CN106868199B - A kind of molecular labeling and application with Kiwi berry soluble solid character QTL site close linkage - Google Patents
A kind of molecular labeling and application with Kiwi berry soluble solid character QTL site close linkage Download PDFInfo
- Publication number
- CN106868199B CN106868199B CN201710286481.0A CN201710286481A CN106868199B CN 106868199 B CN106868199 B CN 106868199B CN 201710286481 A CN201710286481 A CN 201710286481A CN 106868199 B CN106868199 B CN 106868199B
- Authority
- CN
- China
- Prior art keywords
- kiwi berry
- soluble solid
- molecular labeling
- application
- ssc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of molecular labeling with Kiwi berry soluble solid character QTL site close linkage and applications, are SSC F according to the primer that the molecular labeling designs：5 ' TTGTCTTGATAGGCCCCTCG 3 ' and SSC R：5’‑CAACAAGACATGGTTCCTCACA‑3’.The present invention located the main effect QTL site that soluble solid is controlled in Kiwi berry for the first time, interpretable 19.61% phenotypic variance, pass through detection and the relevant molecular labeling of soluble solid character, i.e. predictable Kiwi berry soluble solid, and then the fine individual plant that accurate quick screening soluble solid is higher.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding fields, are more particularly to one kind and consolidate with Kiwi berry solubility
The molecular labeling of shape physical property shape QTL site close linkage and application.
Background technology
Kiwi berry is rich in vitamin C, dietary fiber and several mineral materials nutrition, is a kind of health favored by consumers
Fruit.China is the original centre of origin of actinidia, and Actinidia is extremely abundant, and genetic diversity is high, and China gathers around
Have 96% or so of whole world Kiwi berry species resource sum.By abundant natural resources, selection and breeding polymerize the new of merit
Kind plays a key effect to the healthy and stable development of Kiwi berry industry.Soluble solid is all chemical combination for being dissolved in water
The general name of object is one of an important factor for influencing fruit quality flavor including sugar, acid, vitamin, minerals etc..Therefore, increase
Soluble solid content is most important to improving kiwifruit fruit quality, is one of important goal of Kiwi berry breeding.
In traditional Kiwi berry breeding, it is the main difficulty for influencing breeding efficiency that juvenile phase is long, plantation takes up a large area etc..With
The fast development of molecular biology and sequencing technologies was gradually being selected the selection of character from Phenotypic Selection to genotype
It crosses.Molecular mark can sieve individual using with objective trait gene close linkage or the molecular labeling isolated
Choosing, to achieve the purpose that improve objective trait efficiency of selection, shorten the breeding time limit.In recent years, in fruit trees such as apple, pears, grapes
In, Main Agronomic Characters molecular labeling is successfully developed, carrying out assisted Selection using molecular labeling also reaches its maturity.However,
Kiwi berry Main Agronomic Characters position and related molecular marker development is deficienter.2013, Kiwi berry draft genome
Be published as genomics research and Kiwi berry marker assisted selection provides important foundation.It is high subsequently, based on structure Kiwi berry
Density genetic collection of illustrative plates develops 3 gender identification markings, carries out sex identification in breeding early stage, avoids man power and material's
Waste.Economical character QTL positioning is exactly on the basis of hereditary segregating population, by molecular labeling and genetic map, utilizes QTL
Mapping software analyzes the quantitative trait phenotypes data of segregating population, so that it is determined that Quantitative Trait Genes are on chromosome
Position and effect.Using genetic linkage maps, carry out quantitative trait locus (Quantitative Trait with reference to phenotypic data
Loci, QTL) scanning, it has also become the complicated Quantitative Genetics rule of parsing, effective position key economical character, exploitation association molecule
Label and the effective means that Seedling selection is carried out to merit.
At present, to the QTL of Kiwi berry important quality character soluble solid positioning and excavation and soluble solid
Relevant molecule marking research is not yet carried out.Carry out Kiwi berry soluble solid QTL research, based on QTL site information into
Row molecular marker screening helps to improve the breeding efficiency to Kiwi berry soluble solid character determination, saves breeding cost,
Promote Kiwi berry industrial economy benefit.
Invention content
The object of the present invention is to provide a kind of base of chromosome the 16301870th of Kiwi berry the 23rd in Kiwi berry
Application in soluble solid content screening breeding, sets including being directed to the base of chromosome the 16301870th of Kiwi berry the 23rd
Application of the primer of meter in Kiwi berry soluble solid content screens breeding, including including No. 23 chromosome of Kiwi berry
Application of the Kiwi berry sequence of 16301870th base in Kiwi berry soluble solid content screens breeding.
The object of the present invention is to provide a kind of points with Kiwi berry soluble solid character QTL site close linkage
The primer of son label, primer SSC-F：5 '-TTGTCTTGATAGGCCCCTCG-3 ' and SSC-R：5’-
CAACAAGACATGGTTCCTCACA-3’。
In order to achieve the above object, the present invention takes following technical measures：
A kind of acquisition of molecular labeling with Kiwi berry soluble solid character QTL site close linkage：
1. contained using the small sorb Kiwi berry ' MT570001 ' Kiwi berry of soluble solid content and soluble solid
Measure big Chinese gooseberry ' osmanthus sea 4 ' hybridization structure F1Segregating population.In group's result the 6th year, 125 plants of F are selected1Group
Offspring's single plant be research object.
2. acquiring 125 parts of single-strain blades of group, total DNA is extracted using CTAB methods.China Mi is built according to RADseq methods
Monkey peach ' osmanthus sea 4 ', library and the sequencing of sorb Kiwi berry ' MT570001 ' and 125 plants of filial generations.
3. sequencing data is filtered, removal low quality base contents are more than 50% sequence, and rejecting has sequence measuring joints
Pollution and the sequence largely repeated.The sequencing data for meeting filter criteria is compared to reference gene group using software SOAP2, it is right
Each sample carries out Mutation detection, hereditary form of the statistics polymorphic site in group.
4. build the Kiwi berry genetic map based on SNP marker using Joinmap4.0 analysis softwares.Heredity point will be met
Polymorphism mark site from rule is imported by Joinmap4.0 software formats, rejects shortage of data rate in 10% site, row
Except site is significantly detached partially, dense genetic map is built using Kosambi mapping functions.
5. in fructescence, to Chinese gooseberry ' osmanthus sea 4 ', sorb Kiwi berry ' MT570001 ' and 125 group of hills
The soluble solid content of body single plant fruit measures.Each sample 20 fruits of random acquisition, use ATAGO
The digital refractometers of Palette PR-32 α measure soluble solid content.
6. the genotype data of sample soluble solid content data and label is imported into MapQTL5.0 softwares, selection
More Interval Mappings, setting LOD threshold values are 3.0, and QTL positioning analysis is carried out to Kiwi berry soluble solid.It eventually detects
With the relevant main effect QTL site of soluble solid, the contribution rate to the character is 19.61%, which marks with corresponding SNP
It is 108.6cM to remember the genetic distance in linkage group.
7. the sequence of the 16301870th each 100bp of base upstream and downstream of No. 23 chromosome of Kiwi berry is extracted, according to design
Primer principle, exploitation design SNP marker primer.Forward primer SSC-F is 5 '-TTGTCTTGATAGGCCCCTCG-3 ', is reversely drawn
Object SSC-R is 5 '-CAACAAGACATGGTTCCTCACA-3 '.Amplified production size is 157bp.
Protection scope of the present invention includes：The base of chromosome the 16301870th of Kiwi berry the 23rd is in Kiwi berry solubility
Application in solid content screening breeding or the primer based on the design of the chromosome the 16301870th of Kiwi berry the 23rd base exist
Sequence is in Kiwi berry solubility solid shown in application or SEQ ID NO.3 in the screening breeding of Kiwi berry soluble solid
Application in object screening breeding.
Above-described application, using the prior art, to the 16301870th of No. 23 chromosome of Kiwi berry to be checked the
A base is detected, and realizes the breeding objective that early screening is carried out to Kiwi berry soluble solid.
The positive effect of the present invention：
The present invention located the main effect QTL site that soluble solid is controlled in Kiwi berry for the first time, can be explained 19.61%
Phenotypic variance.In conventional breeding methods, soluble solid content will wait until that the maturity period measures in kiwifruit fruit, and waste is big
Time and efforts is measured, and efficiency of selection is low, and by detection and the chain molecular labeling in soluble solid main effect site, it can
To be selected in seedling stage, not only save production cost but also greatly improve efficiency of selection.Kiwi berry solubility is consolidated in the present invention
The major gene loci locality specific of shape object, the detection method in molecular labeling site is convenient and efficient, not affected by environment.Pass through inspection
It surveys and the relevant molecular labeling of soluble solid character, you can prediction Kiwi berry soluble solid, and then accurate quick sieve
Select the fine individual plant that soluble solid content is high.
Specific embodiment
Technical solution of the present invention is routine techniques if not otherwise specified；The reagent or material are not said especially such as
It is bright, derive from commercial channel.
Embodiment 1：
The acquisition of chain molecular labeling with Kiwi berry soluble solid main effect QTL and exploitation：
1. consolidated in the present embodiment using the small sorb Kiwi berry ' MT570001 ' Kiwi berry of soluble solid and solubility
Shape object big Chinese gooseberry ' osmanthus sea 4 ' hybridization structure F1Segregating population.In group's result the 6th year, 125 plants of F are selected1Group
Offspring's single plant of body is research object.
2. acquiring 125 parts of single-strain blades of group, total DNA is extracted using CTAB methods.China Mi is built according to RADseq methods
Monkey peach ' osmanthus sea 4 ', library and the sequencing of sorb Kiwi berry ' MT570001 ' and 125 plants of filial generations.
3. sequencing data is filtered, removal low quality base contents are more than 50% sequence, and rejecting has sequence measuring joints
Pollution and the sequence largely repeated.The sequencing data for meeting filter criteria is compared to reference gene group using software SOAP2, it is right
Each sample carries out Mutation detection, hereditary form of the statistics polymorphic site in group.
4. build the Kiwi berry genetic map based on SNP marker using Joinmap4.0 analysis softwares.Heredity point will be met
Polymorphism mark site from rule is imported by Joinmap4.0 software formats, rejects shortage of data rate in 10% site, row
Except site is significantly detached partially, dense genetic map is built using Kosambi mapping functions.
5. in fructescence, to Chinese gooseberry ' osmanthus sea 4 ', sorb Kiwi berry ' MT570001 ' and 125 group of hills
Body single plant soluble solid content measures.Each sample 20 fruits of random acquisition, use ATAGO Palette PR-
The digital refractometers of 32 α measure soluble solid content.
6. it is soft that the genotype data of the phenotypic data of sample mean soluble solid and label is imported MapQTL5.0
Part selects more Interval Mappings, and setting LOD threshold values are 3.0, and QTL positioning analysis is carried out to Kiwi berry soluble solid.Finally
Detect with the relevant main effect QTL site of soluble solid, be 19.61% to the contribution rate of the character, the site with it is corresponding
Genetic distance of the SNP marker in linkage group be 108.6cM.
7. the sequence of the 16301870th each 100bp of base upstream and downstream of No. 23 chromosome of Kiwi berry is extracted, according to design
Primer principle, exploitation design SNP marker primer.Forward primer SSC-F is 5 '-TTGTCTTGATAGGCCCCTCG-3 ', is reversely drawn
Object SSC-R is 5 '-CAACAAGACATGGTTCCTCACA-3 '.Amplified production size is 157bp.
Chinese gooseberry ' osmanthus sea 4 ' in the sequence that expands for shown in SEQ ID NO.3；
The sequence expanded in sorb Kiwi berry ' MT570001 ' is shown in SEQ ID NO.4.
8. parting is carried out to soluble solid using high-resolution solubility curve (HRM) technology.According toPremix
Ex TaqTMII (Tli RNaseH Plus), ROX plus kits explanation, designs 20uL reaction systems：5ng·uL-1Macaque
Peach genomic DNA template 2ul, 2 × SYBR Premix 10ul, 50 × ROX Dye II 0.4ul, 10uM SSC-F and SSC-R
Each 0.8ul, distilled water supply surplus.Amplification program is：95 DEG C of pre-degenerations 5s, 60 DEG C of annealing 1min；95 DEG C of denaturation 5s, 60 DEG C are moved back
Fiery 30s carries out 35 cycles.Dissolving program is：95℃15s；60 DEG C of 1min, then from 60-95 DEG C of continuous warming, often increase 0.3
DEG C 1 fluorescence is collected, 95 DEG C of 15s are finally cooled to 40 DEG C.It is molten that amplified production is automatically generated in Gene Scan ning softwares
Solution curve.
9. the amplified production solubility curve to the molecular labeling is analyzed, 125 filial generations are divided into two genoid types.
In line style grouping 1 (with parent's Chinese gooseberry ' osmanthus sea 4 ' solubility curve identical), 66 offspring's single plants are average soluble solid
Shape object content is 14.7%；Line style is grouped in 2 (identical with the solubility curve of parent's sorb Kiwi berry ' MT570001 '), after 59
Soluble solid is averaged as 11.2% for single plant.Conspicuousness inspection is carried out to the average soluble solid of 125 hybrid generations
It surveys, analysis shows that the average soluble solid difference of two genoid types individual is 3.5%, difference extremely significantly (P<0.005).
Therefore, it is analyzed by the measure to soluble solid and HRM analysis results, it was demonstrated that the specific molecular marker can detect macaque
The difference of peach soluble solid.
Embodiment 2：
A kind of and Kiwi berry soluble solid character QTL site close linkage molecular labeling is in Kiwi berry breeding
Using step is：
(1) with the sorb Kiwi berry that winter resistance is high, disease resistance is good but soluble solid content is low as female parent, fruit
The Chinese gooseberry that real flavor is good and soluble solid content is high obtains F for paternal hybrid1In generation, chooses F1For 60 in group
Single plant is research object.
(2) in fructescence, F is acquired1For the fruit of 60 single plants of group, each 20 fruits of sample random acquisition,
Soluble solid content is measured using the digital refractometers of ATAGO Palette PR-32 α.
(3) F is extracted1The total DNA of 60 single plants of generation, according toPremix Ex TaqTMII(Tli RNaseH
Plus), ROX plus kits illustrate, design 20uL reaction systems：5ng·uL-1Kiwi berry genomic DNA template 2ul, 2 × S
YBR Premix 10ul, 50 × ROX Dye II each 0.8ul of 0.4ul, 10uM SSC-F and SSC-R, distilled water supply surplus.
Amplification program is：95 DEG C of pre-degenerations 5s, 60 DEG C of annealing 1min；95 DEG C of denaturation 5s, 60 DEG C of annealing 30s carry out 35 cycles.Dissolving
Program is：95℃15s；60 DEG C of 1min, then from 60-95 DEG C of continuous warming, often increase 0.3 DEG C of collection, 1 fluorescence, 95 DEG C of 15s, most
After be cooled to 40 DEG C.Amplified production solubility curve is automatically generated in Gene Scanning softwares.
The amplified production solubility curve of the molecular labeling is analyzed, 60 filial generations are divided into two genoid types.Line
In type grouping 1 (with parent's Chinese gooseberry ' osmanthus sea 4 ' solubility curve identical), the average soluble solid of 27 offspring's single plants
Object content is 14.2%；Line style is grouped in 2 (identical with the solubility curve of parent's sorb Kiwi berry ' MT570001 '), 33 offsprings
Single plant is averaged soluble solid content as 11.8%.Conspicuousness inspection is carried out to the average soluble solid of 60 hybrid generations
It surveys, analysis shows that the average soluble solid difference of two genoid types individual is 2.4%, difference extremely significantly (P<0.005).
Therefore, it is analyzed, illustrated through molecular marker assisted selection solubility by the measure to soluble solid and HRM analysis results
Solid content site can significantly improve efficiency of selection.
Claims (3)
1. detection includes the reagent of the Kiwi berry sequence of Kiwi berry the 16301870th base of No. 23 chromosome in Kiwi berry
Application in soluble solid screening breeding, the sequence is shown in SEQ ID NO.3.
2. it is sieved for the primer of the chromosome the 16301870th of Kiwi berry the 23rd base design in Kiwi berry soluble solid
Application in select index.
3. application according to claim 2, the primer is SSC-F：5 '-TTGTCTTGATAGGCCCCTCG-3 ' and
SSC-R：5’-CAACAAGACATGGTTCCTCACA-3’.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710286481.0A CN106868199B (en) | 2017-04-27 | 2017-04-27 | A kind of molecular labeling and application with Kiwi berry soluble solid character QTL site close linkage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710286481.0A CN106868199B (en) | 2017-04-27 | 2017-04-27 | A kind of molecular labeling and application with Kiwi berry soluble solid character QTL site close linkage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106868199A CN106868199A (en) | 2017-06-20 |
| CN106868199B true CN106868199B (en) | 2018-06-12 |
Family
ID=59161494
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710286481.0A Active CN106868199B (en) | 2017-04-27 | 2017-04-27 | A kind of molecular labeling and application with Kiwi berry soluble solid character QTL site close linkage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106868199B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313019A (en) * | 2014-09-30 | 2015-01-28 | 中国科学院武汉植物园 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
-
2017
- 2017-04-27 CN CN201710286481.0A patent/CN106868199B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313019A (en) * | 2014-09-30 | 2015-01-28 | 中国科学院武汉植物园 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
Non-Patent Citations (3)
| Title |
|---|
| Draft genome of the kiwifruit Actinidia chinensis;Shengxiong Huang etal.;《nature communications》;20131018;第1-9页 * |
| High-density interspecific genetic maps of kiwifruit and the identification of sex-specific markers;Qiong Zhang etal.;《DNA research》;20151231;第22卷(第5期);第367-375页 * |
| 猕猴桃种间高密度遗传图谱的构建及果实性状QTLs定位;刘春燕等;《中国博士学位论文全文数据库农业科技辑》;20160915(第9期);第73-77页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106868199A (en) | 2017-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109706263A (en) | Chain SNP marker and application with wheat stripe rust resisting ospc gene QYr.sicau-1B-1 | |
| CN109825621A (en) | Wheat spikelet number QTL chain SNP marker and its application | |
| CN106480228B (en) | The SNP marker and its application of rice low cadmium-accumulation gene OsHMA3 | |
| CN106591457B (en) | A kind of identification is located at the SNP marker exploitation and its application of the clubroot Resistance QTL on Chinese cabbage A03 chromosome | |
| CN108004344A (en) | A kind of corn whole genome SNP chip and its application | |
| CN106048042B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits color traits | |
| CN106191240B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits epidermal hair character | |
| CN109554493A (en) | The SNP marker and its detection method of a kind of plum blossom weeping branch character close linkage and application | |
| CN107488659B (en) | Sequence related to red and yellow color characters of citrus peels and application thereof | |
| CN105506149A (en) | Linkage SNP locus and CAPS marker of watermelon fruit sugar accumulation gene STP1 | |
| CN110499387A (en) | A kind of molecular labeling and its application that the long QTL of wheat flag leaf is chain | |
| CN112289384B (en) | Construction method and application of citrus whole genome KASP marker library | |
| CN109762812A (en) | Wheat growth gesture related SNP and its as target spot identification wheat growth gesture character in application | |
| CN108504773B (en) | Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker | |
| CN109868323A (en) | A kind of kind duck egg laying performance associated gene SMAD3 method for screening molecular markers | |
| CN113774161A (en) | KASP molecular marker of peanut pod and kernel size major QTL and application thereof | |
| CN114774570B (en) | Molecular marker closely linked with wheat stem rot resistance QTL and application | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN104789648B (en) | Identify molecular labeling and its application of the section haplotypes of rice CMS restoring genes Rf 1 | |
| CN109182557A (en) | A kind of SNP marker and its application for identifying Pelteobagrus vachelli low dissolved oxygen tolerance and coefficient of condition | |
| CN109182592A (en) | Chain SNP marker and application with rape multi-branched character main effect QTL site | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN106460063A (en) | SNP combination for Chinese cabbage genetic resources diversity analysis and molecular breeding and application thereof | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN106868199B (en) | A kind of molecular labeling and application with Kiwi berry soluble solid character QTL site close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |