CN103290043B - ToyB expression reinforced recombined streptomyces diastatochromogenes, as well as construction method and use - Google Patents

Abstract

The invention discloses toyB expression reinforced recombined streptomyces diastatochromogenes, as well as a construction method and use. The toyB expression reinforced recombined streptomyces diastatochromogenes excessively expresses the key enzyme-6-acetone acyl tetrahydrobiopterin synthetase encoding gene toyB of biosynthetic toyocamycin and has higher toyocamycin synthesis capability than streptomyces diastatochromogenes 1628. The construction process is as follows: 1) constructing an expression vector pIB139-toyB; and 2) utilizing a conjugational transfer method to integrate the expression vector with the chromosome of the streptomyces diastatochromogenes so as to obtain the engineering bacteria. A promoter permoE* on the pIB139 vector is utilized to start expression of toyB gene; the vector pIB139-toyB is specifically integrated with the chromosome of the streptomyces diastatochromogenes 1628 by the conjugational transfer method so as to obtain engineering bacteria with genetic stability. Compared with the original strain, the engineering bacteria obviously improves the activity of the recombined bacteria 6-synthetase acetone acyl tetrahydrobiopterin synthetase by at least three times and at least increases the yield of the toyocamycin by at least 23.4%.

Description

Restructuring streptomyces diastatochromogenes and construction process and purposes that toyB expresses are strengthened

Technical field

The present invention relates to improve toyokamycin output by strengthening toyB gene in the expression of streptomyces diastatochromogenes, belong to gene engineering technology field.

Background technology

Toyokamycin is a kind of novel nucleoside microbiotic, and molecular formula is C ₁₂h ₁₃n ₅o ₄, ribose C ₁connect the deazapurine ring of similar guanine, core texture is pyrroles's pyrimidine nucleoside analoys.The mechanism of action is mainly the growth that affects thalline of transcribing by suppressing microorganism, and its bioactivity research report mainly concentrates on clinical medicine domain.Studies have found that in the recent period toyokamycin has good prevention effect to various plants epidemic disease, life-time service can not cause environmental pollution, and plant-growth is also had to certain regulating effect.Therefore the application potential that, toyokamycin has in agricultural plants disease control field.With respect to chemical synthesis, the synthetic toyokamycin of biological process is taking renewable resources as raw material, has reaction conditions gentleness, pollutes less and the advantage such as with low cost, and therefore, biological synthesis process is the both economical effective means of current toyokamycin suitability for industrialized production.

Toyokamycin belongs to secondary metabolite, and route of synthesis complexity is subject to restriction and the regulation and control of many factors, causes the synthetic level of toyokamycin lower, is difficult to large-scale production.The existing way addressing this problem is all generally the production bacterial strain as Main Means screening high yield and high quality by traditional selection by mutation, but screen, the uncertain factor of high efficient strain is many, the cycle is long.

Output how to utilize the advanced persons' such as molecular biology technique means improvement microorganism further to improve toyokamycin becomes a feasible thinking.The people such as McCarty are taking the synthetic toyokamycin bacterial strain Streptomyces rimosus (ATCC14673) of a strain as initial research object; clone biosynthesizing toyokamycin gene cluster; building-up process and the regulatory mechanism of toyokamycin are illustrated; research finds that toyokamycin is precursor by GTP; through the synthetic toyokamycin of polystep reaction, be wherein one of key enzyme of pathways metabolism by the 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme of toyB genes encoding.Have no relevant report but utilize metabolic engineering technology further to improve toyokamycin output by increasing toyokamycin metabolic flux because relate to the challenge such as foundation of expression system.

Summary of the invention

In order to overcome the deficiencies in the prior art, the invention provides structure of a kind of streptomyces diastatochromogenes engineering bacteria that produces toyokamycin and uses thereof.

Streptomyces diastatochromogenes ( streptomyces diastatochromogenes) 1628 are strain Antagonistic Actinomycetes, its fermented liquid has stronger restraining effect to various plants pathogenic fungi, through separation and Extraction, determine that its main effective constituent is toyokamycin, there is not yet streptomyces diastatochromogenes metabolic engineering molecular modification aspect research report.

The present invention first from streptomyces diastatochromogenes ( streptomyces diastatochromogenes) clone first the toyB gene of coding 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme in 1628 (deposit number of bacterial strain is CGMCC NO. 2060), and this gene is connected with streptomycete integrative gene expression type plasmid pIB139, successfully build and carried toythe recombinant vectors pIB139-of B gene toyb, and utilize conjugal transfer method by its specific being incorporated on streptomyces diastatochromogenes 1628 karyomit(e)s.

A toyB gene for streptomyces diastatochromogenes, his sequence is as shown in SEQ ID NO:1.

Strengthened the restructuring streptomyces diastatochromogenes that toyB expresses, it has expressed the key enzyme-6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene of biosynthesizing toyokamycin toyb, have than streptomyces diastatochromogenes ( streptomyces diastatochromogenes) 1628 higher toyokamycin abilities to express.

Described original bacterium be streptomyces diastatochromogenes ( streptomyces diastatochromogenes) 1628.

Described 6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene toyB come from original bacterium streptomyces diastatochromogenes to be reorganized ( streptomyces diastatochromogenes).

Described 6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene toyb is integrated into original bacterium streptomyces diastatochromogenes karyomit(e).

Described reinforcement the toyB construction process of restructuring streptomyces diastatochromogenes of expressing, it is characterized in that, process is as follows:

1) construction of expression vector pIB139-toyB;

2) utilize conjugal transfer method that described expression vector is integrated into streptomyces diastatochromogenes karyomit(e), obtain described engineering bacteria.

Utilize promotor permE* on pIB139 carrier to start the expression of toyB gene, utilize conjugal transfer method by specific carrier pIB139-toyB be integrated into streptomyces diastatochromogenes ( streptomyces diastatochromogenes) 1628 karyomit(e), obtain the engineering bacteria of inheritance stability.

Described reinforcement the purposes of restructuring streptomyces diastatochromogenes expressed of toyB; recombinant bacterium 1628-TOYB is fermented; compared with original strain, recombinant bacterium 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme is lived and is improved at least 1.3 times, and toyokamycin output has at least improved 23.4%.

Beneficial effect of the present invention:

The present invention strengthens toyokamycin biosynthetic pathway key gene toyB in streptomyces diastatochromogenes after overexpression; compared with original bacterium; the work of recombinant bacterium 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme has improved 1.3 times, and the original bacterium of energy force rate of synthetic toyokamycin has improved 23.4%.For further improving toyokamycin output, realize early suitability for industrialized production and lay a good foundation.

Brief description of the drawings

Fig. 1 is recombinant plasmid pIB139 -the structure schematic diagram of toyB.

Fig. 2 is that the enzyme of recombinant plasmid pMD18-T-toyB is cut proof diagram.

1. pMD18-T-toyB/ Nde I+ Not I；2. DNA Marker DL2000；

Fig. 3 is that toyB gene exists e.colithe SDS-PAGE analysis chart of BL21.

1. pET28a- toyB/ e.colibL21 induction; 2. Protein Marker; 3. pET28a- toyB/ e.colibL21 does not induce.

Fig. 4 is the restriction enzyme digestion and electrophoresis checking of restructuring shuttle expression plasmid pIB139-toyB.

1. λ DNA/ HindIII Marker；2. pIB139-toyB/ Nde I+ Not I；3. toyB gene；4. DL2000 Marker。

Fig. 5 is the PCR electrophoresis proof diagram of recombinant bacterium 1628-TOYB.

1-3. engineering strain; 4. original strain; 5. DL2000 Marker.

specific implementation method

Below in conjunction with the drawings and specific embodiments, the present invention is described further.

embodiment 1:the structure of the amplification of goal gene and restructuring streptomyces diastatochromogenes

With s. diastatochromogenes1628 chromogene groups are template, with PtoyB F ndei and PtoyB R noti is primer, and pcr amplification obtains and contains ndei and notthe toyB gene of two restriction enzyme sites of I, is connected with pMD18-T Vector, builds cloning vector pMD18-T-toyB( ndei+ noti), by cloning vector pMD18-T-toyB( ndei+ noti) be converted in acceptor intestinal bacteria, coat on the LB agar plate containing ammonia benzyl resistance, after 37 DEG C of overnight incubation, random picking positive transformant enzyme is cut and is served that Hai Shenggong check order and carry out sequential analysis after qualification, use ndei and noti double digestion is contained ndei and notthe toyB gene of two restriction enzyme sites of I, connects with the streptomycete integrative shuttle expression vector pIB139 of same double digestion, obtains recombinating shuttle expression carrier pIB139-toyB after enzyme is cut checking, is proceeded to e.colieT12567 (pUZ8002) screens positive transformant on the LB flat board of that resistance of card and apramycin resistance e.colieT12567 (pUZ8002, pIB139-toyB), with e.colieT12567 (pUZ8002, pIB139-toyB) is donor, and streptomyces diastatochromogenes is acceptor, utilizes conjugal transfer method that pIB139-toyB specificity is incorporated into streptomyces diastatochromogenes s. diastatochromogeneson 1628 karyomit(e)s, on apramycin resistance MS flat board, screen positive transformant, streptomyces diastatochromogenes 1628-TOYB obtains recombinating.

With s. diastatochromogenes1628 karyomit(e)s are template, design two primers, pcr amplification toyB, and design of primers is as follows:

toyB F Nde I：5’-CGC CATATGTTGTTCAGCATCACCGTC -3’；

toyB R Not I： 5’-CGC GCGGCCGCTCACAGCGCACGCTCGTAG-3’ 。

Recombinant plasmid pMD18-T-toyB is with restriction enzyme ndei and noti double digestion verifies as shown in Figure 2, and recombinant plasmid pMD18-T-toyB double digestion obtains the DNA fragmentation of about 0.4kb and 2.7kb, and in the same size with toyB gene fragment and plasmid pMD18-T respectively, illustrates that recombinant cloning vector connects correct.To recombinant plasmid, pMD18-T-toyB checks order; sequential analysis shows that Insert Fragment is the sequence of 399 bp; 132 amino acid of encoding; relative molecular weight size is about respectively 14 kDa; there is higher homology with the 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme of many streptomyces of reporting, be wherein up to 90%.ToyB nucleotide sequence is as shown in SEQ ID NO:1.ToyB gene is connected into pET28a carrier; build pET28a-toyB recombinant vectors; and recombinant vectors is proceeded to e. coli bl21, and picking positive transformant is in the LB of 10mL substratum, and 37 DEG C of shaking culture are spent the night; switching next day; IPTG abduction delivering, as shown in Figure 3, after induction, recombinant bacterium has obvious signature band to occur; recording 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme activity is 39 U/mg total proteins, shows toyB gene successful expression in intestinal bacteria.

The enzyme of integrated restructuring shuttle expression plasmid pIB139-toyB is cut the result as shown in Figure 4, recombinant plasmid pIB139-toyB warp ndei and notit is in the same size that I double digestion discharges fragment and the toyB gene of 0.4 kb, illustrates that plasmid pIB139-toyB builds correct, with conjugal transfer method be incorporated into streptomyces diastatochromogenes ( streptomyces diastatochromogenes) on 1628 karyomit(e), after in apramycin resistant panel, the random some single bacterium colonies of picking are cultivated repeatedly in CP substratum, extraction karyomit(e).PCR experiment all can amplify apramycin resistant gene apr(Fig. 5), prove that restructuring streptomyces diastatochromogenes 1628-TOYB successfully constructs, and inheritance stability.

embodiment 2:the leavening property checking of the original bacterium of streptomyces diastatochromogenes and recombinant bacterium

Compared with original strain, the 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme work of recombinant bacterium has improved 1.3 times; Recombinant bacterium 1628-TOYB and original bacterium s. diastatochromogenes1628 carry out 250 mL shake flask fermentation experiments, and the increase of 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme streptomyces diastatochromogenes being lived from fermentation angle is verified the raising effect of toyokamycin output.Reciprocating shaking speed is 200 r/min, 28 DEG C, and fermentation 96h, control group is the streptomyces diastatochromogenes strain of setting out.As shown in table 1, the ultimate capacity of recombinant bacterium toyokamycin is higher than original bacterium, and recombinant bacterium toyokamycin ultimate capacity reaches 166.55 mg/L, and more original bacterium has improved approximately 23.4%, and repeatability is good.Illustrate at toyokamycin and produce bacterial strain s. diastatochromogenesthe expression that strengthens the key enzyme 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme-ToyB of biosynthetic pathway in 1628 contributes to improve the output of toyokamycin in fermenting process.

The comparison of table 1 recombinant bacterium and the final toyokamycin output of original bacterium

Thalline	Toyokamycin output (mg/L)
		1628	134.97
1628-TOYB	166.55

SEQUENCE LISTING

The <110> China Measures Institute

<120> has strengthened restructuring streptomyces diastatochromogenes and construction process and purposes that toyB expresses

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 399

<212> DNA

<213> Streptomyces diastatochromogenes

<400> 1

ttgttcagca tcaccgtccg tgaccacctg atggtcgcgc acagcttccg cggcgcggtc 60

ttcggacccg cgcagcgcct gcacggcgcc accttcatcg tggacgccac cttccgccgc 120

cccgaactcg acgacgacaa catcgtggtc gacatcggcc tcgccaccca ggaactcggc 180

ggcgtgatcg ccgagctcaa ctaccgcaac ctcgacgacg aacccgcctt cgccgggacc 240

aacacctcca ccgaggcgct cgccaaagtg atcgccgacc ggctcgccga ccgggtgcac 300

gccggcaacc tcggtgcggg cgcccgcgac ctgagcggca tcaccgtcac cctgcacgag 360

tcccacgtgg cctgggccag ctacgagcgt gcgctgtga 399

Claims (4)

1. a toyB gene for streptomyces diastatochromogenes, is characterized in that: its sequence is as shown in SEQ ID NO:1.

2. strengthened the restructuring streptomyces diastatochromogenes that toyB expresses, it is characterized in that: its deposit number be CGMCC NO. 2060 streptomyces diastatochromogenes ( streptomyces diastatochromogenes) recombinant expressed key enzyme-6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene toyB of biosynthesizing toyokamycin in 1628, sequence is as shown in SEQ ID NO:1, and having than deposit number is the higher toyokamycin ability to express of streptomyces diastatochromogenes 1628 of CGMCC NO. 2060;

Described 6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene toyB is integrated into the karyomit(e) of above-mentioned streptomyces diastatochromogenes 1628.

3. a construction process for the restructuring streptomyces diastatochromogenes of having strengthened toyB expression as claimed in claim 2, is characterized in that, process is as follows:

1) construction of expression vector pIB139-toyB;

2) utilize conjugal transfer method that described expression vector is integrated into streptomyces diastatochromogenes karyomit(e), obtain engineering bacteria;

Described expression vector pIB139-toyB is the expression that utilizes the promotor permE* startup toyB gene on pIB139 carrier, described step 2) be to utilize conjugal transfer method by the specific carrier pIB139-toyB karyomit(e) that is integrated into streptomyces diastatochromogenes 1628, obtain the engineering bacteria of inheritance stability.

4. one kind is utilized the purposes of the restructuring streptomyces diastatochromogenes of having strengthened toyB expression as claimed in claim 2; it is characterized in that; restructuring streptomyces diastatochromogenes is fermented; compared with original strain; recombinant bacterium 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme is lived and is improved at least 1.3 times, and toyokamycin output has at least improved 23.4%.