis attenuation salmonella seedling | |
| CN103421732B (en) | Express the Salmonella choleraesuls attenuated vaccine of haemophilus parasuis surface antigen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160406 |
|
| RJ01 | Rejection of invention patent application after publication |