CN104388459A - Method for self-production of microcells in bacteria and bacterial mutation strain capable of implementing self production of the microcells - Google Patents
Method for self-production of microcells in bacteria and bacterial mutation strain capable of implementing self production of the microcells Download PDFInfo
- Publication number
- CN104388459A CN104388459A CN201410589298.4A CN201410589298A CN104388459A CN 104388459 A CN104388459 A CN 104388459A CN 201410589298 A CN201410589298 A CN 201410589298A CN 104388459 A CN104388459 A CN 104388459A
- Authority
- CN
- China
- Prior art keywords
- mind
- minicell
- microcells
- self
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for self-production of microcells in bacteria. The method comprises the following steps: constructing suicide plasmids of an upstream and downstream homologous arm with a nucleotide sequence as shown SEQ ID No.1 or a nucleotide sequence with at least 80% sequence identity of the nucleotide sequence as shown in SEQ ID No.1, knocking out the nucleotide sequence by a homologous recombination method so as to inhibit normal progress of bacteria division, disconnecting the bacteria at two pole parts so as to produce microcells. The method is free of resistance maker; the requirements of safety of biological vaccines can be met; the application of the microcells in subunit vaccines and antigen delivery vectors can be facilitated. The invention also provides a salmonella typhimurium mutant which is prepared by the method and is capable of implementing self production of the microcells; the classification nomenclature of the salmonella typhimurium mutant is SalmonellaentericaserovarTyphimuriumiP0002; the preservation number is CCTCCNO.M2014474; the preservation date is October 14, 2014.
Description
Technical field
The invention belongs to technical field of bioengineering, be specifically related to make bacterium from the method for main product minicell and the self-produced minicell mutant strain of a strain.
Background technology
Bacterial minicells be a kind of when proper splitting movable disturbed after isolated by rod-shaped bacterium the two poles of the earth and produce without nuclear structure.First minicell producing bacterial strain is found when finding cellular segregation mutant strain by genomics researchist, after they find this kind of structure, the minicell of various molecular level and gene level forms associated viscera and is more reported out, people can according to the generation mechanism of minicell, to gene and bacterial strain structural context clearly bacterial strain transform, minicell is used as vaccine carrier better.Minicell has been used to transcribe, translate, plasmid separation, cellular replication, plasmid backbone virulence factor expression analysis etc., because minicell does not have the characteristic copied, but can most of material in submission bacterium, comprise proteantigen and plasmid DNA, a kind of vaccine carrier platform efficiently can be become.
Minicell has following characteristics: 1, because minicell can be considered to the bacteria particles not containing genetic material, there is most of biological characteristics of parent bacteria, exogenous plasmid can be carried and express foreign protein, and the excretory system of bacterium can be utilized to transform secretion foreign protein, so as in antigen presentation carrier, have selective advantage more widely; 2, because it does not have the material that bacterial genomes etc. makes bacterium copy, surely can not grow for a long time at internal body and bring potential hazard; 3, form because minicell has the biofilm load similar with bacterium; body can be stimulated to produce efficient immune response and immune protective efficiency; 4, because the size of minicell has difference with the parent bacteria that can copy; we just can utilize easy; minicell can be separated very efficiently by traditional separation method such as gradient centrifugation from parental cell, and simple purification method is feasible.
At present, although by certain methods, make the self-produced minicell of intestinal bacteria, on other bacteriums, particularly in salmonella, also do not find a kind of good method making its self-produced minicell.
Summary of the invention
One of the technical problem to be solved in the present invention is to provide a kind of method making the self-produced minicell of bacterium.The method comprises the steps:
1) build containing nucleotide sequence shown in SEQ ID No.1 or have the suicide plasmid of the upstream and downstream homology arm of the nucleotide sequence of the sequence iden of at least 80% with nucleotide sequence shown in SEQ ID No.1, the nucleotides sequence shown in described SEQ ID No.1 is classified as and lacks last 18bp sequence
minDgene order;
2) by bacterium and the λ containing step 1) gained plasmid
pircoli strain natural combination, by the method for homologous recombination, through chlorampenicol resistant screening and the screening of sucrose susceptibility, obtains the mutant strain of the gene lacking the division of regulation and control bacterium.
Described suicide plasmid is that plasmid vector builds with pRE112.
The construction step of described suicide plasmid is:
1) design of primers
minD-1F：5’-TCACAAAAACGCGATTAATTGATG-3’
minD-1R：5’-ACCTGCAGGATGCGGCCGCGGTTAAAAAGGGATCAATTC-3’
minD-2F：5’-CCGCGGCCGCATCCTGCAGG CAAACGCCTGTTCG-3’
minD-2R：5’-GTTGCAGGAGTATCCGCTTTAACG-3’
2) extraction is in the bacterial genomes DNA of logarithmic phase as template, increases respectively, obtain the amplified production of its left and right homology arm with left and right homology arm primer, reclaims product and carries out fusion DNA vaccine amplification, namely use primer
minD-1F and
minD-2R increases, and obtains the left and right homology arm amplified production merged;
3) carry out the process of+A base with+A reaction kit at fragment ends again, and with
adh 1enzyme obtains pRE112 digestion products after cutting carries out connecting and being transformed into λ under the effect of T4 ligase enzyme
pirin intestinal bacteria, obtain the suicide plasmid pRE112-minD of the upstream and downstream homology arm of the gene containing the division of regulation and control bacterium.
Restructuring suicide plasmid, owing to can not copy survival Salmonellas, will proceed to the λ of recombinant plasmid
pircoli strain engages naturally with Salmonellas, homologous fragment is made to import salmonella gene group, and pass through homologous recombination, exchange and resistance screening (Cm resistance) through first time, obtain positive colony, then cultivate positive colony, make it that spontaneous mutation occur and produce secondary exchange, with the Screening of Media containing sucrose, obtain the clone to sucrose resistance to antibiotic sensitive, the method screening of last PCR obtains mutant strain.
As incited somebody to action
minDgene all knocks out, and can affect the normal work of minE, as easy as rolling off a logly causes bacterium not produce minicell.Only knock out nucleotide sequence shown in SEQ ID No.1 or with nucleotide sequence shown in SEQ ID No.1, there is the nucleotide sequence of the sequence iden of at least 80%, the self-produced minicell of bacterium can be made.
Another object of the present invention is to provide the self-produced minicell of a strain
salmonella entericaserovar typhimuriumi P002 mutant.Lacked all sequences except last 18bp sequence in minD gene in this mutant chromosomal DNA, Classification And Nomenclature is
salmonella entericaserovar Typhimuriumi P0002, (postcode: 430072), preserving number is CCTCC NO.M2014474, and the preservation time is on October 14th, 2014 for Luo Jia Shan, wuchang, wuhan, Wuhan University to be preserved in China typical culture collection center.This mutant can self-produced minicell, and the application that can be as a kind of efficient antigen presentation carrier and subunit vaccine provides precondition.
The invention has the beneficial effects as follows:
1, the present invention can make the self-produced minicell of bacterium, minicell has non-reproduction due to it, its words as subunit vaccine and antigen presentation carrier can not produce lasting injury to body, and the present invention can promote the application of minicell on subunit vaccine and antigen presentation carrier;
2, method provided by the invention, not containing any resistance marker, meets the requirement of vaccine Biosafety.
Accompanying drawing explanation
Fig. 1: the inventive method schematic diagram;
Fig. 2: containing the plasmid map of suicide plasmid of upstream and downstream homology arm of minD gene lacking last 18bp sequence;
Fig. 3: the qualification result being the suicide plasmid that the present invention builds, M:DNA marker III 1:minD in figure
Fig. 4: the PCR of the different serotypes salmonella mutant of self-produced minicell detects electrophoresis result, M:DNA marker III 1 in figure: parent minD;
Fig. 5: the activity checking of the minicell of the Salmonella typhimurtum mutant strain generation of self-produced minicell;
Fig. 6: the electron micrograph result of the minicell of the Salmonella typhimurtum mutant strain generation of self-produced minicell;
Fig. 7: the electron micrograph result knocking out the mouse salmonella mutant strain of minD gene order completely, arrow indication part is long filamentous bacterium;
Fig. 8: the electron micrograph result knocking out the minicell produced with the Yersinia enterocolitica that there is the nucleotide sequence of the sequence iden of 80% with nucleotide sequence shown in SEQ ID No.1.
Embodiment
Below by embodiment, the present invention is specifically described; what be necessary to herein means out is that following examples are just for being further detailed the present invention; limiting the scope of the invention can not be interpreted as; some nonessential improvement and adjustment that the person skilled in the art in this field makes according to foregoing invention content, still belong to protection scope of the present invention.
Embodiment 1
1) containing lacking last 18bp sequence
minDthe structure of the suicide plasmid of the upstream and downstream homology arm of gene
Design two pairs of fusion DNA vaccine primers according to the Salmonella typhimurium UK-1 strain sequence of having reported for work (be CP002614.1 with reference to GenBank sequence number) to increase respectively and lack last 18bp sequence
minDthe upstream homology arm of gene and downstream homology arm, amplified fragments size is respectively 420bp and 360bp, and above-mentioned primer is by the synthesis of Beijing Hua Da genome company, and primer sequence is as follows:
minD-1F：5’-TCACAAAAACGCGATTAATTGATG-3’
minD-1R：5’-ACCTGCAGGATGCGGCCGCGGTTAAAAAGGGATCAATTC-3’
minD-2F：5’-CCGCGGCCGCATCCTGCAGG CAAACGCCTGTTCG-3’
minD-2R：5’-GTTGCAGGAGTATCCGCTTTAACG-3’
The Salmonella typhimurium UK-1 strain of freeze-drying is connected to incubated overnight in LB flat board, within second day, picking list colony inoculation is in LB liquid nutrient medium, 37 DEG C of 180 r/min cultivates the genome that 8-12h extracts bacterium, what extract that genome utilizes is the bacterial genomes extraction agent box of day root biochemistry, and operation steps to specifications carries out genomic extracting.
The amplified reaction of PCR carries out in the system of 50 μ L, and reaction system is as follows: template DNA 1 μ L, 2 × high-fidelity DNA enzyme premixed liquid, purchased from precious biological (Dalian) company limited 25 μ L, upstream primer 1 μ L, and downstream primer 1 μ L, ddH
2o 22 μ L.
Amplification condition is: enter circulation after 94 DEG C of sex change 5min, and loop parameter is 94 DEG C of 10 sec, 55 DEG C of 15 sec, 72 DEG C of 10 sec.After 35 circulations, 72 DEG C extend 10min.Amplification PCR primer through 1% agarose gel electrophoresis analysis, two clip size that increases are respectively 420bp and 360bp, with expect sizableness.
The fusion of upstream and downstream homology arm: by the ratio of upstream and downstream homology arm according to mole number 1:1, total template amount is that 2 μ L are as pcr amplification template, utilize primer minD-1F and minD-2R with same system and amplification condition before under increase, obtain the fusion fragment that size is about 800bp.
The fusion fragment obtained before is carried out+A process, utilize the plus A reaction kit of sky root biochemistry, reaction system is: template 15 μ L, plus A buffer 4 μ L, Taq enzyme 1 μ L; Reaction conditions is: 72 DEG C of 30min, has reacted rear stand-by.
The preparation of suicide plasmid pRE112 endonuclease bamhi: utilize
adh Ienzyme cuts pRE112 plasmid, and plasmid fragments enzyme is cut out T cloning site, and reclaim carrier pRE112, then connect with T4 DNA ligase, 16 DEG C of water-baths are spent the night, and transforms λ
pircompetent escherichia coli cell, treats that it grows the qualification of laggard performing PCR, thus obtains suicide plasmid.Qualification result confirms that the suicide plasmid built is correct, and as shown in Figure of description 3, the structure schema of suicide plasmid is as shown in Figure of description Fig. 2.
2) structure of the Salmonella typhimurium mutant of self-produced minicell
The suicide plasmid built is converted into intestinal bacteria λ
pirin coli strain, (this plasmid has lacked
asdgene, needs DAP to grow, can be good at the screening for follow-up conjugal transfer), will the λ of suicide plasmid be carried
pirintestinal bacteria and Salmonella typhimurium (
salmonella entericaserovar Typhimuriumi UK-1), Salmonella choleraesuls (
salmonellacholeraesuis), Salmonella enteritidis (
salmonellaenteritidis), avian infectious bronchitis nephritis virus (
salmonellagallinarium), salmonella dublin (
salmonelladublin) and Salmonella paratyphi A (
salmonellaparatyphi A) etc. bacterial strain carry out conjugal transfer, the LB flat board of chlorampenicol resistant screens positive bacteria fall, positive bacteria is dropped on and does not cultivate propagation containing in the LB liquid nutrient medium of chlorampenicol resistant, 10% sucrose plate screens the bacterium colony of resistance to sucrose, and picking list bacterium colony carries out PCR qualification.
PCR identifies: extract minD mutant strain
minD-UK-1 genomic dna, by primer minD-1F and minD-2R amplification upstream and downstream homology arm fragment, simultaneously with primer minD-1R and minD-2F amplification
minDgene, sees that can amplify size be about the specific deficiency of about 700bp
minDgene fragment, if can not amplify respective segments, then shows that result conforms to expection, and the qualification of the present embodiment mutant strain successfully constructs, as shown in Figure of description Fig. 4.
Embodiment 2
Except when building the structure of suicide plasmid of homology arm, the suicide plasmid of homology arm is containing the upstream and downstream homology arm of the nucleotide sequence had plenty of as shown in SEQ ID No.2, and primer sequence is:
minD-1F：atcatcaacacgcctgtcc
minD-1R：cgcggccgccctgcagggaaatggattccttgtcaaaag
minD-2F：tccctgcagggcggccgcgggggataaaccatggctttg
minD-2R：ggattttcttgttttggctg
Outside, all the other steps are in the same manner as in Example 1.
Embodiment 3
The purifying of minicell and Activity determination: the mutant salmonella strain in the embodiment 1 of cultivation 500ml is to low-oxygen environment until OD value A600 reaches 1.1.By double low-speed centrifugal (2000 × g, 10mins) remove microorganism impurity, collect supernatant, minicell is enriched in supernatant, by centrifugal (10000 × g, 30mins) collect minicell, and with 1 × DPBS resuspended, and utilize density gradient centrifugation to obtain the minicell of purifying, density gradient pattern is: the iodixanol (OptiPrep of continuous print 5-20%, Axis-Shield PLC, Scotland), respectively density centrifugation agent concentration is added in centrifuge tube from high to low, minicell is placed in most top layer, centrifugal (2000 × g after installing density centrifugation, 20min), centrifugal complete after the centrifugate of collection different levels in 1.5ml centrifuge tube, minicell is collected with 18000 × g, and be applicable to the resuspended minicell of solvent, unpolluted minicell can with 10
6only judge that it is not contaminated containing a bacterium in minicell.
The method that reporter plasmid pUC-Mcherry containing red fluorescent protein is transformed by electricity is proceeded in mutant salmonella strain, and according to described method above by minicell purification out, can see that the minicell purity be purified is high by fluorescent electronic microscope, and can red fluorescent protein be expressed, show redness, as shown in Figure of description Fig. 5.
Embodiment 4
The electron microscopic observation of the minicell of spontaneous generation: for the mutant strain of embodiment 1 and embodiment 2, produce in mutant strain bacterium liquid culture medium at the minicell being cultured to logarithmic phase and get 1 ml nutrient solution, with 4000 × g collected by centrifugation thalline, 2 times are cleaned with PBS, with glutardialdehyde (2.5% in PBS), fix 2 hours for 4 degree, with identical buffer rinse 3 times, dewater step by step with ethylalcohol and isoamyl acetate solutions, be put on silver spray support, after dewatering completely with dry ice, spray one deck silver powder increases the susceptibility of sample, the situation of minicell is produced with Hitachi S-4800 scanning electron microscopic observation minicell mutant, minicell simultaneously after desirable purifying carries out electron microscopic observation after the process of as above step, result is as shown in Figure of description Fig. 6 and Fig. 8.
Comparative example 1
When building suicide plasmid, except upper and lower homology arm contains whole minD gene order, and primer sequence is:
MinD-1F：TCACAAAAACGCGATTAATTGATG
MinD-1R：ACCTGCAGGATGCGGCCGCGG TTAAAAAGGGATCAATTC
MinD-2F: CCGCGGCCGCATCCTGCAGGTATGGCATTACTGG
MinD-2R: GTTGCAGGAGTATCCGCTTTAACG
Outside, all the other steps are consistent with embodiment 1.
As shown in Figure of description 7, MinD gene is knocked out completely, the function of MinE can be affected, thus form the long filamentous bacterium at arrow indication place, do not have the situation that bacterium disconnects at the two poles of the earth when dividing, thus can not Minicells be formed.
sequence table
SEQUENCE LISTING
<110> Sichuan Agricultural University
<120> makes bacterium from the method for main product minicell and the self-produced minicell mutant of a strain
<130> 2014
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 795
<212> DNA
<213> artificial sequence
<400> 1
atggcacgca ttattgttgt tacttcgggt aaagggggcg ttggcaagac cacctccagc 60
gcggccatcg ctacaggttt ggcccagaag ggaaagaaaa ctgtcgtcat tgattttgat 120
atcggactgc gtaacctcga tctgattatg gggtgcgaac gtcgtgtcgt ttacgatttt 180
gtaaacgtca ttcagggcga tgcgacactg aatcaggcgc tgatcaaaga taagcgtact 240
gaaaatctct tcattcttcc ggcgtcgcag acccgggata aagacgcgct aacgcgcgaa 300
ggcgtcgcta aggtactgga ctcactgaaa gcgatggact ttgagttcat cgtttgcgac 360
tcgccggcgg gtatcgaaac cggggcgctg atggcgctct attttgccga tgaagcgatc 420
atcacgacca acccggaagt ctcttctgtc cgtgactcgg accgtattct gggtattctg 480
gcatcgaaat ctcgtcgcgc agaaaatggc gaagaaccga ttaaagaaca tctcctgttg 540
acgcgctaca atccaggccg cgtcaataaa ggcgacatgc tcagcatgga agatgtactg 600
gagattctgc gtattaaact cgtcggtgtg atcccggaag atcaatccgt actgcgcgca 660
tcgaaccagg gcgaaccggt gattcttgac gccactgcgg atgcgggtaa agcctatgca 720
gataccgtag atcgtctgtt gggagaagaa cgtcctttcc gcttcattga agaagagaag 780
aaaggtttcc tcaaa 795
<210> 2
<211> 813
<212> DNA
<213> artificial sequence
<400> 2
atggcacgca ttattgttgt tacatcgggt aaagggggcg ttggcaagac cacatcaagc 60
gcggctatcg caaccggctt ggcccaaaaa ggtaaaaaaa ccgttgttat cgattttgat 120
atcggactac ggaatctaga cttgattatg ggttgtgaac gccgggtagt ttacgatttt 180
gttaatgtga ttcaaggtga cgccacattg aaccaggcat taataaaaga taagcgcacg 240
gataatttgt atattctgcc cgcttctcag acccgtgaca aagacgctct gaccaaagag 300
ggtgtcgaaa agattttaaa cgatcttggc gaaatgaatt ttgagtttgt cgtgtgtgac 360
tcacctgccg gtatcgaaag cggtgcgttg atggcactgt attttgctga cgaagctgtc 420
atcacgacca accctgaagt ttcttcagtt cgtgactcag accgtatcct cgggatattg 480
tcatccaagt cacgccgagc tgagaatggt caggaaccaa ttaaagaaca tctgctgttg 540
actcgctaca acccagggcg tgttaatcgc ggcgatatgc ttagcatgga agatgtcctt 600
gatattctga ggataccact ggttggcgtt attccagaag atcagtctgt attgcgcgcc 660
tcgaaccaag gcgagcctgt gattctggac aaagagtcag atgccggtaa agcttatgac 720
gataccgttg accgtttgct aggagaagaa cgtcccttcc gcttcattga agaagagaag 780
aagggcttcc tgaaacgcct ttttggggga taa 813
Claims (4)
1. make a method for the self-produced minicell of bacterium, it is characterized in that: said method comprising the steps of:
1) build containing nucleotide sequence shown in SEQ ID No.1 or have the suicide plasmid of the upstream and downstream homology arm of the nucleotide sequence of the sequence iden of at least 80% with nucleotide sequence shown in SEQ ID No.1, the nucleotides sequence shown in described SEQ ID No.1 is classified as and lacks last 18bp sequence
minDgene order;
2) by object bacterium and the λ containing step 1) gained plasmid
pircoli strain natural combination, by the method for homologous recombination, through chlorampenicol resistant screening and the screening of sucrose susceptibility, obtains the mutant strain of the gene lacking the division of regulation and control bacterium.
2. method according to claim 1, is characterized in that: suicide plasmid described in step 1) is that plasmid vector builds with pRE112.
3. method according to claim 1 and 2, is characterized in that: the construction step of described suicide plasmid is:
1) design of primers
minD-1F：5’-TCACAAAAACGCGATTAATTGATG-3’
minD-1R：5’-ACCTGCAGGATGCGGCCGCGGTTAAAAAGGGATCAATTC-3’
minD-2F：5’-CCGCGGCCGCATCCTGCAGG CAAACGCCTGTTCG-3’
minD-2R：5’-GTTGCAGGAGTATCCGCTTTAACG-3’
2) extraction is in the bacterial genomes DNA of logarithmic phase as template, increases respectively, obtain the amplified production of its left and right homology arm with left and right homology arm primer, reclaims product and carries out fusion DNA vaccine amplification, namely use primer
minD-1F and
minD-2R increases, and obtains the left and right homology arm amplified production merged;
3) carry out the process of+A base with+A reaction kit at fragment ends again, and with
adh 1enzyme obtains pRE112 digestion products after cutting carries out connecting and being transformed into λ under the effect of T4 ligase enzyme
pirin intestinal bacteria, obtain the suicide plasmid of the upstream and downstream homology arm of the gene containing the division of regulation and control bacterium.
4. a strain self-produced minicell that prepared by claim 1-3 either method
salmonella entericaserovar Typhimuriumi P0002 mutant, is characterized in that: lacked in described mutant chromosomal DNA
minDmost of sequence of gene, but retain last 18bp sequence wherein, Classification And Nomenclature is
salmonella entericaserovar Typhimuriumi P0002, is preserved in China typical culture collection center, and preserving number is CCTCC NO.M2014474, and the preservation time is on October 14th, 2014, and the preservation time is on October 14th, 2014.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410589298.4A CN104388459B (en) | 2014-10-29 | 2014-10-29 | Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410589298.4A CN104388459B (en) | 2014-10-29 | 2014-10-29 | Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104388459A true CN104388459A (en) | 2015-03-04 |
| CN104388459B CN104388459B (en) | 2017-03-08 |
Family
ID=52606416
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410589298.4A Expired - Fee Related CN104388459B (en) | 2014-10-29 | 2014-10-29 | Make antibacterial from the method for main product microcell and one plant of self-produced minicell mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388459B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105462907A (en) * | 2015-11-02 | 2016-04-06 | 四川农业大学 | Attenuation salmonella typhimurium and construction method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005079854A1 (en) * | 2004-02-02 | 2005-09-01 | Engeneic Molecular Delivery Pty Ltd. | Compositions and methods for targeted in vitro and in vivo drug delivery to mammalian cells via bacterially derived intact minicells |
-
2014
- 2014-10-29 CN CN201410589298.4A patent/CN104388459B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005079854A1 (en) * | 2004-02-02 | 2005-09-01 | Engeneic Molecular Delivery Pty Ltd. | Compositions and methods for targeted in vitro and in vivo drug delivery to mammalian cells via bacterially derived intact minicells |
| CN102028953A (en) * | 2004-02-02 | 2011-04-27 | 恩杰内克分子递送有限公司 | Compositions and methods for targeted in vitro and in vivo drug delivery to mammalian cells via bacterially derived intact minicells |
Non-Patent Citations (1)
| Title |
|---|
| PIET A. J. DE BOER等: "A Division Inhibitor and a Topological Specificity Factor Coded for by the Minicell Locus Determine Proper Placement of the Division Septum in E. coli", 《CELL》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105462907A (en) * | 2015-11-02 | 2016-04-06 | 四川农业大学 | Attenuation salmonella typhimurium and construction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104388459B (en) | 2017-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107400677B (en) | Bacillus licheniformis genome editing vector based on CRISPR-Cas9 system and preparation method thereof | |
| CN112080521B (en) | Recombinant pseudorabies virus vector construction for expressing foreign protein and preparation method of recombinant pseudorabies virus | |
| CN109825532B (en) | Application of CRISPR/Cas12a gene editing system in physcomitrella patens gene editing | |
| US9982269B2 (en) | Mortierella alpine uracil auxotroph with URA5 gene knocked out through homologous recombination, and construction method thereof | |
| CN104388368B (en) | Low-endotoxin escherichia coli prokaryotic expression engineering bacterial mutant strain and construction method | |
| Ji et al. | A simplified and efficient method for transformation and gene tagging of Ustilago maydis using frozen cells | |
| CN104593388B (en) | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof | |
| CN102174508A (en) | Method for screening non-essential regions for replication of goat pox virus and universal transfer vectors for same | |
| CN104524564A (en) | Crucian herpes virus disease compound vaccine preparation, preparation method and application | |
| CN109022476A (en) | A kind of bacillus licheniformis CRISPR-Cas9 gene editing system and its application | |
| CN112626101A (en) | African swine fever virus I177L gene recombinant plasmid, expression vector and preparation method | |
| CN101979598B (en) | Method for constructing HSV-1 BAC system carrying luciferase report genes | |
| CN104388459A (en) | Method for self-production of microcells in bacteria and bacterial mutation strain capable of implementing self production of the microcells | |
| KR100786514B1 (en) | - Development of E.coli-lactobacillus shuttle vector and it's application | |
| CN107760693A (en) | Application of the Chlamydomonas reinhardtii LRR genes in Chlamydomonas reinhardtii cadmium tolerance is regulated and controled | |
| CN107083375B (en) | Medium-temperature alpha-amylase and gene and application thereof | |
| CN107513502A (en) | A kind of botrytis cinerea mutant strain Δ bcscd1 and its construction method for producing pillar spore ketone | |
| CN103232994A (en) | Method for screening unmarked gene knockout bacterial strain of acidithiobacillus thiooxidans | |
| CN105624078B (en) | One plant of attenuation Salmonella choleraesuls and its preparation method and application | |
| CN106754592B (en) | Streptococcus suis 2-type Rex gene knockout mutant strain SS2-1 Δ Rex and its construction method and application | |
| CN110591993A (en) | Vibrio harveyi homologous recombination gene knockout method based on hydrochloric acid stimulation | |
| CN114836392B (en) | PRRSV (porcine reproductive and respiratory syndrome virus) weak virus and preparation method and application thereof | |
| CN104131023A (en) | Plasmids capable of applying RED recombinant system in zymomonas mobilis, construction method and applications thereof | |
| CN104152482A (en) | RecET recombination system expression plasmids for zymomonas mobilis, as well as construction method and applications thereof | |
| CN103305544A (en) | Acarbose engineering bacterium as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170308 Termination date: 20211029 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |