CN104388420A - Method for quickly acquiring great number of plasmid DNAs by utilizing PCR technology - Google Patents

Abstract

The invention relates to a method for quickly acquiring a great number of plasmid DNAs (Deoxyribonucleic Acids) by utilizing a PCR (Polymerase Chain Reaction) technology and belongs to the technical field of molecular biology. Primers are designed according to sequence information of a template plasmid DNA required to be obtained, upstream and downstream primers are complementary with two template chains of the plasmid DNAs respectively, and twenty bases of 5' ends of the two primers are complementary. The two primers are used for performing PCR amplification on 0.5mu g of template plasmids, and the great number of plasmid DNAs can be quickly obtained in vitro. Compared with a conventional plasmid acquisition method, the method provided by the invention has the advantages that the method is independent of host bacteria and is wide in application range; the steps of plasmid transformation, bacterial cultivation, plasmid extraction and the like are eliminated, the time is shortened, and the cost is reduced.

Description

A kind of method utilizing round pcr to obtain a large amount of plasmid DNA fast

Technical field

The present invention relates to one utilizes polymerase chain reaction (PCR) technology to obtain the method for a large amount of plasmid DNA fast, can be used for improving the efficiency of external acquisition plasmid DNA and increasing the output of plasmid DNA, belongs to technical field of molecular biology.

Background technology

Plasmid is a kind of hereditary unit can carrying out self-replacation independent of karyomit(e), and most plasmid is all circular double-stranded DNA.From the seventies in last century, investigator starts on the basis of natural plasmid, develop the special plasmid carrier in a large number with difference in functionality and characteristic.At present, these artificial constructed plasmids have become the most frequently used in genetically engineered, most crucial is also one of the most effective instrument.

Report, only 2013 take plasmid as the genetic immunization of core and treat the market output value close to 45,000,000,000 dollars, and this market also presents the trend constantly expanded, and the corresponding demand to plasmid DNA also continues to increase.

Under normal circumstances, a certain plasmid of a large amount of acquisition depends on this Plastid transformation Host Strains (being generally intestinal bacteria), and makes its amount reproduction, carries out cracking to discharge plasmid and to collect purifying to it to thalline.Concrete steps comprise: Plastid transformation Host Strains, yeast culture, the steps such as plasmid extraction purifying.Whole process need 2-3 days, the cycle is longer.If target plasmid is low copy plasmid, improving yield plasmid often needs by expanding yeast culture scale, and the methods such as Extending culture time realize, and corresponding cost also will increase.

After plasmid DNA imports Host Strains, it copies and can cause burden to Host Strains.On plasmid, the expression of some gene also may have toxic action to Host Strains, and these situations all can have a negative impact for a large amount of plasmid DNA of efficient acquisition.

In order to shorten the cycle, reducing costs, certainly will will seek a kind of method not relying on a large amount of plasmid of acquisition of Host Strains.

Summary of the invention

The object of this invention is to provide a kind of method utilizing round pcr to obtain a large amount of plasmid DNA fast, have and efficient save cost fast, the advantage such as have wide range of applications, and can make up the deficiency of traditional method, for obtaining the approach that a large amount of plasmid DNA provides new fast.

The technical solution used in the present invention is as follows:

Utilize round pcr to obtain a large amount of plasmid DNA fast, comprise the following steps:

1, the template plasmid DNA sequence dna information design primer (upstream primer, downstream primer) obtained as required, upstream and downstream primer is complementary with two template strands of plasmid DNA respectively and 5 ' of two primers hold 20 base complementrities;

2, the primer pair 0.5 μ g template plasmid of design in step (1) is utilized to carry out pcr amplification;

3,2 μ L are got to the product obtained in step 2 and carry out agarose electrophoresis, detect production concentration, and remainder is saved backup in-20 ° of C;

Above-mentioned pcr amplification reaction and agarose gel electrophoresis detecting step comprise:

(1) PCR reaction system (50 μ L): 5 × TransStart FastPfu buffer 10 μ L, dNTPs(2.5 mM each) 5 μ L, upstream primer (10 mM) 2 μ L, downstream primer (10 mM) 2 μ L, template plasmid DNA 0.5 μ g, TransEco FastPfu DNA Polymerase 1 μ L, aqua sterilisa complements to 50 μ L.

(2) PCR response procedures: 95 ° of C 2 min; 95 ° of C 20 s, 50 ° of C 40 s, 72 ° of C 1 min, totally 25 circulations; 72 ° of C 5 min.

(3) agarose gel electrophoresis detects: take 0.4 g agarose powder, add in 40 mL 0.5 × tbe buffer liquid, microwave heating adds 2 μ L DNA staining fluid EB after agarose dissolves completely, mix, pour in glue groove while hot, and plug pecten, room temperature leaves standstill 20 more than min, vertically pecten is taken out after solidifying completely, the sepharose prepared is put into the electrophoresis chamber filling 0.5 × tbe buffer liquid, damping fluid should not have glue face, draw the loading wells that PCR primer that 2 μ L and sample-loading buffer mix adds sepharose, DNA molecular amount standard (DNA marker) is added wherein in a loading wells, switch on power electrophoresis 30 min under 5 V/cm conditions, after electrophoresis terminates, take out sepharose, be placed in imaging on ultraviolet transilluminator lightly, concentration and the size of amplified band is judged according to DNA molecular amount standard (DNA marker), residue PCR primer is saved backup in-20 ° of C.

Remarkable advantage of the present invention: the technology that the present invention relates to, by carrying out pcr amplification to a small amount of template plasmid DNA, can obtain a large amount of plasmid DNA fast, have following remarkable advantage compared with traditional method:

(1) cycle is short: utilize round pcr amplification plasmid, only need within several hours, can obtain the plasmid DNA that can be directly used in subsequent operations in a large number, compared with the cycle of traditional method 2-3 days, substantially reduce the cycle that plasmid obtains.

(2) easy and simple to handle: to carry out a PCR reaction and can obtain a large amount of plasmid, eliminate the extensive works such as traditional method Plastid transformation Host Strains, microbial culture, plasmid extraction, simplify operating process.

(3) with low cost: due to the correlated process skipping culturing bacterium, save the consumption of the medicine in this process, instrument, the aspect such as artificial, save cost.

(4) have wide range of applications: utilize the technical limit spacing plasmid DNA that the present invention relates to, participate in without the need to Host Strains, the plasmid that just can carry out copying for the special Host Strains of dependence is applicable equally.

(5) high and stable yields: by improving the cycle number of PCR, the plasmid DNA of generation can be made to increase with exponential form, and the height of plasmid copy number can not impact output.

Accompanying drawing explanation

Fig. 1 is that in application the present invention, the method pSG76-CS plasmid obtained that increases contrasts figure with the pSG76-CS plasmid electrophoresis that traditional method obtains.In figure, M is TaKaRa DL2000 DNA molecular amount standard, and 1 is the pSG76-CS plasmid that in application the present invention, method obtains, the 2 pSG76-CS plasmids obtained for traditional method.

Embodiment

We need to obtain a large amount of pSG76-CS plasmid (Kolisnychenko V, Plunkett III G, Herring CD, Feh é r T, P ó sfai J, Blattner FR, P ó sfai G. Engineering a Reduced in process of scientific research escherichia coligenome. Genome Research, 2002,12:640-647.) for gene knockout, but this plasmid copying in bacterium requires that Host Strains provides PIR albumen (Function protein that a kind of pSG76-CS plasmid replication relies on), this laboratory does not have preservation relevant bacteria species, cannot obtain this plasmid by traditional method.Therefore, we carry out pcr amplification, to obtain a large amount of pSG76-CS plasmids by the pSG76-CS plasmid of method to this Laboratories Accession a small amount of related in the present invention.

Detailed process is:

(1) design of primers

According to the plasmid pSG76-CS sequence information that US National Biotechnology Information center (NCBI) provides, design specificity upstream and downstream primer (upstream primer: 5 '-ATGTAACGCACTGAGAAGCCCTTAGAGCCTCT-3 ', downstream primer: 5 '-GGCTTCTCAGTGCGTTACATCCCTGGCTTGTT-3 '), upstream and downstream primer is complementary with two template strands of plasmid DNA respectively and 5 ' of two primers hold 20 base complementrities.

(2) Auele Specific Primer is utilized to carry out pcr amplification to 0.5 μ g pSG76-CS plasmid.

PCR reaction system (50 μ L): 5 × TransStart FastPfu buffer 10 μ L, dNTPs(2.5 mM each) 5 μ L, upstream primer (10 mM) 2 μ L, downstream primer (10 mM) 2 μ L, pSG76-CS plasmid DNA 0.5 μ g, TransEco FastPfu DNA Polymerase 1 μ L, aqua sterilisa complements to 50 μ L.

PCR response procedures: 95 ° of C 2 min; 95 ° of C 20 s, 50 ° of C 40 s, 72 ° of C 1 min, totally 25 circulations; 72 ° of C 5 min.

(3) agarose gel electrophoresis detects: take 0.4 g agarose powder, add in 40 mL 0.5 × tbe buffer liquid, microwave heating adds 2 μ L DNA staining fluid EB after agarose dissolves completely, mix, pour in glue groove while hot, and plug pecten, room temperature leaves standstill 20 more than min, vertically pecten is taken out after solidifying completely, the sepharose prepared is put into the electrophoresis chamber filling 0.5 × tbe buffer liquid, damping fluid should not have glue face, draw the loading wells that PCR primer that 2 μ L and sample-loading buffer mix adds sepharose, DNA molecular amount standard (DNA marker) is added wherein in a loading wells, switch on power electrophoresis 30 min under 5 V/cm conditions, after electrophoresis terminates, take out sepharose, be placed in imaging on ultraviolet transilluminator lightly, concentration and the size of amplified band is judged according to DNA molecular amount standard (DNA marker), residue PCR primer is saved backup in-20 ° of C.

As shown in Figure 1, the increase pSG76-CS plasmid that obtains of method in the present invention of applying carries out electrophoresis with the pSG76-CS plasmid that traditional method obtains and contrasts.In figure, M is TaKaRa DL2000 DNA molecular amount standard, and 1 is the pSG76-CS plasmid that in application the present invention, method obtains, the 2 pSG76-CS plasmids obtained for traditional method.Known by the relative position in sepharose comparing 1 and 2, utilize method in the present invention to have successfully been obtained pSG76-CS plasmid.In experiment afterwards, utilize the pSG76-CS plasmid obtained in the present embodiment to carry out gene knockout, can complete smoothly and knock out experiment, this also illustrates the function that the pSG76-CS plasmid obtained in this experiment normally can exercise each element on it.

The just specific embodiments of the invention more than enumerated, the present invention is not limited only to above embodiment, and the plasmid changed as pcr template can obtain different types of plasmid product, and all functions of these plasmids are all by complete reservation.According to the various effective deformations that conception of the present invention is carried out embodiment, all should think in protection scope of the present invention.

Sequence table

SEQUENCE LISTING

 

<110> Agricultural University Of Shenyang

The method that <120> mono-kind utilizes round pcr to obtain a large amount of plasmid DNA fast

<130>

<160>2

 

<210>1

<211>32

<212>DNA

<213> artificial sequence

 

<400>1

atgtaacgcactgagaagcccttagagcctct 32

 

<210>2

<211>32

<212>DNA

<213> artificial sequence

<220>

 

<400>2

ggcttctcagtgcgttacatccctggcttgtt 32

 

 

Claims (2)

1. utilize round pcr to obtain a method for a large amount of plasmid DNA fast, it is characterized in that:

(1) the template plasmid DNA sequence dna information design primer (upstream primer, downstream primer) obtained, as required, upstream and downstream primer is complementary with two template strands of plasmid DNA respectively and 5 ' of two primers hold 20 base complementrities;

(2) the primer pair 0.5 μ g template plasmid of design in step (1), is utilized to carry out pcr amplification;

(3), 2 μ L are got to the product obtained in step (2) carry out agarose electrophoresis, detect production concentration and stripe size, and remainder is saved backup in-20 ° of C.

2. utilize round pcr to obtain the method for a large amount of plasmid DNA fast according to claim 1, it is characterized in that pcr amplification reaction and agarose gel electrophoresis detecting step, comprising:

(1) PCR reaction system (50 μ L): 5 × TransStart FastPfu buffer 10 μ L, dNTPs(2.5 mM each) 5 μ L, upstream primer (10 mM) 2 μ L, downstream primer (10 mM) 2 μ L, template plasmid DNA 0.5 μ g, TransEco FastPfu DNA Polymerase 1 μ L, aqua sterilisa complements to 50 μ L;

(2) PCR response procedures: 95 ° of C 2 min; 95 ° of C 20 s, 50 ° of C 40 s, 72 ° of C 1 min, totally 25 circulations; 72 ° of C 5 min;

(3) agarose gel electrophoresis detects: take 0.4 g agarose powder, add in 40 mL 0.5 × tbe buffer liquid, microwave heating adds 2 μ L DNA staining fluid EB after agarose dissolves completely, mix, pour in glue groove while hot, and plug pecten, room temperature leaves standstill 20 more than min, vertically pecten is taken out after solidifying completely, the sepharose prepared is put into the electrophoresis chamber filling 0.5 × tbe buffer liquid, damping fluid should not have glue face, draw the loading wells that PCR primer that 2 μ L and sample-loading buffer mix adds sepharose, DNA molecular amount standard (DNA marker) is added wherein in a loading wells, switch on power electrophoresis 30 min under 5 V/cm conditions, after electrophoresis terminates, take out sepharose, be placed in imaging on ultraviolet transilluminator lightly, concentration and the size of amplified band is judged according to DNA molecular amount standard (DNA marker), residue PCR primer is saved backup in-20 ° of C.