CN103290043A

CN103290043A - ToyB expression reinforced recombined streptomyces diastatochromogenes, as well as construction method and use

Info

Publication number: CN103290043A
Application number: CN2013101706652A
Authority: CN
Inventors: 马正; 俞晓平; 陶立彬; 申屠旭萍; 边亚琳; 郝培应; 许益鹏
Original assignee: China Jiliang University
Current assignee: China Jiliang University
Priority date: 2013-05-08
Filing date: 2013-05-08
Publication date: 2013-09-11
Anticipated expiration: 2033-05-08
Also published as: CN103290043B

Abstract

The invention discloses toyB expression reinforced recombined streptomyces diastatochromogenes, as well as a construction method and use. The toyB expression reinforced recombined streptomyces diastatochromogenes excessively expresses the key enzyme-6-acetone acyl tetrahydrobiopterin synthetase encoding gene toyB of biosynthetic toyocamycin and has higher toyocamycin synthesis capability than streptomyces diastatochromogenes 1628. The construction process is as follows: 1) constructing an expression vector pIB139-toyB; and 2) utilizing a conjugational transfer method to integrate the expression vector with the chromosome of the streptomyces diastatochromogenes so as to obtain the engineering bacteria. A promoter permoE* on the pIB139 vector is utilized to start expression of toyB gene; the vector pIB139-toyB is specifically integrated with the chromosome of the streptomyces diastatochromogenes 1628 by the conjugational transfer method so as to obtain engineering bacteria with genetic stability. Compared with the original strain, the engineering bacteria obviously improves the activity of the recombined bacteria 6-synthetase acetone acyl tetrahydrobiopterin synthetase by at least three times and at least increases the yield of the toyocamycin by at least 23.4%.

Description

Reorganization streptomyces diastatochromogenes and construction process and purposes that toyB expresses have been strengthened

Technical field

The present invention relates to improve toyokamycin output by strengthening the toyB gene in the expression of streptomyces diastatochromogenes, belong to gene engineering technology field.

Background technology

Toyokamycin is a kind of novel nucleoside microbiotic, and molecular formula is C ₁₂H ₁₃N ₅O ₄, ribose C ₁The deazapurine ring that connects similar guanine, core texture are pyrroles's pyrimidine nucleoside analoys.The mechanism of action mainly is the growth that influences thalline of transcribing by the inhibition microorganism, and its bioactivity research report mainly concentrates on clinical medicine domain.Have in the recent period and discover that toyokamycin has good prevention effect to the various plants eqpidemic disease, life-time service can not cause environmental pollution, and plant-growth is also had certain regulating effect.Therefore, the application potential that has in agricultural plants disease control field of toyokamycin.With respect to chemical synthesis, the synthetic toyokamycin of biological process is raw material with the renewable resources, has the reaction conditions gentleness, pollutes less and advantage such as with low cost, and therefore, biological synthesis process is the both economical effective means of present toyokamycin suitability for industrialized production.

Toyokamycin belongs to secondary metabolite, and the route of synthesis complexity is subjected to restriction and the regulation and control of multiple factor, causes the synthetic level of toyokamycin lower, is difficult to large-scale production.The existing way that addresses this problem generally all is by the traditional selection by mutation production bacterial strain as main means screening high yield and high quality, and the uncertain factor of efficient bacterial strain is many, the cycle is long but screen.

Output how to utilize advanced persons' such as molecular biology technique means improvement microorganism further to improve toyokamycin becomes a feasible thinking.People such as McCarty are initial research object with the synthetic toyokamycin bacterial strain Streptomyces rimosus (ATCC14673) of a strain; cloned biosynthesizing toyokamycin gene cluster; building-up process and the regulatory mechanism of toyokamycin have been illustrated; discover that toyokamycin is precursor by GTP; through the synthetic toyokamycin of polystep reaction, wherein the 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme by the toyB genes encoding is one of key enzyme of pathways metabolism.But utilize the metabolic engineering technology further to improve toyokamycin output by increasing the toyokamycin metabolic flux and do not see relevant report because relate to the challenges such as foundation of expression system.

Summary of the invention

In order to overcome the deficiencies in the prior art, the invention provides structure of a kind of streptomyces diastatochromogenes engineering bacteria that produces toyokamycin and uses thereof.

Streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) 1628 are strain antagonism actinomycetes, its fermented liquid has stronger restraining effect to the various plants pathogenic fungi, through separation and Extraction, determine that its main effective constituent is toyokamycin, do not see as yet streptomyces diastatochromogenes metabolic engineering molecular modification aspect research report.

The present invention at first from streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) clone the toyB gene of coding 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme in 1628 (deposit number of bacterial strain is CGMCC NO. 2060) first, and this gene is connected with streptomycete integrative gene expression type plasmid pIB139, successfully made up and carried ToyThe recombinant vectors pIB139-of B gene ToyB, and utilize the conjugal transfer method with its specific being incorporated on streptomyces diastatochromogenes 1628 karyomit(e)s.

A kind of toyB gene of streptomyces diastatochromogenes, his sequence is shown in SEQ ID NO:1.

A kind of reorganization streptomyces diastatochromogenes of having strengthened the toyB expression, it has expressed the key enzyme-6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene of biosynthesizing toyokamycin ToyB, have than streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) 1628 higher toyokamycin abilities to express.

Described original bacterium be streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) 1628.

Described 6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene toyB come from original bacterium streptomyces diastatochromogenes to be recombinated ( Streptomyces diastatochromogenes).

Described 6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene ToyB is integrated into original bacterium streptomyces diastatochromogenes karyomit(e).

The described construction process of having strengthened the reorganization streptomyces diastatochromogenes of toyB expression is characterized in that process is as follows:

1) construction of expression vector pIB139-toyB;

2) utilize the conjugal transfer method that described expression vector is integrated into streptomyces diastatochromogenes karyomit(e), obtain described engineering bacteria.

Utilize the promotor permE* on the pIB139 carrier to start the toyB expression of gene, utilize the conjugal transfer method with carrier pIB139-toyB specific be integrated into streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) 1628 karyomit(e), obtained the engineering bacteria of inheritance stability.

The described purposes of having strengthened the reorganization streptomyces diastatochromogenes of toyB expression; the bacterium 1628-TOYB that will recombinate ferments; compare with original strain, reorganization bacterium 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme is lived and is improved at least 1.3 times, and toyokamycin output has improved 23.4% at least.

Beneficial effect of the present invention:

The present invention strengthens toyokamycin biosynthetic pathway key gene toyB in streptomyces diastatochromogenes behind the overexpression; compare with original bacterium; the work of reorganization bacterium 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme has improved 1.3 times, and the original bacterium of energy force rate of synthetic toyokamycin has improved 23.4%.Be further to improve toyokamycin output, realize that early suitability for industrialized production lays a good foundation.

Description of drawings

Fig. 1 is recombinant plasmid pIB139 -The structure synoptic diagram of toyB.

Fig. 2 is that the enzyme of recombinant plasmid pMD18-T-toyB is cut proof diagram.

1. pMD18-T-toyB/ Nde I+ Not I；2. DNA Marker DL2000；

Fig. 3 is that the toyB gene exists E.coliThe SDS-PAGE analysis chart of BL21.

1. pET28a- ToyB/ E.coliBL21 induces; 2. Protein Marker; 3. pET28a- ToyB/ E.coliBL21 does not induce.

Fig. 4 is the restriction enzyme digestion and electrophoresis checking of reorganization shuttle expression plasmid pIB139-toyB.

1. λ DNA/ HindIII Marker；2. pIB139-toyB/ Nde I+ Not I；3. toyB gene；4. DL2000 Marker。

Fig. 5 is the PCR electrophoresis proof diagram of reorganization bacterium 1628-TOYB.

1-3. engineering strain; 4. original strain; 5. DL2000 Marker.

Specific implementation method

The present invention is described further below in conjunction with the drawings and specific embodiments.

Embodiment 1:The structure of the amplification of goal gene and reorganization streptomyces diastatochromogenes

With S. diastatochromogenes1628 chromogene groups are template, with PtoyB F NdeI and PtoyB R NotI is primer, and pcr amplification obtains to contain NdeI and NotThe toyB gene of two restriction enzyme sites of I is connected with pMD18-T Vector, makes up cloning vector pMD18-T-toyB( NdeI+ NotI), with cloning vector pMD18-T-toyB( NdeI+ NotI) be converted in the acceptor intestinal bacteria, coat on the LB agar plate that contains ammonia benzyl resistance, after 37 ℃ of overnight incubation, picking positive transformant enzyme is served the Hai Shenggong order-checking and is carried out sequential analysis after cutting evaluation at random, uses NdeI and NotThe I double digestion is contained NdeI and NotThe toyB gene of two restriction enzyme sites of I, integrated shuttle expression carrier pIB139 is connected with the streptomycete of same double digestion, obtains recombinating shuttle expression carrier pIB139-toyB after enzyme is cut checking, and it is changed over to E.coliET12567 (pUZ8002) screens positive transformant at the LB flat board that blocks that resistance and apramycin resistance E.coliET12567 (pUZ8002, pIB139-toyB), with E.coli(pUZ8002 pIB139-toyB) is donor to ET12567, and streptomyces diastatochromogenes is acceptor, utilizes the conjugal transfer method that the pIB139-toyB specificity is incorporated into streptomyces diastatochromogenes S. diastatochromogenesOn 1628 karyomit(e)s, screen positive transformant at apramycin resistance MS flat board, streptomyces diastatochromogenes 1628-TOYB namely obtains recombinating.

With S. diastatochromogenes1628 karyomit(e)s are template, design two primers, pcr amplification toyB, and design of primers is as follows:

toyB F Nde I：5’-CGC CATATGTTGTTCAGCATCACCGTC -3’；

toyB R Not I： 5’-CGC GCGGCCGCTCACAGCGCACGCTCGTAG-3’ 。

Recombinant plasmid pMD18-T-toyB is with restriction enzyme NdeI and NotI double digestion checking as shown in Figure 2, recombinant plasmid pMD18-T-toyB double digestion obtains the dna fragmentation of about 0.4kb and 2.7kb, big or small consistent with toyB gene fragment and plasmid pMD18-T illustrates the recombinant cloning vector connection correctly respectively.PMD18-T-toyB checks order to recombinant plasmid; sequential analysis shows that inserting fragment is the sequence of 399 bp; 132 amino acid of encoding; the relative molecular weight size is about 14 kDa respectively; have higher homology with the 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme of many streptomyces of having reported, wherein be up to 90%.The toyB nucleotide sequence is shown in SEQ ID NO:1.The toyB gene is connected into the pET28a carrier; make up the pET28a-toyB recombinant vectors; and change recombinant vectors over to e. coli bl21, and the picking positive transformant is in the LB of 10mL substratum, and 37 ℃ of shaking culture are spent the night; switching next day; the IPTG abduction delivering as shown in Figure 3, induces back reorganization bacterium to have the obvious characteristics band to occur; recording 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme activity is 39 U/mg total proteins, shows toyB gene successful expression in intestinal bacteria.

The enzyme of integrated reorganization shuttle expression plasmid pIB139-toyB is cut the checking result as shown in Figure 4, recombinant plasmid pIB139-toyB warp NdeI and NotThe fragment that the I double digestion discharges 0.4 kb is consistent with toyB gene size, plasmid pIB139-toyB structure be described correctly, with the conjugal transfer method with its be incorporated into streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) on 1628 the karyomit(e), after the some single bacterium colonies of picking are cultivated repeatedly at random on the apramycin resistant panel, extract karyomit(e) in the CP substratum.The PCR experiment all can amplify the apramycin resistant gene Apr(Fig. 5), prove that reorganization streptomyces diastatochromogenes 1628-TOYB successfully constructs, and inheritance stability.

Embodiment 2:The leavening property checking of the original bacterium of streptomyces diastatochromogenes and reorganization bacterium

Compare with original strain, the 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme work of reorganization bacterium has improved 1.3 times; Reorganization bacterium 1628-TOYB and original bacterium S. diastatochromogenes1628 carry out the experiment of 250 mL shake flask fermentations, from the increase that the fermentation angle is lived to 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme the streptomyces diastatochromogenes raising effect of toyokamycin output are verified.Reciprocating type shaking speed is 200 r/min, and 28 ℃, fermentation 96h, control group are the streptomyces diastatochromogenes strain of setting out.As shown in table 1, the ultimate capacity of reorganization bacterium toyokamycin is higher than original bacterium, and reorganization bacterium toyokamycin ultimate capacity reaches 166.55 mg/L, and it is about 23.4% that more original bacterium has been improved, and repeatability is good.Explanation is produced bacterial strain at toyokamycin S. diastatochromogenesThe expression that strengthens the key enzyme 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme-ToyB of biosynthetic pathway in 1628 helps to improve the output of toyokamycin in the fermenting process.

The comparison of table 1 reorganization bacterium and the final toyokamycin output of original bacterium

Thalline	Toyokamycin output (mg/L)
		1628	134.97
1628-TOYB	166.55

SEQUENCE LISTING

＜110〉China Measures Institute

＜120〉reorganization streptomyces diastatochromogenes and construction process and purposes that toyB expresses have been strengthened

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 399

<212> DNA

<213> Streptomyces diastatochromogenes

<400> 1

ttgttcagca tcaccgtccg tgaccacctg atggtcgcgc acagcttccg cggcgcggtc 60

ttcggacccg cgcagcgcct gcacggcgcc accttcatcg tggacgccac cttccgccgc 120

cccgaactcg acgacgacaa catcgtggtc gacatcggcc tcgccaccca ggaactcggc 180

ggcgtgatcg ccgagctcaa ctaccgcaac ctcgacgacg aacccgcctt cgccgggacc 240

aacacctcca ccgaggcgct cgccaaagtg atcgccgacc ggctcgccga ccgggtgcac 300

gccggcaacc tcggtgcggg cgcccgcgac ctgagcggca tcaccgtcac cctgcacgag 360

tcccacgtgg cctgggccag ctacgagcgt gcgctgtga 399

Claims

1. the toyB gene of a streptomyces diastatochromogenes, it is characterized in that: his sequence is shown in SEQ ID NO:1.

2. strengthened the reorganization streptomyces diastatochromogenes that toyB expresses for one kind, it is characterized in that: it has expressed the key enzyme-6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene of biosynthesizing toyokamycin ToyB, have than streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) 1628 higher toyokamycin abilities to express.

3. as claimed in claim 2ly strengthened the reorganization streptomyces diastatochromogenes that toyB expresses, it is characterized in that: described original bacterium be streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) 1628.

4. as claimed in claim 2ly strengthened the reorganization streptomyces diastatochromogenes that toyB expresses, it is characterized in that: described 6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene toyB come from original bacterium streptomyces diastatochromogenes to be recombinated ( Streptomyces diastatochromogenes).

5. the reorganization streptomyces diastatochromogenes of having strengthened the toyB expression as claimed in claim 2 is characterized in that: described 6-pyruvoyl tetrahydrochysene pterin synthetase-coding gene ToyB is integrated into original bacterium streptomyces diastatochromogenes karyomit(e).

6. construction process of having strengthened the reorganization streptomyces diastatochromogenes that toyB expresses as claimed in claim 2 is characterized in that process is as follows:

1) construction of expression vector pIB139-toyB;

7. method as claimed in claim 6 is characterized in that, utilizes the promotor permE* on the pIB139 carrier to start the toyB expression of gene, utilize the conjugal transfer method with carrier pIB139-toyB specific be integrated into streptomyces diastatochromogenes ( Streptomyces diastatochromogenes) 1628 karyomit(e), obtained the engineering bacteria of inheritance stability.

8. one kind is utilized the purposes of having strengthened the reorganization streptomyces diastatochromogenes of toyB expression as claimed in claim 2; it is characterized in that; the bacterium 1628-TOYB that will recombinate ferments; compare with original strain; reorganization bacterium 6-pyruvoyl tetrahydrochysene pterin synthetic enzyme enzyme is lived and is improved at least 1.3 times, and toyokamycin output has improved 23.4% at least.