CN104293816A - Mycoplasma hyopneumoniae fusion gene and application - Google Patents
Mycoplasma hyopneumoniae fusion gene and application Download PDFInfo
- Publication number
- CN104293816A CN104293816A CN201410527845.6A CN201410527845A CN104293816A CN 104293816 A CN104293816 A CN 104293816A CN 201410527845 A CN201410527845 A CN 201410527845A CN 104293816 A CN104293816 A CN 104293816A
- Authority
- CN
- China
- Prior art keywords
- gene
- linker
- mycoplasma hyopneumoniae
- fusion gene
- pet30a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the field of animal gene engineering, and in particular relates to a synthetic fusion gene for expressing mycoplasma hyopneumoniae and application. The fusion gene is characterized in that a mycoplasma hyopneumoniae P97R1 gene is connected in series with a P36 gene through a Linker, the termination codon of the P36 gene is deleted, the P46 gene with signal peptide removed is fused at the C end of the P36 gene through Linker, and then the fusion gene P97R1-P36-P46 is obtained, wherein the nucleotide sequence of the fusion gene is shown as SEQ ID NO: 1. The fusion gene is included in a prokaryotic expression plasmid, and escherichia coli BL21/pET30a-P97R1-Linker-P36-Linker-P46 containing the plasmid is collected in CCTCC with the collection number CCTCC NO: M2014269. The invention further discloses immune efficacy evaluation of the fusion gene and application of the fusion gene in a novel vaccine.
Description
Technical field
The invention belongs to zoonosis technical field, relevant with animal genetic engineering.Be specifically related to a kind of fusion gene of mycoplasma hyopneumoniae, its preparation method and application.
Background technology
Porcine mycoplasmal pneumonia (Mycoplasmal pneumonia of swine, MPS) be by mycoplasma hyopneumoniae (Mycoplasma hyopneumoniae, MHP) cause, with the chronic respiratory transmissible disease that pig cough and asthma are cardinal symptom, there is chronic, contact, highly infective, high incidence and low actual feature.This disease is distributed widely in all over the world, often be called as epidemic swine pneumonia abroad, and be often called as swine enzootic pneumonia (Maes D in China, Segales J, Meyns T, et al.Control of Mycoplasma hyopneumoniae infections in pigs.Vet Microbiol, 2008,126:297-309).Mycoplasma hyopneumoniae infection causes the growth rate decline 12%-16% of pig, feed conversion rate reduces 13%-22%, body weight reduces 10-25kg relatively, the marketing time of market pig postpones 10-30 days (Shao Guoqing, Liu Maojun, Jin Min. detect the foundation of mycoplasma hyopneumoniae antibody indirect ELISA method. Jiangsu's agriculture journal, 2007, 23:437-441), also destroy segmental bronchus and the bronchiole cilium of pig simultaneously, and then damage stops the physical barriers of pathogenic micro-organism invasion, destroy the scavenger cell of pig, reduce the immune clearance ability of body, cause immunosuppression (Ye Baohong, willow. the immunological investigation present situation of mycoplasma hyopneumoniae. Yulin College's journal, 2009, 192.2).Therefore, clinically mycoplasma hyopneumoniae usually with the cause of disease polyinfections such as PRRS virus, pig 2 type PCV-II, swine influenza virus, actinobacillus pleuropneumoniae, pasteurella multocida, add difficulty (the Ciprian A of the diagnosis of current swine disease and prevention and control, Pijoan C, Cruz T, et al.Mycoplasma hyopneumoniae increases the susceptibility of pigs to experimental Pasteurella multocida pneumonia.Can J Vet Res, 1988,52:434-438).In addition, because mycoplasma hyopneumoniae is the prokaryotic micro-organisms lacking cell walls, insensitive to the conventional microbiotic (as beta-lactam enzyme microbiotic etc.) acting on cell walls, swinery is once by mycoplasma hyopneumoniae infection, and it will be very difficult for controlling and purify.According to the preliminary statistics, the direct economic loss that causes because of mycoplasma hyopneumoniae infection every year of the whole world is up to 200,000,000 dollars.Can say, mycoplasma hyopneumoniae has become the great epidemic disease that current serious affects pig industry economic benefit, is called " Silent Killer " that affect pig industry economic benefit.
Mainly take vaccine immunity for the prevention and control of mycoplasma hyopneumoniae at present, isolation evolution swinery, strengthens the measures such as hygienic condition monitoring.China's widely used mycoplasma hyopneumoniae inactivated vaccine is primarily of external import: as Pfizer pharmaceutical Co. Ltd have developed " fitting for auspicious times " deactivation vaccine; Nanjing Cimmeria animal health company limited is immunological adjuvant with Algeldrate, has prepared " the pig gram breathes heavily " commercially available vaccine with immunoprotection effect; It take polyvinyl resin as the i (mycoplasma hyopneumoniae) vaccine of immunological adjuvant that Fu Dao animal health company of the U.S. have developed a kind of; Boehringer Ingelheim company of Germany have developed " mattress lattice are sent out " etc.Due to Culture Mycoplasma difficulty, the price of above-mentioned commercialized vaccine is all quite expensive.The whole world in 1999 only for this expense of vaccine control porcine mycoplasmal pneumonia just up to 1.1 hundred million pounds, account for 1/4th (Ross R F.Mycoplasmal Disease, Swine Diease, 6 that the whole world in 1999 spends on pig vaccine
thedi Iowa.1986:496-483).Based on this, utilize gene engineering method to develop low cost, safety, new high-efficiency i (mycoplasma hyopneumoniae) vaccine will become the important directions of anti-this disease of system.
Mycoplasma hyopneumoniae P97 genes encoding cilium adhesin, be proved the adhesion factor with adhesive attraction the earliest, its main Antigen distribution is held at the C of P97, the short peptide sequence of the tandem sequence repeats that C holds existence one section to be made up of 5 amino acid (AAKPV/E), i.e. Rl district.Minion (Minion F C, Adams C, Hsu T.R1 region of P97 mediates adherence of Mycoplasma hyopneumoniae to swine cilia.Infect Immun, 2000,68:3056-3060) point out that the short peptide sequence (AAKPV/E) of tandem sequence repeats in P97R1 must reach more than 8 and just have the ability adhering to ciliated cell.P36 is a kind of cytosol albumen, there is lactate dehydrogenase activity, research confirms in the pig body of artificial and natural infection, P36 can induce early stage innate immunity (Frey J, Haldimann A, Kobisch M, et al.Immune response against the L-lactate dehydrogenase of Mycoplasma hyopneumoniae in enzootic pneumonia of swine.Microb Pathog, 1994, 17:313-322), the specific antibody produced can maintain longer time (Strasser M in vivo, Frey J, Bestetti G, et al.Cloning and expression of a species-specific early immunogenic 36-kilodalton protein of Mycoplasma hyopneumoniae in Escherichia coli.Infect Immun, 1991, 59:1217-1222).P46 is the surface antigen protein of mycoplasma hyopneumoniae, can cause host's early immune responsing reaction.The B subunit of P97R1 and enterotoxins of Escherichia coli is merged rear immune mouse by Conceicao, find that mucous membrane and the systemic immunity response of mouse obtain obvious activation (Conceicao F R, Moreira A N, Dellagostin O A.A recombinant chimera composed of R1 repeat region of Mycoplasma hyopneumoniae P97 adhesin with Escherichia coli heat-labile enterotoxin B subunit elicits immune response in mice.Vaccine, 2006, 24:5734-5743).P97NrdF fragment is inserted the Salmonellas of attenuation by Fagan, prepare Salmonellas live vector vaccine, and Efficacy evaluation has been carried out in pig body, found that the pulmonary lesion that this vaccine can weaken mycoplasma hyopneumoniae infection and causes, improve day weight gain (the Fagan P K of infected pigs, Walker M J, Chin J, et al.Oral immunization of swine with attenuated Salmonella typhimurium aroA SL3261 expressing a recombinant antigen of Mycoplasma hyopneumoniae (NrdF) primes the immune system for a NrdF specific secretory IgA response in the lungs.Microb Pathog, 2001, 30:101-110).P97, P36 and P46 usually as the preferred object gene of vaccine design, for the development of mycoplasma hyopneumoniae recombinant vaccine.Therefore, we construct a kind of mycoplasma hyopneumoniae fusion gene (P97R1-P36-P46), and compare the immunogenic difference of this fusion gene and individual gene, in the hope of obtaining the lower genetic resources of better cost.
Summary of the invention
A task of the present invention is the scarce limit overcoming prior art, its objective is by the gene of mycoplasma hyopneumoniae as P97R1, P36 and P46 gene tandem, thus obtains the better fusion gene P97R1-P36-P46 of a kind of immunogenicity.
Another object of the present invention be evaluate obtain the immunogenicity of mycoplasma hyopneumoniae fusion gene P97R1-P36-P46 and utilize this fusion gene development of new i (mycoplasma hyopneumoniae) vaccine and application.
The present invention implements by the following technical programs:
Applicant is by engineered method, obtain a kind of expression mycoplasma hyopneumoniae fusion gene P97R1-P36-P46 of synthetic, it is that (base sequence of Linker is: GGCAGCGGCAGCGGCAGCGGCAGC) by mycoplasma hyopneumoniae P 97 R 1 gene and P36 gene tandem by Linker method, and lack the terminator codon (TAA) of wherein P36 gene, merge by Linker method the P46 gene removing signal peptide at the C end of P36 gene and obtain.
The nucleotide sequence of above-mentioned fusion gene P97R1-P36-P46 is as shown in sequence table SEQ ID NO:1.
Fusion gene of the present invention builds by the following method and obtains: NcoI and the XhoI site of above-mentioned mycoplasma hyopneumoniae fusion gene P97R1-P36-P46 being inserted prokaryotic expression carrier pET-30a (+), structure obtains recombinant plasmid pET30a-P97R1-Linker-P36-Linker-P46, and by these recombinant plasmid transformed intestinal bacteria, obtain intestinal bacteria (Escherichia coli) BL21/pET30a-P97R1-Linker-P36-Linker-P46 recombinated, we are by the intestinal bacteria called after e. coli bl21/pET30a-P97R1-Linker-P36-Linker-P46 of this restructuring, Escherichia coli BL21/pET30a-P97R1-Linker-P36-Linker-P46, China is delivered on June 19th, 2014. Wuhan. Wuhan University's China typical culture collection center preservation, its preserving number is CCTCC NO:M2014269.
The present invention also comprises above-mentioned P97R1-P36-P46 fusion gene and is preparing the application in porcine mycoplasmal pneumonia vaccine.
And then also comprise: preserving number is that intestinal bacteria (Escherichia coli) BL21/pET30a-P97R1-Linker-P36-Linker-P46 of CCTCC NO:M2014269 is preparing the application in porcine mycoplasmal pneumonia vaccine
The invention has the beneficial effects as follows:
1, obtain a kind of P97R1-P36-P46 gene of fusion, the immunogenicity of this fusion gene is significantly higher than the immunogenicity of individual gene, for development of new i (mycoplasma hyopneumoniae) vaccine is laid a good foundation.
2, fusion gene P97R1-P36-P46 is lower-cost genetic resources, and the subunit vaccine expression amount based on P97R1-P36-P46 fusion gene is high, is easy to purifying and preparation.Compare preparation cost with the inactivated vaccine of routine with attenuated vaccine significantly to reduce.
The more detailed technical scheme of the present invention is as described in " embodiment ".
Accompanying drawing explanation
Sequence table SEQ ID NO:1 is the nucleotide sequence of the porcine mycoplasmal fusion gene P97R1-P36-P46 of synthetic of the present invention, and sequence length is 2426bp.
Sequence table SEQ ID NO:2 is with mycoplasma hyopneumoniae 168 pnca gene group DNA for template, and the nucleotide sequence of the P97R1 gene that pcr amplification obtains, sequence length is 252bp.
Sequence table SEQ ID NO:3 is with mycoplasma hyopneumoniae 168 pnca gene group DNA for template, and the nucleotide sequence of the P36 gene that pcr amplification obtains, sequence length is 945bp.
Sequence table SEQ ID NO:4 is with mycoplasma hyopneumoniae 168 pnca gene group DNA for template, and the nucleotide sequence of the P46 gene that pcr amplification obtains, sequence length is 1146bp.
Fig. 1: be techniqueflow block diagram of the present invention.
Fig. 2: the structure schematic diagram being recombinant plasmid pET30a-P97R1-Linker-P36-Linker-P46 in the present invention.Wherein: Fig. 2 A is total structure schematic diagram; Fig. 2 B is the physical map of plasmid A (pET30a-P46); Fig. 2 C is the physical map of plasmid B (pET30a-P36-Linker-P46); Fig. 2 D is the physical map of plasmid C (pET30a-P97R1-Linker-P36-Linker-P46).
Fig. 3: the glue figure being the prokaryotic expression of the recombinant plasmid pET30a-P97R1-Linker-P36-Linker-P46 in the present invention.Description of symbols in figure: M: molecular weight of albumen; 1:pET30a-p97R1-linker-p36-linker-p46 (BL21) 37 DEG C of IPTG induce 5h; 2:pET30a-p97R1-linker-p36-linker-p46 (BL21) does not induce; 3:pET-30a (+) (BL21) 37 DEG C of IPTG induce 5h.
Fig. 4: be the glue figure in the present invention after pET30a-P97R1-Linker-P36-Linker-P46 fusion protein purification.Description of symbols in figure: M: molecular weight of albumen; 1-9 swimming lane: the purifying of pET30a-p97R1-linker-p36-linker-p46 fusion rotein
Fig. 5: the detection of recombinant subunit vaccine pET30a-P97R1-Linker-P36-Linker-P46, pET32a-P36, pET32a-P46, pET32a-P97R1 of utilizing the present invention to prepare and the antibody horizontal after contrasting phosphate buffered saline buffer (PBS) immune BALB/c mouse in serum.Description of symbols in figure: LP:pET30a-P97R1-Linker-P36-Linker-P46 subunit vaccine immune group.
Embodiment
The structure of embodiment 1:P97R1-P36-P46 fusion gene
1, the design (being shown in Table 1) of primer
Table 1 PCR primer
In table 1, in primer sequence, underscore part is corresponding restriction enzyme site, and the sequence that in P36 primer and P46 primer, boldface letter represents is the nucleotide sequence of Linker, and the primer of table 1 is synthesized by Nanjing Genscript Biotechnology Co., Ltd..
2, the amplification of P46, P36 and P97R1 gene
With mycoplasma hyopneumoniae 168 pnca gene group DNA (Liu W, Feng Z X, Fang L R, et al.Complete genome sequence of Mycoplasma hyopneumoniae strain 168.Journal of Bacteriology.2011,193:1016-1017) increase for template uses Prime STAR to carry out P97R1 (GenBank accession number ADQ90328.1), P36 (GenBank accession number ADQ90382.1) and P46 gene (GenBank accession number ADQ90718.1).
The system of pcr amplification is in described in table 2:
Table 2 PCR amplification system
The amplification condition of P97R1 gene order is: enter circulation after 94.0 DEG C of 5min sex change, loop parameter is: 98.0 DEG C of 10s, 59.0 DEG C of 15s, 72.0 DEG C of 30s, 35 rear 72.0 DEG C of extension 10min of circulation.The PCR primer of amplification is through 0.8% agarose gel electrophoresis analysis, and pcr amplification obtains the DNA fragmentation (P97R1) (see sequence table SEQ ID NO:2 Suo Shi) of long 252bp.
The amplification condition of P36 gene order is: enter circulation after 94.0 DEG C of 5min sex change, loop parameter is: 98.0 DEG C of 10s, 59.0 DEG C of 15s, 72.0 DEG C of 1min, 35 rear 72.0 DEG C of extension 10min of circulation.The PCR primer of amplification is through 0.8% agarose gel electrophoresis analysis, and pcr amplification obtains DNA fragmentation (the disappearance terminator codon of long 945bp
tAAp36 gene) (except the tail of this gene
tAAoutward, the sequence pair shown in its nucleotide sequence and SEQ ID NO:3 is answered).
The nucleotide sequence (sequence containing underscore is the terminator codon of P36 gene) as follows of the P36 gene that amplification obtains:
ATGAAACCTATTAAAATAGCTCTAATTGGTGCTGGAAATGTCGGAAATTCCTTCCTTTATGCAGCAATGAATCAAGGACTTGCATCCGAGTATGGAATTATTGATATTAATCCTGATTTTGCCGATGGTAATGCTTTTGATTTTGAAGATGCCTCAGCTTCTTTGCCTTTTCCGATTAGTGTCTCCCGTTATGAATATAAAGATCTAAAAGATGCTGATTTTATTGTAATTACAGCGGGAAGACCACAAAAACCGGGTGAAACTCGGCTTGAATTAGTAGCTGATAACATCCGAATTATCCGGGAAATTGCACTAAAAGTCAAAGAAAGTGGCTTTAGTGGAATAAGTATTATTGTTGCTAATCCTGTTGATATAATTACAAGGGCTTACCGGGATGCATCTGGATTTTCCGATCAAAAAGTTATCGGTAGTGGAACTGTTTTAGATACAGCAAGGCTTCAATTTGCAATCGCAAAAAGAGCAAAAGTATCGCCTAATTCGGTTCAGGCCTACGTGATGGGTGAACATGGTGATTCATCTTTTGTTGCTTATTCAAATATTAAAATTGCCGGTGAATGTTTCTGTGCTTATTCTAAACTAACCGGAATTAATAGCTCAAATTACGAAAAAGAACTTGAATATCCAGTTTCTCGCCGGGCTTATGAAATTATTAATCGTAAAAGGGCAACATTTTATGGAATTGGTGCAGCTATTGCCAAAATAGTTTCTAATATTATCAAAGATACAAAAAATATTATGATTGCCGGAGCAAATTTACGAGGAGAATACGGATTTCACGGAGTAAATATCGGAGTTCCAGTTGTTTTAGGGGCAAACGGAATTGAAAAAATTATTGAGATTAGTCTTAATGATAAAGAAAAAGAAAAATTTGCCAAATCAGTTGCAATCATTGATAAAATTTATCAGGATGCAATTAAAAATATT
TAA；
The amplification condition of P46 gene order is: enter circulation after 95.0 DEG C of 5min sex change, loop parameter is: 98.0 DEG C of 10s, 59.0 DEG C of 15s, 72.0 DEG C of 1.5min, 35 rear 72.0 DEG C of extension 10min of circulation.Amplification PCR primer through 0.8% agarose gel electrophoresis analysis, pcr amplification obtain long 1146bp DNA fragmentation (deleted signal peptide:
aTGAAAAAAATGCTTAGAAAAAAATTTTTGTATTCATCAGCTATTTATGCAACTTC GCTTG cATCAATTATTGCATTTGTTGCAGCAGGTTGTGGACAGACAGAATCAGGTTCGp46 gene) (except 114bp signal peptide sequence before this gene, the sequence pair shown in its nucleotide sequence and SEQ ID NO:4 should).
The nucleotide sequence (sequence containing underscore is the signal peptide region of P46) as follows of the P46 gene that amplification obtains:
ATGAAAAAAATGCTTAGAAAAAAATTTTTGTATTCATCAGCTATTTATGCAACTTCGC TTGCATCAATTATTGCATTTGTTGCAGCAGGTTGTGGACAGACAGAATCAGGTTCGACTTCTGATTCTAAACCACAAGCCGAGACTCTAAAACATAAAGTAAGTAATGATTCTATTCGAATAGCACTAACCGATCCGGATAATCCTCGATGAATTAGTGCCCAAAAAGATATTATTTCTTATGTTGATGAAACAGAGGCAGCAACTTCAACAATTACAAAAAACCAGGATGCACAAAATAACTGACTCACTCAGCAAGCTAATTTAAGTCCAGCACCAAAAGGATTTATTATTGCCCCTGAAAATGGAAGTGGAGTTGGAACTGCTGTTAATACAATTGCTGATAAAGGAATTCCGATTGTTGCCTATGATCGACTAATTACTGGATCTGATAAATATGATTGGTATGTTTCTTTTGATAATGAAAAAGTTGGCGAATTACAAGGTCTTTCACTTGCTGCGGGTCTATTAGGAAAAGAAGATGGTGCTTTTGATTCAATTGATCAAATGAATGAATATCTAAAATCACATATGCCCCAAGAGACAATTTCTTTTTATACAATCGCGGGTTCCCAAGATGATAATAATTCCCAATATTTTTATAATGGTGCAATGAAAGTACTTAAAGAATTAATGAAAAATTCGGAAAATAAAATAATTGATTTATCTCCTGATGGCGAAAATGCTGTTTATGTCCCAGGATGAAATTATGGAACTGCTGGTCAAAGAATCCAATCTTTTCTAACAATTAATAAAGATCCAGCAGGTGGTAATAAAATCAAAGCTGTTGGTTCAAAACCAGCTTCTATTTTCAAAGGATTTCTTGCCCCAAATGATGGAATGGCCGAACAAGCAATCACCAAATTAAAACTTGAAGGATTTGATACCCAAAAAATCTTTGTAACCGGTCAAGATTATAATGATAAAGCCAAAACTTTTATCAAAGACGGCGATCAAAATATGACAATTTATAAACCTGATAAAGTTTTAGGAAAAGTTGCTGTTGAAGTTCTTCGGGTTTTAATTGCAAAGAAAAATAAAGCATCTAGATCAGAAGTCGAAAACGAACTAAAAGCAAAGCTACCAAATATTTCATTTAAATATGATAATCAAACATATAAAGTACAAGGTAAAAATATTAATACAATTTTAGTAAGTCCAGTAATTGTTACAAAAGCTAATGTTGATAATCCTGATGCCTAA
3, the structure of recombinant plasmid pET30a-P97R1-Linker-P36-Linker-P46
Primer P46-F, P46-R is utilized to carry out pcr amplification to P46 gene, obtain the P46 gene of disappearance P46 N end signal peptide, reclaim this gene fragment also with after Not I and Xho I double digestion, be inserted into pET-30a (+) (Novagen, Germany) Not I and Xho I site between, obtain recombinant plasmid pET30a-P46.Utilize P36-F, P36-R primer amplification P36 gene (removal terminator codon) further, by the PCR primer of acquisition with after Not I and Sal I double digestion, be connected with the pET30a-P46 plasmid cut through Not I and SalI enzyme, obtain recombinant plasmid pET30a-P36-Linker-P46.Utilize the R1 region of P97-F, P97-R primer amplification P97 gene, by the PCR primer of acquisition with after Nco I and Sal I double digestion, be connected with the pET30a-P36-Linker-P46 plasmid cut through Nco I and Sal I enzyme, obtain the prokaryotic expression plasmid pET30a-P97R1-Linker-P36-Linker-P46 of P97R1-P36-P46 fusion gene and this fusion gene of expression.Cut through enzyme and identify and confirm that construction of recombinant plasmid is correct with checking order.Recombinant plasmid pET30a-P97R1-Linker-P36-Linker-P46 structure iron as shown in Figure 2.
4, the structure (for contrasting with the immune effect of individual gene in simultaneous test) of recombinant plasmid pET32a-P97R1, pET32a-P36, pET32a-P46
With mycoplasma hyopneumoniae 168 pnca gene group DNA (Liu W, Feng Z X, Fang L R, et al.Complete genome sequence of Mycoplasma hyopneumoniae strain 168.Journal of Bacteriology.2011,193:1016-1017) be masterplate, obtain the DNA fragmentation of P46 with primer P1 and P2 pcr amplification, obtain the DNA fragmentation of P36 with primer P3 and P4 amplification, obtain the DNA fragmentation of P97R1 with primer P5 and P6 amplification.PCR amplification system is with reference to table 2, and the amplification condition of P97R1 gene order is: enter circulation after 94.0 DEG C of 5min sex change, loop parameter is: 98.0 DEG C of 10s, 52.0 DEG C of 15s, 72.0 DEG C of 30s, 35 rear 72.0 DEG C of extension 10min of circulation; The amplification condition of P36 gene order is: enter circulation after 94.0 DEG C of 5min sex change, loop parameter is: 98.0 DEG C of 10s, 52.0 DEG C of 15s, 72.0 DEG C of 1min, 35 rear 72.0 DEG C of extension 10min of circulation; The amplification condition of P46 gene order is: enter circulation after 94.0 DEG C of 5min sex change, loop parameter is: 98.0 DEG C of 10s, 52.0 DEG C of 15s, 72.0 DEG C of 1.5min, 35 rear 72.0 DEG C of extension 10min of circulation.Amplification is detected by 0.8% agarose gel electrophoresis, purifying reclaims object fragment, the amplified production of purifying is after BamH I, Xho I double digestion, be cloned into prokaryotic expression carrier pET-32a (+) (Novagen respectively, Germany) corresponding site (BamH I and Xho I), obtain recombinant plasmid pET32a-P46, pET32a-P36, pET32a-P97R1 of expressing P46, P36 and P97R1 gene respectively, cut through enzyme and to identify with PCR and confirm that plasmid construction is correct, order-checking confirms to mismatch without base.
Embodiment 2: the prokaryotic expression of recombinant plasmid pET30a-P97R1-Linker-P36-Linker-P46
1, the conversion of plasmid
By expression plasmid pET30a-P97R1-Linker-P36-Linker-P46 (blocking that resistance) the transformation of E. coli BL21 competent cell containing mycoplasma hyopneumoniae P 97 R 1-P36-P46 fusion gene.
Concrete operations are as follows:
1) get 100 μ L e. coli bl21 competent cell suspensions to transfer in aseptic 1.5ml EP pipe, add 3 μ L and connect product, rotate gently with contents were mixed, place 30min on ice.
2) centrifuge tube to be put in the circulator bath being warmed to 42 DEG C in advance thermal shocking 90 seconds.
3) fast centrifuge tube is transferred in ice bath, make cell cool 1 ~ 2min.
4) often pipe adds 400 μ L LB substratum.Heat to 37 DEG C with water-bath by substratum, then transferred to by centrifuge tube on 37 DEG C of shaking tables, incubation 45min, makes bacteria resuscitation.For reaching effective conversion, during recovery, rotating speed is no more than 225 revs/min.
5) competent cell getting 100 μ L conversions is transferred to containing on corresponding antibiotic LB agar plate, with an aseptic elbow glass rod, the cell of conversion is uniformly applied to agar plate surface.
6) plate is put 37 DEG C of cultivations, until liquid is absorbed, being then inverted plate and cultivating, can there is bacterium colony in 12 ~ 16h.
2, prokaryotic expression
Picking list bacterium colony enlarged culturing, uses plasmid Mini Kit (Beijing Tian Gen biochemical technology company limited) to extract its plasmid and carries out enzyme and cut and identify and preserve bacterium liquid.After qualification is correct, the bacterium liquid of preservation is recovered according to the volume ratio of 1:1000.Next day, induce according to the volume ratio of 1:100.Be 0.8mM IPTG at final concentration, induce under the condition of 37 DEG C and 180r/min.Before induction and after induction, 3h, 4h, 5h and 6h sample 1mL respectively, and using the bacteria-induction product of the E.coli BL21 (DE3) transforming pET-30a carrier as blank.After the centrifugal 1min of 12000r/min, add 100 μ L ddH
2after the resuspended bacterium liquid of O, add 25 μ L 5 × Loading Buffer, in the boiling water of 100 DEG C, boil 10min, after ice bath 10min, carry out sample analysis by 12%SDS-PAGE, determine whether the protokaryon albumen of recombinating expresses.When carrying out SDS-PAGE and detecting, before loading, by all centrifugal 1min of sample 10000r/min, extract the sample loading being positioned at sample liquid level upper strata.In addition, carry out Western Blotting analysis using the monoclonal antibody of P46 as antibody, whether checking recombinant protein expresses.Determining that prokaryotic recombinant protein can after stably express, again induce 100mL recombinant bacterium, after high pressure cracker fragmentation, the centrifugal 10min of 12000r/min, upper cleer and peaceful precipitation is boiled sample respectively, carry out 12%SDS-PAGE detection, determine the expression-form of recombinant protein, pET30a-P97R1-Linker-P36-Linker-P46 expresses in supernatant with soluble form.Test-results as shown in Figure 3.
The purifying of embodiment 3:pET30a-P97R1-Linker-P36-Linker-P46 fusion rotein
Carry out purifying with the pET30a-P97R1-Linker-P36-Linker-P46 fusion rotein AKTA FPLC (Amersham Biosciences UPC-900) that soluble form is expressed, purification step is as follows:
(1) by the bacterium liquid 200mL after induction 5h, the centrifugal 1min of 12000r/min, discard supernatant, by resuspended for precipitation Binding Buffer (1/10), be placed in-80 DEG C of refrigerators, after multigelation three times, be crushed to limpid with the broken instrument of ultra-high voltage ripple, the centrifugal 30min of 12000r/min, gets supernatant, by supernatant 0.22 μm of membrane filtration, be placed in for subsequent use on ice.
(2) open analyser, then open computer, select UNICORNS.1.0, select default, hit OK.
(3) select System control, A, B two probes are put into 20% dehydrated alcohol, opens successively: Manual → Pump → Pump Wash → A:ON, B:ON → Execute; Flow → Flow Rate 1.0mL/min, starts sucking pump, terminates afterwards until system is cleaned automatically.
(4) under the state of dehydrated alcohol flowing, protein purification post is loaded specified location, continue flowing washes of absolute alcohol purification column, about 30mL.
(5), after Pause → distilled water cleaning cleaning probe (A, B pump), A pump is put into Binding Buffer, and Elution Buffer → Continue put into by B pump.Gradient 0.0% does not need to regulate.
(6) after about 60mL, after red, blue line is parallel, Pause, cleaning A pump, puts into sample, Continue, 0.5mL/min, after completion of the sample, Pause, cleaning A pump, puts into Binding Buffer, Continue, until red line drops to minimum, flow 10mL again, start wash-out, Flow rate 1.0mL/min.
(7) from 10%, different wash-out concentration can be used to carry out wash-out, often change once different wash-out concentration, could change when must be red, blue line keeping parallelism, be finally 100%, sample is all collected by the peak value place of each wash-out concentration.
(8) Pause, cleaning A, B pump, all puts into dehydrated alcohol, Continue, until red, blue line be all down to minimum cut parallel, End.Pull down purification column, close all operations window, turn off analyser and computer.
(9) utilize the concentration of spectrophotometric determination purifying protein, and detect its purity by SDS-PAGE, be diluted to 0.4 μ g/ μ L with phosphate buffered saline buffer (PBS pH7.4), namely can be used for animal injection.Test-results as shown in Figure 4.
Embodiment 4: subunit vaccine of the present invention and control vaccine are to the biological experiment of mouse immune effect
1, the immune programme for children of BALB/c mouse
50 5-6 female BAl BIc/c mouse in age in week are divided into 5 groups, be respectively PBS control group, pET32a-P36, pET32a-P46, pET32a-P97R1 and pET30a-P97R1-Linker-P36-Linker-P46 immune group, often organize 5, employing hind leg muscle is injected, immunity is carried out according to shown in table 3, immunity 2 times, carries out two after head exempts from 21d and exempts from altogether.Within 2,3,5,6 weeks after first immunisation, through tail vein negative pressure hemostix, separation of serum, detects Serum Antibody level.
Table 3: the mouse experiment grouping of mycoplasma hyopneumoniae recombinant subunit vaccine
2, antibody horizontal in mice serum
Utilize mycoplasma hyopneumoniae 168 strain whole bacterial protein coated elisa plate (4 μ g/mL), 2nd, 3,5,6 week Serum Antibody level after detection first immunisation, result shows that pET30a-P97R1-Linker-P36-Linker-P46 immune group can produce the specific antibody of higher level on the 3rd week after head exempts from.After booster immunization, except phosphate buffered saline buffer (PBS, formula: take 8g NaCl, 0.2g KCl, 1.44g Na
2hPO
4, 0.24g KH
2pO
4, be dissolved in 800mL ddH
2in O, adjust pH to 7.2, be settled to 1000mL, autoclaving, room temperature preservation is for subsequent use) outside group, other immune group antibody horizontal is all remarkable ascendant trend, the specific antibody that pET30a-P97R1-Linker-P36-Linker-P46 immune group produces rises rapidly, reaches higher level, difference extremely significantly (P<0.01 compared with single-gene immune group, t-test), test-results as shown in Figure 5.
Claims (5)
1. a fusion gene P97R1-P36-P46 for the expression mycoplasma hyopneumoniae of synthetic, its nucleotide sequence is as shown in sequence table SEQ ID NO:1.
2. the fusion gene of the expression mycoplasma hyopneumoniae of the synthetic as shown in claim 1, it obtains as follows:
Utilize Linker method by mycoplasma hyopneumoniae P 97 R 1 gene and P36 gene tandem, the terminator codon of disappearance P36 gene, merged at the C end of P36 gene the P46 gene removing signal peptide by Linker, thus obtain fusion gene P97R1-P36-P46;
Wherein:
The nucleotide sequence of P97R1 gene is as shown in SEQ ID NO:2;
The nucleotide sequence of P36 gene is as shown in SEQ ID NO:3;
The nucleotide sequence of P46 gene is as shown in SEQ ID NO:4;
The base sequence of above-mentioned Linker is: GGCAGCGGCAGCGGCAGCGGCAGC.
3. comprise intestinal bacteria (Escherichia coli) BL21/pET30a-P97R1-Linker-P36-Linker-P46 of mycoplasma hyopneumoniae fusion gene, be deposited in China typical culture collection center, its preserving number is CCTCC NO:M2014269, and the nucleotide sequence of described mycoplasma hyopneumoniae fusion gene is as described in SEQ ID NO:1.
4. mycoplasma hyopneumoniae fusion gene according to claim 1 is preparing the application in porcine mycoplasmal pneumonia vaccine.
5. preserving number according to claim 3 is that intestinal bacteria (Escherichia coli) BL21/pET30a-P97R1-Linker-P36-Linker-P46 of CCTCC NO:M2014269 is preparing the application in porcine mycoplasmal pneumonia vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410527845.6A CN104293816B (en) | 2014-07-04 | 2014-10-09 | Mycoplasma hyopneumoniae fusion gene and application |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2014103172438 | 2014-07-04 | ||
| CN201410317243 | 2014-07-04 | ||
| CN201410317243.8 | 2014-07-04 | ||
| CN201410527845.6A CN104293816B (en) | 2014-07-04 | 2014-10-09 | Mycoplasma hyopneumoniae fusion gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293816A true CN104293816A (en) | 2015-01-21 |
| CN104293816B CN104293816B (en) | 2017-01-04 |
Family
ID=
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015192196A1 (en) * | 2014-06-16 | 2015-12-23 | Ouro Fino Saúde Animal Ltda | Complex of immunogenic polyproteins of m. hyopneumoniae, synthetic gene encoding the complex of immunogenic polyproteins of m. hyopneumoniae, immunogenic composition, method for producing a complex of immunogenic polyproteins of m. hyopneumoniae, use of a composition based on the complex of immunogenic polyproteins of m. hyopneumoniae |
| CN107828810A (en) * | 2017-10-25 | 2018-03-23 | 李晓菊 | A kind of fusion and its application in pneumovax is prepared |
| CN109200284A (en) * | 2018-09-30 | 2019-01-15 | 江苏省农业科学院 | A kind of porcine mycoplasmal pneumonia live vaccine Mucosal Adjuvants, preparation method and applications |
| CN109207502A (en) * | 2018-10-10 | 2019-01-15 | 杭州洪桥中科基因技术有限公司 | Porcine mycoplasmal pneumonia and porcine circovirus 2 type recombinant protein and prepare bigeminy vaccine |
| CN109620953A (en) * | 2019-01-21 | 2019-04-16 | 南京农业大学 | Recombined bacillus subtilis is preventing or is treating the application in mycoplasma hyopneumoniae infection |
| CN111925452A (en) * | 2020-10-19 | 2020-11-13 | 苏州世诺生物技术有限公司 | Mycoplasma hyopneumoniae genetic engineering subunit vaccine, and preparation method and application thereof |
| CN112891524A (en) * | 2020-12-09 | 2021-06-04 | 扬州优邦生物药品有限公司 | Porcine mycoplasma pneumoniae subunit vaccine composition and preparation method and application thereof |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015192196A1 (en) * | 2014-06-16 | 2015-12-23 | Ouro Fino Saúde Animal Ltda | Complex of immunogenic polyproteins of m. hyopneumoniae, synthetic gene encoding the complex of immunogenic polyproteins of m. hyopneumoniae, immunogenic composition, method for producing a complex of immunogenic polyproteins of m. hyopneumoniae, use of a composition based on the complex of immunogenic polyproteins of m. hyopneumoniae |
| CN107828810A (en) * | 2017-10-25 | 2018-03-23 | 李晓菊 | A kind of fusion and its application in pneumovax is prepared |
| CN107828810B (en) * | 2017-10-25 | 2019-01-25 | 武汉迈特维尔生物科技有限公司 | A kind of fusion and its preparing the application in pneumovax |
| CN109200284A (en) * | 2018-09-30 | 2019-01-15 | 江苏省农业科学院 | A kind of porcine mycoplasmal pneumonia live vaccine Mucosal Adjuvants, preparation method and applications |
| CN109200284B (en) * | 2018-09-30 | 2022-01-11 | 江苏省农业科学院 | Mycoplasma hyopneumoniae live vaccine mucosal immune adjuvant, and preparation method and application thereof |
| CN109207502A (en) * | 2018-10-10 | 2019-01-15 | 杭州洪桥中科基因技术有限公司 | Porcine mycoplasmal pneumonia and porcine circovirus 2 type recombinant protein and prepare bigeminy vaccine |
| CN109620953A (en) * | 2019-01-21 | 2019-04-16 | 南京农业大学 | Recombined bacillus subtilis is preventing or is treating the application in mycoplasma hyopneumoniae infection |
| CN109620953B (en) * | 2019-01-21 | 2021-09-14 | 南京农业大学 | Application of recombinant bacillus subtilis in preventing or treating mycoplasma hyopneumoniae infection |
| CN111925452A (en) * | 2020-10-19 | 2020-11-13 | 苏州世诺生物技术有限公司 | Mycoplasma hyopneumoniae genetic engineering subunit vaccine, and preparation method and application thereof |
| CN111925452B (en) * | 2020-10-19 | 2020-12-18 | 苏州世诺生物技术有限公司 | Mycoplasma hyopneumoniae genetic engineering subunit vaccine, and preparation method and application thereof |
| CN112891524A (en) * | 2020-12-09 | 2021-06-04 | 扬州优邦生物药品有限公司 | Porcine mycoplasma pneumoniae subunit vaccine composition and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101178415B1 (en) | Attenuated Salmonella mutants transformed with adhesin gene of pathogenic Escherichia coli in pigs and Vaccine composition comprising thereof for protection and treatment against pathogenic Escherichia coli and Salmonella in pigs | |
| CN107298716A (en) | A kind of recombinant helicobacterpylori protein vaccine and preparation method thereof | |
| CN106928373B (en) | Multi-epitope mucosal vaccine for mycoplasma hyopneumoniae | |
| CN113354743A (en) | Multi-epitope antigen and vaccine for piglet diarrhea as well as preparation method and application of multi-epitope antigen and vaccine | |
| CN102276730A (en) | Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof | |
| CN108774628B (en) | Escherichia coli engineering bacterium for synthesizing neonatal meningitis escherichia coli glycoprotein conjugate vaccine and application | |
| KR102228308B1 (en) | Vaccine composition for preventing swine mycoplasmal pneumonia and pleuropneumonia | |
| CN113350495B (en) | Streptococcus suis-haemophilus parasuis disease-porcine infectious pleuropneumonia triple subunit vaccine and preparation method thereof | |
| WO2015066292A1 (en) | Attenuated pasteurella multocidavaccines & methods of making & use thereof | |
| EP3231868B1 (en) | O-antigen carbohydrate chain extended salmonella paratyphi a and use thereof | |
| CN102732473B (en) | The recombinant salmonella choleraesuis of expression mycoplasma hyopneumoniae p46 albumen and preparation method and application | |
| CN113943714A (en) | Cat calicivirus strain and application thereof | |
| CN117427153A (en) | Vaccine prepared from truncated erysipelothrix rhusiopathiae SpaA protein and application thereof | |
| CN108822192B (en) | Actinobacillus pleuropneumoniae immunoprotective antigen protein APJL _1976 and application thereof | |
| CN115850404A (en) | Recombinant erysipelothrix rhusiopathiae surface protection antigen A with tandem dominant epitopes and application thereof | |
| CN115991749A (en) | Porcine infectious pleuropneumonia-porcine pasteurellosis bigeminal subunit vaccine | |
| CN105602981B (en) | Preparation method and application of porcine epidemic diarrhea virus genetic engineering subunit oral combined vaccine | |
| CN104293816B (en) | Mycoplasma hyopneumoniae fusion gene and application | |
| CN110408633B (en) | Prokaryotic expression preparation method of BTV1 VP2 protein | |
| CN104293816A (en) | Mycoplasma hyopneumoniae fusion gene and application | |
| CN113980101A (en) | Actinobacillus pleuropneumoniae subunit vaccine | |
| TWI458823B (en) | Recombinant surface protein antigen of streptococcus suis, method of producing the same in mass by using bioreactor and vaccine composition including the same | |
| CN107625960B (en) | Universal swine colibacillosis vaccine and preparation method thereof | |
| CN107245105B (en) | HN-VP233-221aa fusion protein and preparation method and application thereof | |
| CN115725002B (en) | Coli specific antigen fusion protein and recombinant lactococcus lactis thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |