CN104312967A - Gene cluster expression strengthened recombinant streptomyces diastatochromogenes and construction method thereof - Google Patents
Gene cluster expression strengthened recombinant streptomyces diastatochromogenes and construction method thereof Download PDFInfo
- Publication number
- CN104312967A CN104312967A CN201410506760.XA CN201410506760A CN104312967A CN 104312967 A CN104312967 A CN 104312967A CN 201410506760 A CN201410506760 A CN 201410506760A CN 104312967 A CN104312967 A CN 104312967A
- Authority
- CN
- China
- Prior art keywords
- streptomyces diastatochromogenes
- gene cluster
- toy
- diastatochromogenes
- toyokamycin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
Abstract
The invention discloses a gene cluster expression strengthened recombinant streptomyces diastatochromogenes and a construction method thereof. The gene cluster expression strengthened recombinant streptomyces diastatochromogenes excessively expresses a whole toy gene cluster for biosynthesizing toyocamycin and has stronger toyocamycin synthetic capability than streptomyces diastatochromogenes 1628. A construction process comprises the following steps: 1) constructing an expression vector pSET152-toyAM; and 2) integrating the expression vector into chromosome of the streptomyces diastatochromogenes by utilizing a conjugative transferring method to obtain an engineering bacterium. According to the construction method disclosed by the invention, specificity of the vector pSET152-toyAM is integrated into the chromosome of the streptomyces diastatochromogenes 1628 by utilizing the conjugative transferring method to obtain an engineering bacterium with genetic stability. Compared with an original strain, the gene cluster expression strengthened recombinant streptomyces diastatochromogenes has the advantage that the yield of toyocamycin is increased by 4.5 times.
Description
Technical field
The present invention relates to and improve toyokamycin output by intensifying genes bunch toy AM in the expression of streptomyces diastatochromogenes, belong to gene engineering technology field.
Background technology
Toyokamycin is a kind of novel nucleoside microbiotic, and molecular formula is C
12h
13n
5o
4, ribose C
1connect the deazapurine ring of similar guanine, core texture is pyrrolopyrimidine nucleoside analog.The mechanism of action mainly affects the growth of thalline by suppressing transcribing of microorganism, its bioactivity research report mainly concentrates on clinical medicine domain.Studies have found that toyokamycin has good prevention effect to various plants epidemic disease in the recent period, life-time service can not cause environmental pollution, and also has certain regulating effect to plant-growth.Therefore, the application potential that has in field of agricultural plant disease control of toyokamycin.Relative to chemical synthesis, biological process synthesis toyokamycin take renewable resources as raw material, and have reaction conditions gentleness, pollute less and the advantage such as with low cost, therefore, biological synthesis process is the both economical effective means of current toyokamycin suitability for industrialized production.
Toyokamycin belongs to secondary metabolite, and route of synthesis is complicated, is subject to restriction and the regulation and control of many factors, causes toyokamycin synthesis level lower, be difficult to large-scale production.The existing way solving this problem is all generally by the production bacterial strain of traditional selection by mutation as Main Means screening high yield and high quality, but the uncertain factor screening high efficient strain is many, the cycle is long.
The output how utilizing the advanced technique means improvement microorganisms such as molecular biology to improve toyokamycin further becomes a feasible thinking.The people such as McCarty are with a strain synthesis toyokamycin bacterial strain
streptomyces rimosus(ATCC14673) be initial research object, clone biosynthesizing toyokamycin gene cluster, illustrate building-up process and the regulatory mechanism of toyokamycin, research finds that toyokamycin is precursor by GTP, through polystep reaction synthesis toyokamycin, the biosynthesizing of toyokamycin is wherein responsible for by toyAM gene, and cluster arrangement (gene cluster).This research group in the research in early stage with the toyokamycin with independent intellectual property right produce bacterial strain streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 be research object, clone the part-structure gene in gene cluster, as toyB, toyF etc., and attempted existing
s. diastatochromogenesoverexpression in 1628, has also cloned simultaneously
s. diastatochromogenesbe responsible for the multiple-effect regulatory factor adpA of secondary metabolism in 1628, but the amplitude of toyokamycin output increased only has 20%-30%, still has much room for improvement for suitability for industrialized production.Utilize metabolic engineering technology to increase the copy number of original strain biosynthesizing toyokamycin gene cluster instead of single structure gene, thus increase the metabolic flux of toyokamycin synthesis and to improve toyokamycin output complicated and have no relevant report because relate to problem.
Summary of the invention
In order to overcome the deficiencies in the prior art, the invention provides restructuring streptomyces diastatochromogenes and construction process and purposes that a kind of intensifying genes bunch toyAM expresses.
Streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 are strain Antagonistic Actinomycetes, its fermented liquid has stronger restraining effect to various plants pathogenic fungi, through separation and Extraction, determine that its principle active component is toyokamycin, the copy number that there is not yet by increasing streptomyces diastatochromogenes toyokamycin biological synthesis gene cluster improves toyokamycin and produces quantifier elimination report.
The present invention first from streptomyces diastatochromogenes (
streptomyces diastatochromogenes) the responsible biosynthetic gene cluster toyAM of toyokamycin of the middle clone of 1628 (deposit number of bacterial strain is CGMCC NO. 2060), and this gene cluster is connected with streptomycete integrative plasmid pSET152, successfully construct the recombinant vectors pSET152-toyAM of gene cluster toyAM, and utilize conjugal transfer method by its specific be incorporated into streptomyces diastatochromogenes (
streptomyces diastatochromogenes) on 1628 karyomit(e)s.
Strengthen the restructuring streptomyces diastatochromogenes that gene cluster toyAM expresses, its overexpression gene cluster toyAM, have than deposit number be CGMCC NO. 2060 streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 higher toyokamycin abilities to express.
Described original bacteria be streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628.
Described gene cluster toyAM come from original bacteria streptomyces diastatochromogenes to be reorganized (
streptomyces diastatochromogenes) 1628.
Described gene cluster toyAM be integrated into original bacteria streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 karyomit(e)s.
The described construction process strengthening the restructuring streptomyces diastatochromogenes that gene cluster toyAM expresses, process is as follows:
1) construction of expression vector pSET152-toy AM;
2) utilize conjugal transfer method that described expression vector is integrated into streptomyces diastatochromogenes karyomit(e), the restructuring streptomyces diastatochromogenes described in acquisition.
Utilize carrier pSET152 to realize the overexpression of gene cluster toy AM, utilize conjugal transfer method by specific for carrier pSET152-toy AM be integrated into streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 karyomit(e), obtain the restructuring streptomyces diastatochromogenes of inheritance stability.
The described purposes strengthening the restructuring streptomyces diastatochromogenes that gene cluster toyAM expresses, ferment restructuring streptomyces diastatochromogenes, compared with original strain, and toyokamycin output increased 4.5 times.
Beneficial effect of the present invention:
The present invention strengthens toyokamycin biological synthesis gene cluster toy AM and not only successfully expresses in streptomyces diastatochromogenes, and compared with original bacteria, toyokamycin output increased 4.5 times, unexpectedly, for improving toyokamycin output further, realize large-scale industrial production early and established good basis, there are expected market outlook.
Accompanying drawing explanation
Fig. 1 is the structure schematic diagram of recombinant plasmid pSET152-toy AM.
Fig. 2 is the digestion verification of recombinant plasmid pMD18-T-toyAM.
1. DNA Marker DL2000; 2. λ DNA/
hind III Marker; 3. plasmid pMD18-T-toyAM; 4. pMD18-T-toyAM/
bamh I.
Fig. 3 is the restriction enzyme digestion and electrophoresis proof diagram of restructuring shuttle expression plasmid pSET152-toy AM.
1. λ DNA/
Hind III Marker;2. pSET152-toy AM/
BamH I。
Fig. 4 is
s. albusj1704-TOY AM HPLC detects toyokamycin figure;
A. original strain
s. albusj1074; B. recombinant bacterial strain
s. albusj1074-TOY AM.
Fig. 5 is recombinant bacterium
s. diastatochromogenesthe PCR electrophoresis proof diagram of 1628-TOY AM;
1. DL2000 Marker; 2-3. engineering strain; 4. original strain.
Embodiment
Below in conjunction with the drawings and specific embodiments, the present invention is described further.
embodiment 1:the amplification of gene cluster toyAM and biological function verification
With
s. diastatochromogenes1628 chromogene groups are template, with Ptoy F
bamhI and PtoyF R
bamhI is primer, and pcr amplification obtains and contains
bamthe gene cluster toy AM gene of HI restriction enzyme site, be connected with pMD18-T Vector, build cloning vector pMD18-T-toy AM, cloning vector pMD18-T-toy AM is converted in recipient E. coli, coat on the LB agar plate containing ammonia benzyl resistance, after 37 DEG C of overnight incubation, serve Hai Shenggong after random picking positive transformant enzyme cuts qualification and check order and carry out sequential analysis, use
bamhI enzyme is cut and is obtained two ends and contain
bamthe gene cluster toy AM of HI restriction enzyme site, with same utilization
bamhI enzyme is cut and dephosphorylized streptomycete integrative shuttle expression vector pSET152 connects, and obtains restructuring shuttle expression carrier pSET152-toy AM.After digestion verification, proceeded to
e.coliET12567 (pUZ8002), the LB flat board of that resistance of card and apramycin resistance screens positive transformant
e.colieT12567 (pUZ8002, pSET152-toy AM), with
e.colieT12567 (pUZ8002, pIB139-toyF) is donor, pattern streptomycete
streptomyces albusj1074 is acceptor, utilizes conjugal transfer method that pSET152-toy AM is incorporated into streptomycete
s. albuson J1074 karyomit(e), apramycin resistance MS flat board screens positive zygote, namely obtain restructuring streptomycete J1074-TOY AM.
With
s. diastatochromogenes1628 karyomit(e)s are template, and design two primers, pcr amplification toy AM, design of primers is as follows:
toy F
BamHI:5’-CGC
GGATCCATGTATCGCACAGACGACGGACC-3’
toy R
BamHI:5’-CGC
GGATCCATGGCTTTTCGGATCACC -3’
Recombinant plasmid pMD18-T-toy AM is with restriction enzyme
bamas shown in Figure 2, recombinant plasmid pMD18-T-toy AM enzyme cuts the DNA fragmentation of acquisition about 11 kb and 2.7kb to HI digestion verification, in the same size respectively with gene cluster toy AM and plasmid pMD18-T, illustrates that recombinant cloning vector connects correct.Check order to recombinant plasmid pMD18-T-toy AM, sequential analysis shows that Insert Fragment is the sequence of 10410 bp, the S. ahygroscopicus announced with NCBI (
s. ahygroscopicus) toyokamycin synthetic gene cluster gene sequence homology is up to 89%.Gene cluster nucleotide sequence is as shown in SEQ ID NO:1.
Integrated restructuring shuttle expression plasmid pSET152-toy AM's
bamhI digestion verification result as shown in Figure 3, recombinant plasmid pSET152-toy AM warp
bamhI enzyme cut the fragment of release 11 kb and gene cluster toy AM in the same size, illustrate that plasmid pSET152-toy AM builds correct, be incorporated into pattern streptomycete with conjugal transfer method
streptomyces albuson the karyomit(e) of J1074, on apramycin resistance flat board, the some single bacterium colonies of random picking are cultivated repeatedly in CP substratum, extract karyomit(e).PCR experiment all can amplify apramycin resistance gene
apr, prove recombinant bacterium
s. albusj1074-TOY AM successfully constructs, and inheritance stability.To recombinant bacterium J1074-TOYF and original bacteria
s. albusj1074 carries out 250 mL shake flask fermentation experiments, from fermentation angle pair
s. albusin J1074, the function of gene cluster toyAM is verified.Reciprocal shaker rotating speed is 200 r/min, 28 DEG C, and fermentation 96h, control group is streptomycete
s. albusj1074.As shown in Figure 4, recombinant bacterium can detect toyokamycin characteristic peak, and repeatability is good.Illustrate that the gene cluster toyAM that clone obtains has biological function, the biosynthesizing of toyokamycin can be realized.
embodiment 2:the structure of streptomyces diastatochromogenes recombinant bacterium
With conjugal transfer method recombinant plasmid pSET152-toy AM is incorporated into streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 karyomit(e) on, on apramycin resistance flat board, the some single bacterium colonies of random picking are cultivated repeatedly in CP substratum, extract karyomit(e).PCR experiment all can amplify apramycin resistance gene
apr(Fig. 5), prove that restructuring streptomyces diastatochromogenes 1628-TOYAM successfully constructs, and inheritance stability.
embodiment 3:the leavening property checking of streptomyces diastatochromogenes original bacteria and recombinant bacterium
With original strain
s. diastatochromogenes1628 compare, and the transcriptional activity of the structure gene in recombinant bacterium 1628-TOYAM biosynthesizing toyokamycin gene cluster is all apparently higher than original strain
s. diastatochromogenes1628.To recombinant bacterium 1628-TOY and original bacteria
s. diastatochromogenes1628 carry out 250 mL shake flask fermentation experiments, verify from the raising effect of increase to toyokamycin output of fermentation angle to biosynthesizing toyokamycin gene cluster copy number and transcriptional activity streptomyces diastatochromogenes.Reciprocal shaker rotating speed is 200 r/min, 28 DEG C, fermentation 96h, and control group is that streptomyces diastatochromogenes sets out strain.As shown in table 1, the output of recombinant bacterium toyokamycin is higher than original bacteria, and recombinant bacterium toyokamycin ultimate capacity reaches mg/L, and comparatively original bacteria improves 4.5 times, and repeatability is good.Illustrate at toyokamycin production bacterial strain
s. diastatochromogenesthe raising that biosynthesizing toyokamycin gene cluster copy number is conducive to the output of toyokamycin is increased in 1628.
Table 1 recombinant bacterium compares with the final toyokamycin output of original bacteria
Thalline | Toyokamycin output (mg/L) | Dry cell weight (g/L) |
1628 | 134.97 | 0.58 |
1628-TOYAM | 603.12 | 0.56 |
SEQUENCE LISTING
The <110> China Measures Institute
<120> strengthens restructuring streptomyces diastatochromogenes and the construction process thereof of gene cluster expression
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 10410
<212> DNA
<213> Streptomyces diastatochromogenes
<400> 1
atgtatcgca cagacgacgg accgaagacg tccatgacgg ggcgtcagaa cgagttgcgc 60
cggctcggcg cggccctgga cgacggcgcg cacggcggga ccgtccgcgc cctggtcacc 120
ggcgaaccgg gcatcggccg gaccaccctg ctccaggcgt gcgcggccgc ggcccgcgcc 180
cggggctgga tcaccgtcga ggtgcggtgc ccgccgcacg aacacctgcc gccgttcggc 240
ctcgcccggc acctcgcggg ccgactggcc gcgttgctgc cgccggagca cccccgccgc 300
accgcgctcg acgccgtcgc gcacccgccg gccgaccgta ccggaccggc cgacccgacg 360
ccggtggcgg cggacgtggt gctgggccac gtcagggcgg ccctcaccgt gctgaccgcc 420
ggcgcacccg tgctcctcgg cctcgacgac gcccaccggg ccgacgccgc ctcgctggac 480
ttcctgcacc gggccctgct cgccccgcca ctcgcccgcg tcgtcctggt cgcctccgcc 540
cgggacggcg agaaccgcag cggcggcggc cccggcacac tgcccgaact cctcgccggc 600
gcacggcaac tgccgctcac cgggctggcc ccgtcccagt ccgcggcgtt gctccgcagg 660
gtcgcccgcc gggcaccggc ccccgacgtc gccgcggagt gccaccgcgc ctgtgccggc 720
aaccccgccc tcctcaccga agtcgcccgg gtgctgcgcg agcggccggc ggatcgcgcc 780
ggtgcgccgc tggccgccgc actgcggccc gcggccgtcg cggaactgat cggcacccgg 840
ctggccggac tcgatccgaa cgccggcaag gtcgccctgg ccatcgccgt cgcggagacc 900
cactccgcag ccgagcccct gctcgtctcc cacctcagcg ggctgaccct ggccgaaacc 960
ctggccgcgg tcgacctgtt ggtgtgcatg cacctggtcg ccgacgacga cacgctgtac 1020
ctgcgccacc gcgtcgtgcg cgaggcgctg ctgggccgga tgacgctgat ggcccgcaac 1080
gccgcccacc tcgcggccgc cacccacctg cacggcaagc aggcgcccgc cgaccggatc 1140
gccgaccacc tcgcggcgtc gacggtgacc ctggacgagc cgtgggccgc ccccgtgctg 1200
ctgcgggccg ggcagaaggc cctcgcggcc cgggaaccgc aacgggcccg gcgctatctg 1260
gcgcacgccg tacgcgcggc gtcgggcgcg gaccgccgga ccgcggtgct ggagctcgtc 1320
gacgccgaga tcggcatcga cctgcaagcg gggctgcggg aggcggtccg gaccctggag 1380
gagaccaccg aggacgccct ccggctcccg ctgctggcca ggatcagcac cgcgcgctac 1440
ctcggaaccg accccggcgc gaccgcccgg acgacgcccg ccccggacta cgcccggccc 1500
gactggcatc ccgtgcacgc cctgctcgac ggcctggccg cctacccgct gccggacacc 1560
gcccgacgca ccggggagcg cctcgcgccc gaggagcccg ggccggggtg ccccgagacc 1620
ggcggggccg actgctgcgg cgcggaccgg gccgccgcag acgccgtcgt gcgcgccctg 1680
cgcagccacc tgacgtgtcg gccggccgac gcggtgcacg gcgcgcggga ggcgttgcgg 1740
gcggagggcg gactgtgcct gcacccggtg ctccggctga tggcgctgat gatcctcgcc 1800
tggaacggcc gcgacgccga cgtgacgtcc cacctgcggc tccaccacga ctgcgggcac 1860
tgccacgcgc acccgctgca ccgggccctg ctgctgccgg tcaccgccca cctggccctg 1920
ctgcgcggcc ggctgcgcac cgcgcacgac cggctcggcg catccctcga cgccctggcg 1980
cactacggga cccggcccca acacccgctg ctgatctggc tcgtggggat gctggccgag 2040
gtccgcctgg ccatgggacg cggccctgag gcccgcgcgc tgctgcacga acacggctgc 2100
ctggacggcc cggcaccgga ccgactgcac cgcgaggtgt ggctgacccg ggcgaggctg 2160
cgggccgacg gcggtgacct ggcgggcgtg gcggcggacc tggccgagct caccgacgcc 2220
ccggggggac ccaccggcgg cgtgcacacc tacgtccaca ccgtcgatct gctgacgcag 2280
gtgggccggc acgtgcaggc ccgggagacc gcccggacgc tgctgcgggt cgccgaggcc 2340
atgggcacac cgcgggaacg cggcatcgcc ctgcgggtgc tcggcgcact gggcggcgcc 2400
cccgagggcg aggacctgct gcgcgaggcg atgcgcctgc tggccgcggc ggaggccgac 2460
ttcgacctcg cgcacgccgc cgccgacctg gccctgctgc tgttcgacga cgggcgctac 2520
gaggaggcga cggcggagct gagcacggcg ctggagctgg cggaccgctg cggcgcccga 2580
ccgctcgcgc tgcgggtgcg gcagcggctc gccgccgcgg aggggcgctc cgccgaccgg 2640
tcgccgctgg gcggcgtgct gaagctgacc aagcgggaga agcagatcct catcgacgcc 2700
gtgcgcggct cgaccaacga acggatcgcg acgaccctgc acatcacccg ccgcacggtc 2760
gaactccacc tgtccagtgc gtaccgcaag ctcgacatca ccggccgcaa ggacttcccg 2820
cacctgttcc ggaccgcggg gctgtggccg ctgctggtcg attccgccgc cacctgaccg 2880
gcgcgcggga cccacccctc ggtaccgggg cgcccgcgct acggcaccgg ccgtgatgtt 2940
ccgcggcccg gccggccgcc acgatggccc cgggcgccgg gccgccccgc gtcccggtcg 3000
ttcggtttcc cttcccactc cggaggtttg tgatggatca agacgacagc cgcaccgacc 3060
cgttcaccgc cgtggtggtg ctgtccggag gtctggactc cacgacgctg atggcgcact 3120
acgccgccct ccagtaccgg ctgatcgccg tcaccgtcga ctacgggcag cgccaccacc 3180
gcgagatcga cgcggcccgg gcggtggcgg cccacttcgg cgccgagcac cacgtggtcg 3240
acctgcgcgg ttacggggcg ctgctgcgcg gctccgcact gaccgacgac cgggtcagcg 3300
tccccgacgg gcactacgcg gaacagtcca tgcgggccac cgtcgtgccc aaccgcaacg 3360
cggtgctggc gaacgtcgcg gtgtcgatcg gggtggcgca ccgcgcgtcg gtggtggcgc 3420
tgggcatgca cgccggcgac cacttcatct acccggactg ccggccggag ttcgtcgccg 3480
cgctgcgcga actggtcgcg acggccaacg agggcttcgc ggtcccccag gtcgaggcgc 3540
cgttcctctc ctgggccaag accgacatcg ccacgcacgg cgtccggctg ggcgccccgc 3600
tggaactcag ctggtcctgc tacaagggcg gggaccggca ctgcgggacg tgcgggacct 3660
gctacgagcg gcgggaggcg ttccgcaacg ccgggttggc cgacccgacc ggctacctcg 3720
acgacgtgac ggcgtacccg gcgccctgac gccccgggcg cgcccggccc cgcccacggg 3780
ccgagcaccg cgacgggccg gactccgtgc ggagtccggc ccgtcggcac gccctcggcg 3840
ggcggaaggg gctcacccca ccggttccgc ctggaggatc aagcggccca ggtccgcggc 3900
cgacgggagc aggacgtccg gcccctccgg cgtgccctcg gccggcagcc cgccgccgtt 3960
gccggtgcgc accccgacca cgacggcccc caaccggcgg cccaacgcga tgtccgacgg 4020
ggtgtcgccg acgacgtaga gccggtggtc gggcgcgtgg ccgagcccgt ccaacgcccg 4080
ccgcgccaac gcggtcttgc agtcggcgtc ggagaccggg ccgtcccccg cgtccaggtc 4140
gtcccgggtc aggatcggcc cgaagcacgg gcggaccgcg tagcgctcca gcagggccac 4200
ggtggcctcg gtgccgaccc aggagctgac cagcgcgagc cgcaccccgg ccccggacag 4260
cgccgacagc atcggcacca ccccggggta gagcgtgccg tgcgccatgt accggtgggc 4320
cacctcgtcg acccggtccc gcacccgcac cgacccgatg tgcagcgccc cgctggtgat 4380
cgaggaccag tagccgaagc cgaggatctc ctcgcggggc ggcggaatca ccccctcctg 4440
ccggtggagg tccaggacga agcggtggaa catctcgtag aagtccaaca gggtgccgtc 4500
ccggtccagc acgaccgtgg tccgccctgt ccgacccatt tcctcaacca tgtcgctcac 4560
acccgcaacg gtacggcgag ttcgttgtcc ccgggcggtg cttcccacgg gaagaccgtc 4620
cagtcgtcca cctcgaccgc ctggaagtcg gcccgttggg cggcgcccag gttgcgcacc 4680
accgcgaccg tgcggacctc cgcggcgccg agctcctcca cggtgcgctt ggccagggcc 4740
atggtgccgc cgtcgcccat gatgtcgtcg accagcagca cccgcgcgcc gccgaactcc 4800
cgctccggaa cgacgtactt gagcaccgcc gccccccgct cgctgtaccg ggagttggag 4860
gtgttgcggg ggatgcccag gatgcggaag tcctcgatcg ccagcaggtt cgccagggcg 4920
atggccggcg gcagcccgcc gcgggcgatg cccgccaccg cggtcggggc gaagccgctg 4980
gcccggacgt cgtccgccag tccggccagc atccggccca tcgcctccca actgatcgtc 5040
aacagccggt cccgccgcca catcggtgtg ccgctcatcg gtcgcctccc tggccgctcg 5100
tcacgttgcg ggccgtgccg gcgggccggc cgttccaccg gtccaccacg tcggcggtgc 5160
ccggccccgt cccgagcagg tcgaccggcc ggcccaggcc ctcctcgacc cgggccacga 5220
acgccgccgc cgcctcgggc aactccccgg tgcgcaccgc gcggcaggac gcgtccacgt 5280
ggtccaggaa ggtcagcgcg atccgggtgg gccggttgac gcgcaccgcc tcgcgtgcct 5340
ggtccaggtc gaacgtgccg gcccggcgcc gccgcccggt caccgtgccg tactcgacga 5400
tgcccagccg ctcggcctcc gcctcggtca tctcggtgcg gaacggcccc gcgcccaccc 5460
gggtggggta ggcccggaag accagcacca cctcgtcgat cgcggtgggg cccagtccgg 5520
cgtccgccgc cgcggtgctc gccgtgctgt ccttgccgac ggtgtaggga taggtgccgt 5580
acagcaccga caggccgaag ccgttggtgc cttcgacgtg cacccggtcc ccggcgtcga 5640
ccgcgtcgtt caccacccgc acggtgtccg tgaggtaagg ggcgagttcg gggacgtcct 5700
cggcgcggcg cgccgcacgc atggcgcggg cggccagggc cgggccgtgg ccgctgccgg 5760
tgctgcgcac ccggtcggtc agccccgcgt cggccgcctc cgcggcgacg tgctcggggt 5820
cgatgacggt ggcgcggaag tccacgccga cccgggactc ggcggagaac tccgcgatct 5880
cccgcaacag gacctccggg cggatcaaca cgccggcgcc cagcaggagg cgggtggccg 5940
ggcggatcac cgcactgggc aactggcgca gtttcatggt gcgtccggcg tgcaccacgg 6000
tgtggccggc gccgggcccc agtccggcgc gcaccgccac cgcgggctcg tcccggatcg 6060
ccagatagct ggagatcttc cccttggcct cgtcgcccca ctggccaccg acgatcaccg 6120
tgccgggcat gtccgagctc cttccgtcga ctgtgcgagc gcttcctcgg cccggcgcac 6180
ggtctcctgc gccagggtgt cgcagaagcc ggtgtccgcg gccgcctcgg ccagggccgc 6240
gaggtccggt gcgggcagca ccgcggtcac cgacgcgtcg tccgccagca ccgccaccag 6300
gtcgcggtcg tcccgggcgg cgagcgcact ggcccgttgc agggcccggt aggcgtcgag 6360
ccggtccgtc ccgcggtcga ccatggccag cagcaccgcc tcgctgaggt gactgtggcg 6420
cgaccggtcg aggttctccc gcatccgctc ggggaagacc ctcaggtcgt ccaccacggc 6480
ggtggtggtg aggagcatct cgtcgagcag cacgcacgcc tgcggcaggg tgaagcgttc 6540
gttggcggag ttggccaggt cccgttcgtg ccaggtcacc acgttctcca gcgcggggcc 6600
gaccagcgac cgcagcagcc gggccaggct gcagatgcgt tcgctgcgca ccgggttgcg 6660
cttgtgcggc atggcggagc tgccgatctg gtccccctcg gcgaaggact cggcgagttc 6720
gccgatctcc gtccgctgga ggttgcggat ctcggtcgcg aggttctcca ggcaggccgc 6780
ggtcagcgcg gcccaggaga cgaactccgc gatccggtcc cgcgccaccg cctgggcgca 6840
gatctgcggc tccggcaggc ccagccgggc cagcaccgcc cgctgcaccg ccatgccctg 6900
cggtcccagt ccgcccagcg aaccgaccgc accggcgacc ttgccccgca cggcgcgctc 6960
gcgcagctcc gccagccgcg ccaggcaccg ggtcaactgg tcgaggaaca ccgccagttt 7020
gaaccccagg gtgacgggct gggcgtgctg gccgtgggtc cgtccgatca tcacccgccc 7080
gccctcctcg gcgatctgcc ggcacagcgc ggacatcagg acgccgagcc gttcgcccag 7140
gaggccgatc gccgcgtcca gttggagcgc cagcgcggtg tcgatgacgt cgctgctggt 7200
caccccgtgg tgcacgtagc ggccgtgggg cgcgcaggtc tcggcgaact gctggactac 7260
ggcgtagagc tcgtgccggc tcaccgtctc gatctcggcg atccgcgcca ggtcgcaccg 7320
gtggtcgcgg gcccgggcgg cgatcgcccc ggcggcctcg gacgggatca cccccaactg 7380
gccctgctcc gcggccaacg ccccctccac ccgtacgaag agctggtagc ggttgcggtc 7440
gctgaccagc aggcgcatct ccgggctgcc gtagcggccg tcctcccaag ggttcgtcat 7500
ccggtggcct cccgggcgta gtccagggcc acctgctggg tccgctccag ggcgtgcggg 7560
cggctctccg acagtccggc cggcgtgacc cggatgaact cggcctgcgc ccgcagctcg 7620
gccagggtgt gcgccccgga gtagctcatg cccgaccgca gtccgccgac gaacggccgc 7680
agggtggcgg ccagcggccc ggtgtgggcg aaggtggcct cgacgccctc gggggtgtac 7740
gcgtccagct cctcgcggct gacctcttcg ccgcgggccc gcttcagggt cagctgcatg 7800
ccgaacgtca cgaagccggt gctgaccttc acggggacgc cgtcgcgttc caccaggcgg 7860
gccgcgctct cgtcggcacc ggccagggcg ctgcccagca tcaccgcgtg gccgccggcg 7920
gccagcgcct tgacgacgtc gcccggcgcc ttgatcccgc cgtccgcgat caccgggacg 7980
ccggaaccgg ccgcctcctc ggcgcagtcg aggaccgcgg tcagctgcgg caccccgctg 8040
cccgcgacga gccgggtggt gcagatgccg ccggggccga tgcccacctt cacggcgtgg 8100
gcgccggcct cgatcaggtc cctcgtgccg gcggcggtgg cgacgttccc ggcgatcagc 8160
ggcgtgtcag ggaaacgggc ccgcagcttc tcgacggagg ccaggacgta gtccgcgtgg 8220
ccgtgggcga cgtcggtgac caggacgtcc gcgcccgcct cgacgagccg ggcggcccgc 8280
tccagatagt cgtcggtcac ccccacggcc gccccggcgc gcagccggcc ctgcgcgtcg 8340
acggtggccc gctccgtgcc ctcgggcacc ggcgtcgcct tgaccgcggc cacctccgcg 8400
gcctggtcct cggcggtctg catgcggtgg acgatcccga gcccaccggc caccgccatg 8460
gcgacggcca tctgccggcc ggtgcaccag ggggtgttgg cggagaggac cggcacccgc 8520
agggtgatcc cggccagctc ggtgctggtg tcggtcgccg agcggctcac caccgaggtg 8580
cggcggggca ccagcaggac gtcgtccagg ctgagcccgg tgcgtatgtc gcgaactgcc 8640
acgtgcgtac tcctgtcgat cgtggacggg gtcgggtcac ttgcgcagcg ggaacaccgt 8700
cgccacgagt tcctgacggg ccggcccgta ctcctcgaag accccggagt aggccgtgga 8760
cgtcatgacc gccggggtac ggatgccgcg catgctcatg cacaggtgct cgccggtggc 8820
gatgaccgcg acgtcgaccg aaccggtcac cttggtgacc tcgtccgcga tgtcgcggac 8880
caggcgctcc tgcacctgga gccggtgcgc gtggcgatgg gcgatccggg cgaacttcga 8940
cagtccgagc acgtcgccct tgggccggta ggcgatggtc agggagcagg agaagggcag 9000
caggtggtgc tcgcacagcg accacacgtt gatgtccgag accatgacca gttgtccctc 9060
cgtctggagg gggaacagcg tgtcgaccgc ccccgcgtcg tagcgggaga actcccgcca 9120
ccagcgggcg aagcgggccg gcgtctcctt gagcccgtcg cgctccgggt cctcgccgat 9180
ctcgatcagc agcttgcgcg cgacgtcctc cagcgggtcc gggacctgcg gcccggagtc 9240
gtcgaggacg tccagttcgg gggctccgct cactgtgctc acacgcctct cctgtcgccc 9300
cagacggcaa catgcaatcg agtggtcagg ttccagccgc gtgccacgac gtcgtccccc 9360
agcgcggaca ggtgttggcc gacctcggcg ggtacctgcc cctcgggcat gatccacacc 9420
gggcgggtcc cgtaccggtc gacgagctgc gccacctcgt cgaggtcgct cgtggtgcgg 9480
cagacgaact tgaaggcggt ccccgggacg gccgcgaacg cccgcaacgc gtccggcacg 9540
atccgccgcg cctgcggatc gcccgagtgc gacagcttgg gcgagacgtt gaaccgcacg 9600
ccgagcgcca ccaggtcgtc ctgcggcacc acggtgccgt tcgtctcgat ctccaccttg 9660
cggccggcct ccgtcagcgc gcccagcagc ggcagcaacc ggcgctgctg gctgaggggt 9720
tcgcccccgg agaccacgat cagcgggacc tcgtaggcga gcagcgcacg cagcacgtcg 9780
gtccacggca tcggccgcag ttcccgcttg gggtcgtagg cgaccccgga gtcgcccact 9840
ccggtccagt cccaggtgta cggggtgtcg caccagcggc aggacaggtt gcagccgccc 9900
aaccgcacga aggcgcaccg ctgcccggcc gaggggccct ctccctgcac ggccctcaag 9960
tggggccgaa gatctcgttg acgacgagct tcggttccac cgcggcacca cctcctcggt 10020
gttgcgacgg ggtggcgggc atctgcgtca cggccggtac tccgcccacg tcttggcggt 10080
ctcggagacc cgcaccgcgc tcaactgcgg gtagtgcggc agccaccgct cgtacagcca 10140
ctgcgcgagg tgctcggccg aggggttgcg gtccagcacg tcgttgaggt gacggtggtc 10200
cacctcggcg tccaaccacc ggctgaactg cttgaggtcg ccgtagtcgc ggacgaagcc 10260
cgccttgtcc aggccgtcgg ccggggccgc gagctccagt tcgacgacgt agttgtgccc 10320
gtgcatccgg ccgcacgggt gcccttcggg cagctcggcg agccggtgac tggccgagaa 10380
gtggaactct ttggtgatcc gaaaagccat 10410
Claims (3)
1. strengthen the restructuring streptomyces diastatochromogenes that gene cluster toy AM expresses, it is characterized in that: the gene cluster toy AM of it is recombinant expressed biosynthesizing toyokamycin, have than deposit number be CGMCC N0.2060 streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 higher toyokamycin abilities to express; Described gene cluster toy AM come from original bacteria streptomyces diastatochromogenes to be reorganized (
streptomyces diastatochromogenes) 1628; Described gene cluster toy AM is integrated into original bacteria streptomyces diastatochromogenes karyomit(e).
2. strengthen a construction process for the restructuring streptomyces diastatochromogenes that gene cluster toy AM expresses as claimed in claim 1, it is characterized in that, process is as follows:
1) construction of expression vector pSET152-toy AM;
2) utilize conjugal transfer method that described expression vector is integrated into streptomyces diastatochromogenes karyomit(e), the restructuring streptomyces diastatochromogenes described in acquisition.
3. method as claimed in claim 2, is characterized in that, utilize carrier pSET152 to realize the overexpression of gene cluster toy AM, utilize conjugal transfer method by specific for carrier pSET152-toy AM be integrated into streptomyces diastatochromogenes (
streptomyces diastatochromogenes) 1628 karyomit(e), obtain inheritance stability restructuring streptomyces diastatochromogenes; The described purposes strengthening the restructuring streptomyces diastatochromogenes that gene cluster toy AM expresses, ferment restructuring streptomyces diastatochromogenes, compared with original strain, and toyokamycin output increased 4.5 times.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410506760.XA CN104312967A (en) | 2014-09-28 | 2014-09-28 | Gene cluster expression strengthened recombinant streptomyces diastatochromogenes and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410506760.XA CN104312967A (en) | 2014-09-28 | 2014-09-28 | Gene cluster expression strengthened recombinant streptomyces diastatochromogenes and construction method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104312967A true CN104312967A (en) | 2015-01-28 |
Family
ID=52368284
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410506760.XA Pending CN104312967A (en) | 2014-09-28 | 2014-09-28 | Gene cluster expression strengthened recombinant streptomyces diastatochromogenes and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104312967A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114806992A (en) * | 2022-05-23 | 2022-07-29 | 中国计量大学 | RSH overexpression genetic engineering streptomyces diastatochromogenes and method for improving fermentation yield of toyocamycin |
-
2014
- 2014-09-28 CN CN201410506760.XA patent/CN104312967A/en active Pending
Non-Patent Citations (2)
Title |
---|
REID M. MCCARTY 和 VAHE BANDARIAN: "Deciphering Deazapurine Biosynthesis: Pathway for Pyrrolopyrimidine Nucleosides Toyocamycin and Sangivamycin.", 《CHEMISTRY & BIOLOGY》 * |
檀贝贝 等: "抗生素生物合成基因簇的克隆策略", 《中国农学通报》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114806992A (en) * | 2022-05-23 | 2022-07-29 | 中国计量大学 | RSH overexpression genetic engineering streptomyces diastatochromogenes and method for improving fermentation yield of toyocamycin |
CN114806992B (en) * | 2022-05-23 | 2023-08-22 | 中国计量大学 | RSH over-expression genetic engineering amylase streptomyces chromogenes and method for improving fermentation yield of toyocamycin |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104762247B (en) | Improve the engineering strain and construction method of production ascosin yield | |
Wang et al. | Improved ε-poly-l-lysine production of Streptomyces sp. FEEL-1 by atmospheric and room temperature plasma mutagenesis and streptomycin resistance screening | |
CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
CN105624080A (en) | Bacillus licheniformis gene engineering bacterium capable of producing polysaccharide flocculant at high yield and establishment method thereof | |
CN105779489B (en) | The method for constructing high expression trehalose synthetase engineering bacteria using Pcry3Aa promoter | |
CN111621454B (en) | Gene engineering high-yield strain streptomyces diastatochromogenes, production method and application of epsilon-polylysine | |
CN111607608B (en) | Gene engineering high-yield strain streptomyces diastatochromogenes, method for improving yield of epsilon-polylysine and application | |
CN101319219A (en) | Method for preparing deoxidized violacein and special recombinant bacterium | |
CN103409341A (en) | Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain | |
CN104312967A (en) | Gene cluster expression strengthened recombinant streptomyces diastatochromogenes and construction method thereof | |
CN103233018B (en) | Recombinant streptomyces diastatochromogenes with reinforced adpA expression, construction method and application | |
Sati et al. | Bioactivity of root endophytic freshwater hyphomycetes Anguillospora longissima (Sacc. & Syd.) Ingold | |
CN111019965A (en) | Engineering bacterium for genetic modification of neomycin biosynthesis gene cluster and application thereof | |
CN106554932B (en) | Genencor engineering bacterium for producing gentamicin B and construction method thereof | |
CN110423790B (en) | Metabolic engineering method for directionally producing high yield antifungal tetramycin B | |
CN103820473B (en) | Strengthen restructuring streptomyces diastatochromogenes and construction process and purposes that toyG expresses | |
CN113801834A (en) | Gene engineering streptomyces diastatochromogenes with high yield of toyocamycin and construction method and application thereof | |
CN102277310B (en) | Vector-host system for expressing antibiotic gene clusters and application thereof | |
CN103290043B (en) | ToyB expression reinforced recombined streptomyces diastatochromogenes, as well as construction method and use | |
JPH022349A (en) | Pyrimidine analogue-tolerated gene dna and use thereof | |
CN101195655B (en) | Regulating protein for polyoxin synthesis, encoding gene and application thereof | |
CN103243062A (en) | Streptomyces diastatochromogenes engineering strain for producing toyocamycin, as well as construction method and application thereof | |
CN112921045B (en) | Aminoglycoside antibiotic biosynthesis gene cluster and application thereof | |
CN103205481A (en) | Method for improving aureomycin yield as well as recombinant expression vector and genetic engineering bacterium of aureomycin | |
CN113549587B (en) | Gene engineering high-yield strain streptomyces diastatochromogenes and method for improving yield of epsilon-polylysine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150128 |