CN104313019B - SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations - Google Patents
SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations Download PDFInfo
- Publication number
- CN104313019B CN104313019B CN201410524999.XA CN201410524999A CN104313019B CN 104313019 B CN104313019 B CN 104313019B CN 201410524999 A CN201410524999 A CN 201410524999A CN 104313019 B CN104313019 B CN 104313019B
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- seq
- sex
- fructus actinidiae
- female
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses an SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations, relating to the technical field of molecular genetic breeding. The male plant specific fragment nucleotide sequence of the molecular marker A002 is shown in SEQ.ID No.1; the female plant specific fragment nucleotide sequence is shown in SEQ.ID No.2; and the primer sequence is shown in SEQ.ID No.3 and SEQ.ID No.4. The molecular marker A002 can be used for the early identification detection of males and females of kiwi fruits so as to avoid the great waste caused by abundant male plants in the breeding and production; by utilizing a high-density genetic map, sex related molecular markers can be rapidly explored to assist the breeding and important practical experience is provided for the development of the functional markers; and being used for marker assisted selection of males and females, the molecular marker A002 is capable of greatly improving the selection efficiency of the female plants in the breeding and shortening the breeding period, and has great application potential and relatively high economic value.
Description
Technical field
The present invention relates to molecular genetic breeding technical field, more particularly to it is a kind of for Fructus actinidiae chinensiss hybrid Population male and female sex
SSR molecular marker A002 of identification（A002 is named to distinguish other SSR molecular markers, and A is Fructus actinidiae chinensiss latin nameActinidiaInitial）, i.e., for the early molecule assisted Selection of Fructus actinidiae chinensiss seedling male and female sex character, to improve breeding
Efficiency, reduces soil and human cost.
Background technology
Fructus actinidiae chinensiss（Actinidia chinensisPlanch.) rich in fruit vitamin C, dietary fiber and multi mineral
Nutrition, is described as " king of fruit ", is a kind of wholesome emerging high-grade fruit.With carrying rapidly for living standards of the people
Height, dramatically increases to the demand of high-quality and new varieties Fructus actinidiae chinensiss, and Fructus actinidiae chinensiss breeding efficiency is urgently lifted.Fructus actinidiae chinensiss are feature
Dioecian plant, with floral shape is similar but male and female organ is different female flower and male flower.The male and female of Fructus actinidiae chinensiss filial generation point
It is about 1 from ratio：1, in view of the sex function of the different strain of Actinidia, a small amount of staminiferous plant that pollinates of Chinese gooseberry garden generally configuration is to protect
Card orchard yield and fruit quality, remaining staminiferous plant are then removed.Used as perennial fruit tree, Fructus actinidiae chinensiss are faced with traditional breeding method
Juvenile phase length, the problems such as floor space is big.Fructus actinidiae chinensiss seedling can just bloom after the several years toward down being planted, using Fructus actinidiae chinensiss floral shape
The difference of structure can differentiate the male and female sex of plant, therefore substantial amounts of not result staminiferous plant gives breeding work in the several years before flowering
Cause greatly waste.Due to lacking the molecular marker that available Sex Determination in Actinidia differentiates, the morning of kiwi fruit plant
The work of phase sex identification is difficult to carry out always.SSR marker has high polymorphism, locus specificity, stability height and operation sequence letter
The advantage such as single, is a kind of codominant inheritance marks easy to detect.With reference to hereditism and genomics achievement in research, carry out macaque
Fructus Persicae molecular mark is studied, and is built economic, efficient molecular breeding technology system, is had become the weight of Fructus actinidiae chinensiss breeding
Want research direction.
The content of the invention
It is an object of the invention to overcome the shortcoming and defect that prior art is present, there is provided a kind of to hybridize group for Fructus actinidiae chinensiss
SSR molecular marker A002 of body male and female sex identification.
Specific requirement is：
Filter out the molecular marker A002 for the identification of Fructus actinidiae chinensiss early sex；
The preparation method of above-mentioned molecular marker A002 is provided；
Application of the above-mentioned molecular marker in Fructus actinidiae chinensiss sex identification and marker-assisted breeding is provided.
The object of the present invention is achieved like this：
Using Fructus actinidiae chinensiss dense genetic map, floral trait phenotypic character site is positioned, SSR is screened in Sex Determination interval
Labelling, finally giving to be used for the molecular marker of Fructus actinidiae chinensiss early sex identification, form the technical scheme of this invention.Fructus actinidiae chinensiss
The identification of plant early sex reduces breeding early stage to a great extent in the waste of soil, the means of production and human cost, has emphatically
The theoretical academic significance wanted and higher economic worth.
First, molecular marker A002
For SSR molecular marker A002 of Fructus actinidiae chinensiss hybrid Population male and female sex identification（Abbreviation molecular marker A002）, its
The specific fragment nucleotide sequence that staminiferous plant amplification is obtained is as shown in SEQ.ID No1；The specific fragment nucleoside that its female plant amplification is obtained
Acid sequence is as shown in SEQ.ID No2.
Molecular marker is that the simple sequence repeat polymorphisms based on Fructus actinidiae chinensiss Sex determination region is developed.According to sex phase
The sequence information design specific primer in region is closed, the pcr amplification product of molecular marker A002 shows as staminiferous plant and female plant respectively expands
Increasing obtains two bands of a spectrum, wherein a bands of a spectrum clip size is identical.The specific spectruming belt size that staminiferous plant amplification is obtained is 219bp, special
Heteroleptic nucleotide sequence is as shown in SEQ.ID No1；The female plant specific spectruming belt size that obtains of amplification is 230bp, specific fragment core
Nucleotide sequence is as shown in SEQ.ID No2.Actinidia can be distinguished by the size and specific nucleotide sequence of specific fragment
Sex.
Present invention also offers the primer of the above-mentioned molecular marker of amplification.
The primer sequence of the S001 labellings is as shown in SEQ.ID No3 and SEQ.ID No4.
2nd, molecular marker A002 preparation methods
Molecular marker A002 preparation methods comprise the following steps：
1. build Fructus actinidiae chinensiss dense genetic map；
2. collect sex phenotype and be converted to phenotypic markers；
3. phenotypic markers are positioned on genetic map；
4. Sex Determination interval is determined on genome sequence；
5. screen SSR marker in Sex Determination interval.
Its working mechanism is：
There are many simple sequence repeats in genome（SSR）There is height and make a variation in unit, its number.Due to specific
The flanking sequence of SSR is generally all the stronger unique sequence of conservative, thus can enter performing PCR according to flanking sequence synthetic primer
Amplification, so as to expand out by single microsatellite locus.It is due to the variation quantitatively of single microsatellite locus repetitives, individual
The amplified production of body just produces the polymorphism of length, and the polymorphism of allele is detected with this.
3rd, molecular marker A002 applications
Applications of the molecular marker A002 in Pyrusussuriensiss Fructus actinidiae chinensiss and A.chinensis Planch. ' osmanthus sea 4 ' hybrid Population
Using female plant genomic DNA and staminiferous plant gene in the primer amplification Fructus actinidiae chinensiss hybrid Population of above-mentioned molecular marker A002
Group DNA, pcr amplification product shows as staminiferous plant and female plant is respectively expanded and obtains two bands of a spectrum, wherein a bands of a spectrum clip size is identical.
The specific fragment nucleotide sequence that staminiferous plant amplification is obtained is as shown in SEQ.ID No1；The specific fragment nucleotide that female plant amplification is obtained
Sequence is as shown in SEQ.ID No2.Actinidia can be identified by the size and specific nucleotide sequence of specific fragment
Not.
In molecular marker A002 primers amplification Fructus actinidiae chinensiss genomic DNA, PCR reaction amplification systems are：
10 μ L reaction systems include that forward and reverse primer is each 0.2 μM, 0.2mM dNTPs, 2mM MgCl2, 1 μ l 10X Taq
Buffer, 0.5 units Taq polymerases, 50ng DNA templates.
In molecular labeling primer amplification Fructus actinidiae chinensiss genomic DNA, PCR amplification programs are：
95 DEG C of denaturations 5min；95 DEG C of degeneration 30s, 58 DEG C of annealing 35s, 72 DEG C of extension 50s, 33 circulations；72 DEG C of extensions
5-10min。
Pcr amplification product polyacrylamide gel electrophoresis（8%）.
The present invention has following advantages and good effect：
1. this molecular marker A002 can be used for the early stage identification and detection of Sex Determination in Actinidia, it is to avoid a large amount of staminiferous plants are in breeding
With greatly waste is caused in production；
2. dense genetic map is utilized, can quickly excavate the related molecular marker of sex is used for assistant breeding, is function
The exploitation of labelling is there is provided important practical experience；
3. this molecular marker A002 is used for male and female Sex-linked marker assisted Selection, and the selection for greatly improving female plant in breeding is imitated
Rate, shortens breeding cycle, with very big application potential and higher economic worth.
Description of the drawings
Fig. 1 is schematic diagrams of this molecular marker A002 in the 9th linkage group；
Fig. 2 is the polyacrylate hydrogel electrophoretogram that this molecular marker A002 is expanded in mass screening；
Fig. 3 is one of polyacrylate hydrogel electrophoretogram that this molecular marker A002 is expanded in hybrid Population female plant and staminiferous plant；
Fig. 4 is the two of the polyacrylate hydrogel electrophoretogram that this molecular marker A002 is expanded in hybrid Population female plant and staminiferous plant；
English to Chinese
1、SSR（Simple Sequence Repeats）Labelling：It is developed in recent years a kind of with special primer
Molecular marking technique based on PCR, also referred to as microsatellite DNA（Microsatellite DNA）, it is a class by several nucleoside
Acid（Generally 1～6）For repeat unit group into the tandem repetitive sequence up to tens nucleotide.
2、PCR：Polymerase Chain Reaction, polymerase chain reaction is body that the mid-80 grows up
Outer nucleic acid amplification technologies.
Specific embodiment
Describe in detail with reference to the accompanying drawings and examples：
If not specializing, the conventional handss that technological means used are well known to the skilled person in embodiment
Section.
First, the acquisition of molecular marker A002
Test site：Dawu County of Hubei China province；Test period：In April, 2014
Material：Test is from the group that 174 parts ' Pyrusussuriensiss ' and ' osmanthus sea 4 ' hybrid Population is Fructus actinidiae chinensiss Molecular and Genetic Study
Body, including 87 parts of Fructus actinidiae chinensiss staminiferous plants and 87 parts of Fructus actinidiae chinensiss female plants.Pyrusussuriensiss（A. rufa）Fructus actinidiae chinensiss Vitamin C content is extremely low,
Cold-resistant, resistance to storage, fruit stem base portion do not generate absciss layer, the characteristic with not shedding of surviving the winter.' osmanthus sea four ' (A. chinensis cv.
' GuiHai No.4 ') Vitamin C content height, wide adaptability, strong stress resistance, high temperature resistant arid, and anti-anthrax, sunscald
Ability is strong, and susceptible gene is low.
1. build Fructus actinidiae chinensiss dense genetic map
Using with respective merit and genetic affinity ' Pyrusussuriensiss ' farther out and ' osmanthus sea four ' build hybrid Population.Base
In the RAD-seq technologies of second filial generation sequencing, genome is carried out simplifying the SNP bases of sequencing, quick detection parent and segregating population
Because of type, genotypic database is built；The high density genetic linkage mapses of Fructus actinidiae chinensiss are built with 4.1 mapping softwares of JoinMap.
2. collect sex phenotype and be converted to phenotypic markers
The male and female sex of each individual plant in hybrid Population is collected, sex phenotype's database is set up, by female plant and staminiferous plant
Sex phenotype is converted to a phenotype molecular labeling.
3. phenotypic markers are positioned on genetic map
With reference to genotype SNP marker and phenotype molecular labeling, with 4.1 mapping softwares of JoinMap by sex phenotype's labelling
It is positioned in the on genetic linkage map No. 9 linkage group（See Fig. 1）.
4. Sex Determination interval is determined on genome sequence
SNP marker A002 near sex phenotype's labelling is arranged, the nucleotide sequence comparison of SNP marker A002 is arrived
Fructus actinidiae chinensiss genome sequence；Comparison result shows the neighbouring SNP marker of sex phenotype's labelling both from No. 25 chromosome,
Particular location is near 2Mb；Therefore, the 1.5-2.5Mb for Fructus actinidiae chinensiss sex relevant portions being locked in No. 25 chromosome is interval
It is interior.
5. screen SSR marker A002 in Sex Determination interval
Nucleotide sequence 1.5-2.5Mb interval on Fructus actinidiae chinensiss No. 25 chromosome of genome is extracted, is searched functional
Simple repeated sequence 30；Using Primer5.0 softwares, amplimer is designed for simple repeated sequence；Closed using design
Into primer, Fructus actinidiae chinensiss female plant and staminiferous plant are entered performing PCR amplification, grope suitable amplification condition, it is ensured that amplified band it is clear
Degree and stability；Screening obtains this molecular marker and can respectively expand in staminiferous plant and female plant obtaining a key band（See Fig. 2）.
2nd, the application of molecular marker A002
1st, one of the application of molecular marker in Pyrusussuriensiss Fructus actinidiae chinensiss and A.chinensis Planch. ' osmanthus sea 4 ' hybrid Population
87 parts of female plants in collection Hubei China province Dawu County's Pyrusussuriensiss Fructus actinidiae chinensiss and A.chinensis Planch. ' osmanthus sea 4 ' hybrid Population
With the leaflet tablet of 87 portions of staminiferous plants, plant genomic DNA is extracted；Using molecular labeling primer SEQ.ID No3 and SEQ.ID No4
174 parts of Fructus actinidiae chinensiss DNA samples are expanded.
PCR reacts amplification system：10 μ L reaction systems include that forward and reverse primer is each 0.2 μM, 0.2mM dNTPs, 2mM
MgCl2, 1 μ l 10X Taq buffer, 0.5 units Taq polymerases, 50ng DNA templates；
PCR amplification programs are：95 DEG C of denaturations 5min；95 DEG C of degeneration 30s, 58 DEG C of annealing 35s, 72 DEG C of extension 50s, 33
Individual circulation；72 DEG C of extension 5-10min.174 parts of sample standard deviation amplifications are to two bands of a spectrum, wherein one is the total bands of a spectrum of male and female plant.
In all of 87 portions of staminiferous plants, staminiferous plant specific amplified bands of a spectrum are obtained（SEQ.ID No1）；In all of 87 parts of female plants, obtain
Female plant specific amplified bands of a spectrum（SEQ.ID No2）；Fig. 3 shows what this molecule was expanded in being marked at hybrid Population female plant and staminiferous plant
Polyacrylate hydrogel electrophoretogram.
Qualification result：
2nd, application of the molecular marker in Pyrusussuriensiss Fructus actinidiae chinensiss and A.chinensis Planch. ' osmanthus sea 4 ' hybrid Population it two
In collection Hubei China province Wuhan City's Pyrusussuriensiss Fructus actinidiae chinensiss and A.chinensis Planch. ' osmanthus sea No. 4 ' hybrid Population 100 parts it is female
Strain and the leaflet tablet of 100 portions of staminiferous plants, extract plant genomic DNA；Using molecular labeling primer SEQ.ID No3 and SEQ.ID
No4 is expanded to 200 parts of Fructus actinidiae chinensiss DNA samples.
PCR reacts amplification system：10 μ L reaction systems include that forward and reverse primer is each 0.2 μM, 0.2mM dNTPs, 2mM
MgCl2, 1 μ l 10X Taq buffer, 0.5 units Taq polymerases, 50ng DNA templates；
PCR amplification programs are：95 DEG C of denaturations 5min；95 DEG C of degeneration 30s；58 DEG C of annealing 35s, 72 DEG C of extension 50s, 33
Individual circulation；72 DEG C of extension 5-10min.200 parts of sample standard deviation amplifications are to two bands of a spectrum, wherein one is the total bands of a spectrum of male and female plant.
In all of 100 portions of staminiferous plants, staminiferous plant specific amplified bands of a spectrum are obtained（SEQ.ID No1）；In all of 100 parts of female plants,
To female plant specific amplified bands of a spectrum（SEQ.ID No2）；
Fig. 4 shows poly- third that this molecular marker A002 sex identification is expanded in being marked at hybrid Population female plant and staminiferous plant
Alkene gel electrophoresis figure.
Qualification result
Sequence table
<110>Wuhan Botanical Garden, Chinese Acadmey of Sciences
<120>SSR molecular marker A002 of Fructus actinidiae chinensiss hybrid Population male and female sex identification
<140>
<141>
<160> 4
<210> 1
<211> 219
<212>Molecular marker
<400> TGGAACTGGTGGAGGAAGAGTTGTGAAGGAGGAGCAGCTGCAAATTTCTGACACGAAGGTGGC
TAACAAATCGGCTGGGACTGTTCAGAGAGAGAGAGAGATTGGAGGAAAGTGATAGGCTGCAAACTGCAGTGAGTTAG
GAGCAAATGTAAAGAGCGGCAAAAGTTGAGACTTGAGCATACTTGAGCATAGTACCAGCGGGCAAAGGGATTAGGGA
GT；
<210> 2
<211> 230
<212>Molecular marker
TGGAACTGGTGGAGGAAGAGTTGTGAAGGAGGAGCAGCTGCAAATTTCTGACACGAAGGTGGCTAACAAATCGGCTG
GGACTGTTCAGAGAGAGAGAGAGAAGAGAGAGAGATTGGAGGAAAGTGATAGGCTGCAAACTGCAGTGAGTTAGAAG
CAAATGTAAAGAGCGGCAAAAGTTGAGACTTGAGCATACTTGAGCATAGTACCAGCGGGCAAAGGGATTAGGGAGT；
<210> 3
<211> 24
<212>Primer -1
<400> TACTGACGGTCACTCCCTAATCCC；
<210> 4
<211> 24
<212>Primer -2
<400> CATGGATGGAACTGGTGGAGGAAG。
Sequence table
<110>Wuhan Botanical Garden, Chinese Acadmey of Sciences
<120>SSR molecular marker A002 of Fructus actinidiae chinensiss hybrid Population male and female sex identification
<140>
<141>
<160> 4
<210> 1
<211> 219
<212>Molecular marker
<400> TGGAACTGGTGGAGGAAGAGTTGTGAAGGAGGAGCAGCTGCAAATTTCTGACACGAAGGTGGC
TAACAAATCGGCTGGGACTGTTCAGAGAGAGAGAGAGATTGGAGGAAAGTGATAGGCTGCAAACTGCAGTGAGTTAG
GAGCAAATGTAAAGAGCGGCAAAAGTTGAGACTTGAGCATACTTGAGCATAGTACCAGCGGGCAAAGGGATTAGGGA
GT；
<210> 2
<211> 230
<212>Molecular marker
TGGAACTGGTGGAGGAAGAGTTGTGAAGGAGGAGCAGCTGCAAATTTCTGACACGAAGGTGGCTAACAAATCGGCTG
GGACTGTTCAGAGAGAGAGAGAGAAGAGAGAGAGATTGGAGGAAAGTGATAGGCTGCAAACTGCAGTGAGTTAGAAG
CAAATGTAAAGAGCGGCAAAAGTTGAGACTTGAGCATACTTGAGCATAGTACCAGCGGGCAAAGGGATTAGGGAGT；
<210> 3
<211> 24
<212>Primer -1
<400> TACTGACGGTCACTCCCTAATCCC；
<210> 4
<211> 24
<212>Primer -2
<400> CATGGATGGAACTGGTGGAGGAAG。
Claims (3)
1. a kind of SSR molecular marker A002 for Fructus actinidiae chinensiss hybrid Population male and female sex identification, it is characterised in that：
The amplimer sequence of SSR molecular marker A002 is as shown in SEQ ID NO.3 and SEQ ID NO.4；
The staminiferous plant specific fragment nucleotide sequence that amplification is obtained is as shown in SEQ ID NO.1；
The female plant specific fragment nucleotide sequence that amplification is obtained is as shown in SEQ ID NO.2.
2. the preparation method of SSR molecular marker A002 as described in claim 1, it is characterised in that comprise the following steps：
1. build Fructus actinidiae chinensiss dense genetic map；
2. collect sex phenotype and be converted to phenotypic markers；
3. phenotypic markers are positioned on genetic map；
4. Sex Determination interval is determined on genome sequence
SNP marker A002 near sex phenotype's labelling is arranged, by the nucleotide sequence comparison of SNP marker A002 to macaque
Fructus Persicae genome sequence；Comparison result shows the neighbouring SNP marker of sex phenotype's labelling both from No. 25 chromosome, specifically
Position is near 2Mb；Therefore, the 1.5-2.5Mb for Fructus actinidiae chinensiss sex relevant portions being locked in No. 25 chromosome is interval interior；
5. screen SSR marker in Sex Determination interval and extract 1.5-2.5Mb intervals on Fructus actinidiae chinensiss No. 25 chromosome of genome
Nucleotide sequence, searches functional simple repeated sequence 30；Using Primer5.0 softwares, for simple repeated sequence
Design amplimer；Using the primer of design synthesis, enter performing PCR amplification to Fructus actinidiae chinensiss female plant and staminiferous plant, grope suitable amplification
Condition, it is ensured that the definition and stability of amplified band；Screening obtains this molecular marker and can respectively expand in staminiferous plant and female plant
To a key band.
3. the amplimer SEQ ID NO.3 and SEQ ID NO.4 of SSR molecular marker A002 as described in claim 1 are on mountain
The application of male and female sex identification is carried out in pears Fructus actinidiae chinensiss and A.chinensis Planch. ' osmanthus sea 4 ' hybrid Population.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410524999.XA CN104313019B (en) | 2014-09-30 | 2014-09-30 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410524999.XA CN104313019B (en) | 2014-09-30 | 2014-09-30 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104313019A CN104313019A (en) | 2015-01-28 |
| CN104313019B true CN104313019B (en) | 2017-05-03 |
Family
ID=52368333
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410524999.XA Active CN104313019B (en) | 2014-09-30 | 2014-09-30 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104313019B (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561332B (en) * | 2015-01-20 | 2016-10-05 | 黑龙江省林业科学研究所 | A kind of SSR molecular marker identifying Populus davidiana sex and application thereof |
| CN106119350B (en) * | 2016-06-27 | 2019-06-14 | 西南林业大学 | Early stage identification ' Hort 16A ' Kiwi berry opening pollination offspring's property method for distinguishing |
| CN106367496B (en) * | 2016-08-30 | 2019-12-13 | 中国科学院华南植物园 | kiwi species associated specific single nucleotide molecular marker, detection primer group and application thereof |
| CN106868199B (en) * | 2017-04-27 | 2018-06-12 | 中国科学院武汉植物园 | A kind of molecular labeling and application with Kiwi berry soluble solid character QTL site close linkage |
| CN107022617B (en) * | 2017-04-27 | 2018-09-14 | 中国科学院武汉植物园 | A kind of molecular labeling and application for indulging diameter character QTL site close linkage with kiwifruit fruit |
| CN107385071B (en) * | 2017-08-25 | 2020-10-16 | 中国科学院武汉植物园 | Molecular marker primer for identifying male varieties of kiwi fruit Moshan series and application |
| CN107338318B (en) * | 2017-08-25 | 2020-10-16 | 中国科学院武汉植物园 | Molecular marker Geo101 primer for identifying male varieties of kiwi fruit Moshan series and application |
| CN108796111B (en) * | 2018-06-19 | 2021-06-11 | 中国科学院武汉植物园 | Molecular marker primer for identifying kiwi fruit and golden plum varieties and application |
| CN109055601B (en) * | 2018-09-30 | 2021-06-11 | 中国科学院武汉植物园 | Molecular marker primer for identifying kiwi fruit and kiwi fruit 2 variety and application |
| CN109055599B (en) * | 2018-09-30 | 2021-06-11 | 中国科学院武汉植物园 | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof |
| CN111394495B (en) * | 2020-03-02 | 2021-06-18 | 中国科学院武汉植物园 | General molecular marker primer for sex identification of commercial varieties of kiwi fruits and application |
| CN113403417B (en) * | 2021-07-21 | 2023-07-18 | 安徽农业大学 | SSR molecular marker AerM01 for sex identification of actinidia arguta and application thereof |
| CN113637784B (en) * | 2021-07-21 | 2023-07-18 | 安徽农业大学 | SSR molecular marker AerM02 for sex identification of actinidia arguta and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000042210A2 (en) * | 1999-01-15 | 2000-07-20 | International Paper Company | Microsatellite dna markers and uses thereof |
| CN101113469A (en) * | 2007-06-15 | 2008-01-30 | 易克 | Cucumber female deseription related molecule label and uses thereof |
-
2014
- 2014-09-30 CN CN201410524999.XA patent/CN104313019B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104313019A (en) | 2015-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104313019B (en) | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations | |
| CN104278097B (en) | For the SSR molecular marker A003 of Kiwifruit hybrid Population male and female sex identification | |
| CN104293942B (en) | For the SSR molecular marker A001 of Kiwifruit hybrid Population male and female sex identification | |
| CN107723378B (en) | The SNP marker and application of the seedless main effect QTL site SDL of grape fruit | |
| CN105349671B (en) | Microsatellite sequence and screening technique suitable for clean brook crow soft-shelled turtle population analysis | |
| Roychowdhury et al. | Molecular marker-assisted technologies for crop improvement | |
| CN105506149A (en) | Linkage SNP locus and CAPS marker of watermelon fruit sugar accumulation gene STP1 | |
| CN106755561A (en) | A kind of QTL related to soybean root dry weight, SNP marker and application | |
| CN106498048B (en) | One kind QTL relevant to soybean nodulation number, SNP marker and application | |
| CN107937397A (en) | SNP marker and its preparation method and application with tomato male sterility gene close linkage | |
| Zhu et al. | Genetic diversity of Aquilegia (Ranunculaceae) species and cultivars assessed by AFLPs | |
| CN113122651A (en) | SNP molecular marker linked with major QTL locus of lotus rhizome expansion character and application thereof | |
| CN106119397B (en) | Tomato spotted wilt resistant gene Sw-5b close linkages SNP site obtains and marker development | |
| CN102719543B (en) | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN108624710B (en) | SSR (simple sequence repeat) marker related to cucumber fruit length traits and application thereof | |
| CN104328197B (en) | Bluish dogbane expressed sequence tag microsatellite DNA mark | |
| CN108754005A (en) | A kind of screening technique of the SNP marker of Liriodendron genome | |
| CN108239675A (en) | A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower | |
| CN104313143B (en) | One and the closely linked molecule marker of common kidney bean anti-anthrax gene locus and detection method thereof | |
| CN106755562A (en) | A kind of QTL related to soybean rhizoplane area, SNP marker and application | |
| CN108165657B (en) | SSR (simple sequence repeat) marker related to cucumber fruit length traits and application thereof | |
| CN111944920A (en) | InDel marker closely linked with melon epidemic disease resistance gene and application thereof | |
| CN104894288A (en) | Dendrobium DNA (Deoxyribonucleic Acid) fingerprint spectrum and special primer and establishment method for dendrobium DNA fingerprint spectrum | |
| CN101338341B (en) | Process for marking high Vc content gene molecules of Chinese cabbage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |