CN110408633B

CN110408633B - Prokaryotic expression preparation method of BTV1 VP2 protein

Info

Publication number: CN110408633B
Application number: CN201910618587.5A
Authority: CN
Inventors: 陈玉梅; 王爱萍; 刘运超; 刘燕凯; 冯景
Original assignee: Henan Zhongze Biological Engineering Co ltd; Zhengzhou University
Current assignee: Henan Zhongze Biological Engineering Co ltd; Zhengzhou University
Priority date: 2019-07-10
Filing date: 2019-07-10
Publication date: 2022-06-24
Anticipated expiration: 2039-07-10
Also published as: CN110408633A

Abstract

The application belongs to the technical field of animal vaccine preparation, and particularly relates to a preparation method for preparing BTV1 (bluetongue 1 virus) VP2 protein by using a genetic engineering technology. The coding sequence VP2U of the gene of the VP2 protein of the bluetongue 1 virus consists of 2886bp bases, and the specific base sequence is shown as SEQ ID NO. 1. The specific prokaryotic expression preparation of the BTV1 VP2 protein comprises the following steps: PCR amplification, restriction enzyme digestion, connection with plasmid pET28 to construct recombinant plasmid pET28-VP2U, transformation, induction expression and other steps. The method lays a certain technical foundation for preparing the BTV1 VP2 protein by fermentation by optimizing related encoding genes and further by means of the technical advantages of a prokaryotic expression system. Preliminary experiment results show that the expression level of the target protein in the supernatant of the fermentation liquor can reach 58.4 mu g/ml, and a good technical foundation can be laid for industrial production.

Description

Prokaryotic expression preparation method of BTV1 VP2 protein

Technical Field

The application belongs to the technical field of animal vaccine preparation, and particularly relates to a preparation method for preparing BTV1 (bluetongue 1 virus) VP2 protein by using a genetic engineering technology, which is a matter of matter for patent application.

Background

Bluetongue (BT) is a virulent infectious disease that is caused by bluetongue virus (BTV) and is mediated by insects such as culicoides and aedes, and seriously infects ruminants, and this virus mainly attacks ruminants, can cause symptoms such as high fever, depression, and ulcerative inflammation changes of mucous membranes of oral cavity, nasal cavity and gastrointestinal tract, and is defined as an infectious disease legally reported by the international animal health Organization (OIE), and is also classified as an animal epidemic disease by the ministry of agriculture in China. Based on the above causes of disease, it can be seen that: the occurrence and distribution of bluetongue disease are closely related to the distribution of vector insects, mainly occur in summer and autumn when culicoides are in heavy activities, are particularly frequently found in low-lying humid and watery areas, and mainly occur in tropical and subtropical areas. At present, the bluetongue brings serious threat to the global breeding industry and arouses high attention of people related to the world.

The research shows that BTV belongs to the subgroup of bluetongue virus of circovirus of reoviridae, 27 serotypes exist, and cross protection does not exist among the serotypes. To date, 7 serotypes (BTV 1, BTV2, BTV3, BTV4, BTV12, BTV15, BTV 16) have been discovered in our country. Among them, BTV1 and BTV16 are most popular in China. The BTV genome is about 19218bp, and the molecular weight is 1.3X 10⁷The RNA virus with the largest molecular weight has 10 segments of double-stranded RNA genome, wherein 4 small segments (S7-S10), 3 middle segments (M4-M6) and 3 large segments (L1-L3) are included, and the segment genome encodes 3 nonstructural proteins (NS 1-NS 3) and 7 structural proteins (VP 1-VP 7) respectively.

The complete BTV particles are in an icosahedral symmetric structure and have no capsule membranes. BTV has a double-layer protein capsid, VP2 and VP5 encoded by genes L2 and M5 are the major components constituting the outer shell of BTV, and the inner viral shell, i.e., the core capsid, is composed mainly of major structural proteins VP3 and VP7 and minor structural proteins VP1, VP4 and VP6 encoded by genes L3 and S7, and is involved in the replication of BTV virus. There were 60 triangle-like VP2 trimers raised in the BTV envelope, surrounded by 120 spherical trimers of VP5, a membrane-penetrating protein, the middle layer consisting of 260 VP7 trimers, and the inner layer comprising 120 VP3 monomers almost completely encapsulated by a layer of VP 7.

The VP2 protein of (A) is encoded by L2 gene, contains 956 amino acids, has the size of about 110 kDa, is the main type specific antigen and hemagglutinin protein of the virus, is related to the virulence, receptor binding, cell adsorption and livestock specific immunity of the virus, is related to the generation of neutralizing antibodies by VP2, and is a BTV serotype specific protein; BTV has hemagglutinin, can agglutinate sheep and human O type erythrocyte, and its hemagglutination activity is related to VP2, and hemagglutination inhibition test can be used for BTV typing. The VP5 protein can enhance the generation of neutralizing antibodies, thereby improving the efficacy of the vaccine; the VP3 and VP7 proteins are relatively conservative, have BTV antigenic determinants, and have an important effect on the stability of the BTV internal structure.

At present, vaccines for preventing and controlling bluetongue mainly comprise inactivated vaccines, attenuated vaccines, genetic engineering subunit vaccines and the like. Among them, attenuated vaccines stimulate the body to produce a strong protective immune response, but may also cause some side effects: for example, the medicine can cause teratogenesis and abortion in pregnancy, reduce the yield of lactating animals, generate viremia and the like, and also has the risk of virulence return. The genetic engineering subunit vaccine has the advantages of safety, low price, suitability for various serotypes and good application prospect, but the current genetic engineering subunit vaccine is still in the research stage. The VP2 protein is a main specific antigen and hemagglutinin protein of BTV and a main target for BTV subunit vaccine research, so that the BTV VP2 protein is urgently required to be prepared in large quantity in production and scientific research.

At present, the industrial production of recombinant foreign protein needs engineering bacteria capable of efficiently and stably expressing foreign gene products, and technologies and processes capable of culturing fermentation engineering bacteria on a large scale. However, the VP2 protein expression of the engineering bacteria in the existing research is not satisfactory, and a large amount of manpower, material resources and financial resources are consumed for purification and concentration, so that the industrial production and application are difficult to achieve. Therefore, the development of a VP2 protein fermentation process capable of greatly increasing the yield of engineering bacteria is urgently needed to shorten the production period, reduce the production cost, increase the production efficiency of BTV VP2 protein, and provide a research basis for the prevention and treatment of BTV and the development and production of novel subunit vaccines.

Disclosure of Invention

The application mainly aims to provide a soluble prokaryotic expression preparation method of soluble bluetongue type 1 virus (BTV 1) VP2 protein, thereby laying a certain technical foundation for preparation of related vaccines.

The technical solution adopted in the present application is detailed as follows.

The coding sequence VP2U of the gene of the VP2 protein of the bluetongue 1 virus consists of 2886bp bases, and the specific base sequence is shown as SEQ ID NO. 1.

The preparation method for prokaryotic expression of the BTV1 VP2 protein by utilizing the coding sequence of the VP2 protein gene of the bluetongue disease type 1 virus comprises the following steps:

(1) PCR amplification

The primer sequences for PCR amplification of the VP2U gene sequence are as follows:

VP 2U-F: 5'-CGGGATCCATGGACGAGCTGGGTAT-3', (5 ' GGATCC in the sequence is partial sequence of BamH I site)

VP 2U-R: 5'-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT-3', respectively; (the 5' -end of the sequence "CTCGAG" is a Xho I cleavage site)

Carrying out PCR amplification by using a recombinant plasmid pUC-VP2U containing a gene coding sequence VP2U of the bluetongue type 1 virus VP2 protein as a template, wherein a 50 mul reaction system is designed as follows during PCR amplification:

PrimeSTAR HS (Premix) enzyme, 25. mu.l;

upstream primer F, 1. mu.l;

1 μ l of downstream primer R;

template plasmid pUC-VP2U, 1. mu.l;

sterilizing deionized water, 22 μ l;

the PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 2min for 30 cycles; extending for 10min at 72 ℃;

recovering and purifying PCR amplification products for later use;

(2) cut and connected with plasmid pET28

Carrying out BamH I and Xho I double enzyme digestion on the PCR amplification product recovered in the step (1), simultaneously carrying out BamH I and Xho I double enzyme digestion on a plasmid pET28, and recovering a target fragment;

connecting the recovered target fragments by using T4 DNA ligase, and connecting at 16 ℃ overnight;

(3) transforming and screening to obtain recombinant plasmid pET28-VP2U with correct recombination

Transforming the connecting product in the step (2) into E.coli competent cell DH5 alpha, performing resistance screening, and further performing double enzyme digestion identification and sequencing identification to confirm that a recombinant plasmid pET28-VP2U with correct recombination is obtained;

(4) transformation and induced expression

Transforming the recombinant plasmid pET28-VP2U constructed in the step (3) into competent cells of escherichia coli BL21 (DE 3) to obtain an escherichia coli expression strain pET28-VP2U-BL21 for expressing BTV1 VP2 protein;

further inoculating the strain in a culture medium, and inducing and expressing BTV1 VP2 protein by IPTG;

after induction expression is finished, the thalli are further centrifuged and crushed, after heavy suspension, the thalli are centrifuged and the supernatant is collected, namely the supernatant containing BTV1 VP2 protein, and the supernatant can be used as antigen in vaccine preparation after further purification.

In the step (4), the culture medium is LB liquid culture medium containing 50 mug/mL Kana + or basic fermentation culture medium containing 50 mug/mL kanamycin;

the basic fermentation medium comprises the following components: 12g/L peptone, 24g/L yeast extract, 16.43g/L K₂HPO₄•3H₂O，2.31g/L KH₂PO₄5.04g/L of glycerol.

In the step (4), when IPTG is used for induction expression, the final concentration of IPTG is 0.1-1.0 mM, the induction expression temperature is 20-37 ℃, and the induction expression time is 6-12 h.

In the step (4), during the purification operation, the supernatant is filtered by a 0.22 μm filter membrane and then purified by a nickel affinity chromatography.

In the prior art, when the protein BTV1 VP2 is obtained by using genetic engineering, although many eukaryotic expression systems are researched and applied, in view of the advantages of lower production cost, easy fermentation and preparation and the like of a prokaryotic expression system, the construction of the prokaryotic expression system of the protein still needs to be deeply researched.

In general, compared with the prior art, the main technical advantages of the present application are as follows:

(1) according to the invention, BTV1 VP2 encoding genes are optimized, so that the BTV1 VP2 encoding genes are more suitable for high-efficiency expression of target proteins in an escherichia coli host; through experimental analysis on fusion expression conditions of BTV1 VP2 genes in escherichia coli before and after optimization, the BTV1 VP2 original gene almost has no target protein expression in a pET28a vector, the solubility of the optimized BTV1 VP2 gene in the pET28a vector is obviously increased, and the soluble target protein still keeps high activity;

(2) the invention carries out systematic optimization on the expression conditions of BTV1 VP2 protein, especially carries out preliminary optimization on the thallus fermentation density and the fermentation conditions in the large-scale fermentation process, and lays a preliminary technical foundation for improving the specific productivity of the product (the yield of the product in unit volume and unit time).

In general, the application lays a certain technical foundation for preparing BTV1 VP2 protein by fermentation by optimizing related encoding genes and further by means of the technical advantages of a prokaryotic expression system. Preliminary experiment results show that the expression quantity of the target protein in the supernatant of the fermentation liquor can reach 58.4 mu g/ml, and the value is obviously higher than the yield of the target protein BTV1 VP2 in other prokaryotic expression systems, so that a good technical basis can be laid for industrial production.

Drawings

FIG. 1 shows the amplification of the target gene VP 2; wherein M is a DL15000 molecular weight marker; 1 is the VP2 gene before optimization (left panel); 2 is optimized VP2 gene (right panel);

FIG. 2 is a diagram showing the double restriction enzyme identification of recombinant plasmids, wherein M is a DL2000 molecular weight marker; 1 is pET28a-VP2U plasmid; 2 is pET28a-VP2U plasmid double-restriction enzyme product; 3 is pET28a-VP2 plasmid; 4 is pET28a-VP2 plasmid double enzyme digestion product;

FIG. 3 is an SDS-PAGE identification chart of recombinant VP2 protein in E.coli induced expression optimization, wherein M is a standard protein Marker; a is IPTG concentration optimization: 1-6 are final concentrations: IPTG induction expression results of 0.1 mM, 0.2mM, 0.4 mM, 0.6 mM, 0.8 mM and 1.0 mM; b, optimizing the induction temperature: 1-2 are respectively 20 ℃ induced expression ultrasonic supernatant and sediment; 3-4 respectively performing induced expression on ultrasonic supernatant and precipitation at 25 ℃; 5-6 are respectively 30 ℃ induction expression ultrasonic supernatant and precipitation; c, induced expression time optimization: 1-4 are target protein expression conditions after induced expression for 6h, 8h, 10h and 12h respectively;

FIG. 4 is an SDS-PAGE identification of recombinant VP2 protein expressed in E.coli, wherein M is standard protein Marker; 1 is a recombined VP2 protein ultrasonic supernatant expressed by VP2U gene; 2 is the VP2 protein ultrasonic sediment expressed by VP2U gene; 3 is the ultrasonic supernatant of the recombinant VP2 protein expressed by the original VP2 gene; 4, carrying out ultrasonic precipitation on the recombinant VP2 protein expressed by the original VP2 gene;

FIG. 5 is an SDS-PAGE and Western-Blot identification chart of the purified recombinant VP2 protein (the left is SDS-PAGE; the right is Western-Blot), and M is a standard protein Marker; 1 is a negative control of uninduced bacteria; 2 is purified VP2 protein;

FIG. 6 shows the SDS-PAGE identification result of BTV1 inactivated virus, wherein M is a standard protein Marker; 1 is BTV1 inactivated virus after concentration.

FIG. 7 shows the DOT-ELISA identification results, wherein 1 is BTV1 inactivated virus; 2 is purified VP2 protein; negative control of uninduced bacteria.

Detailed Description

The present application is further illustrated by the following examples. Before describing the specific embodiments, a brief description will be given of some experimental background cases in the following embodiments.

Biological material:

pET-28a plasmid, a product of Novagen (Merck, Germany);

the BTV1 inactivated virus used for identification is benefited by animal husbandry and veterinary science research institute in Yunnan province;

the main experimental reagents are as follows:

(ii) high fidelity hot start PrimeSTAR HS (Premix) enzymes in PCR amplification, products of TaKaLa company;

restriction enzymes BamHI, Xho I, NEB (New England Biolabs, Inc.);

other cases are as follows:

the instruments and equipment involved in the following examples are conventional instruments and equipment unless otherwise specified;

the reagents are all conventional reagents which are sold on the market if not specifically indicated;

the test methods involved, unless otherwise specified, are conventional methods, see molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) may be used.

Example 1

It should be noted that, when the existing gene sequence of BTV1 VP2 is prokaryotic expressed, it is limited by the difference between the genome sequence of Escherichia coli and the virus gene sequence, which results in the VP2 protein actually expressed mostly existing in the form of inclusion body, thus resulting in lower expression efficiency, and in order to overcome this defect, the inventor has performed detailed bioinformatics analysis on the existing gene sequence of BTV1 VP2 (GenBank: JX 101695.1), and has adopted the codon with the highest use frequency for all the amino acids, and simultaneously, by optimizing the secondary structure of the mRNA, combined with the correction of the optimal codon frequency and the avoidance of enzyme cutting site in the subsequent expression process, a brand-new DNA sequence of BTV1 VP2 is designed and obtained, the sequence has a full length of 2886bp, as shown in SEQ ID No. 1.

The designed gene sequence is further synthesized by the company of biological engineering (Shanghai) and transformed into pUC57 plasmid for subsequent experimental application, and the recombinant plasmid is named as: pUC-VP 2U.

The optimized BTV1 VP2 gene sequence (VP 2U) has the following specific base sequences:

ATGGACGAGCTGGGTATCCCAATCTACAAGCAAGGATTCCCTGAGCACCTGCTGCACGGCTACGAGTTCACTATTGACAGCTCTACCAAGATCCAGTCAGTTGGCGGTCGTCACGACGTGACTAAGCTGCCCGAAATGAACGCCTACGACATCAAGGCTGAATCCATCCGCACCGCCCTGTGGTACAACCCTGTTCGTAACGACGGTTTCGTCCTGCCTCGTGTCCTCGACATCACCCTGCGCGGATACGACGGAAAGCGTGCCGTGATCGACTCCAGCAAGCACAAGATCTTCCACACTGACGAGAGGTGGGTCCAGTGGATGATGAAGGACTCAATGGACGCTCAACCCCTCAAGGTCGGCCTGGACGACCGCACACAAAAGATCGCTCACTCATTGCACAATTGTGTTGTGAAGATCGACTCTAAGAAGGCTGACACCATGTCTTACCACGTGGAACCTATCGAAGACCCCAGTAAGGGCTGTCTCCACACCCGTGCCATGCTGTGGAACCACCTGGTTCGCATCGAAATGTCCCACGCCGCCCAAGAAATCGCTTACACACTGAAGCCTACCTACGACATCGTCGTCCACGCTGAACGCCGTGACAGGTCACAACCCTTCCAGCCTGGAGACCAGACCCTGATCAACTTCGGTCGCGGTCAGAAGGTTCAGATGAACCACAACAGCTACGAGAAGATGGTTGAAGGCCTGGCTCACCTCGTGATCCGCGGAAAGACTCCTGAGCTGATCCGTGACGAAATCGCTAAGCTCGACGAGATCTGCAATCGCTGGATCAGGTCCCGTCACGACCCTGGTGAAATCAAGGCCTACGAACTCTGCAAAATCCTCTCCACAGTTGGACGTAAGATGCTCGACCAGGAAAAGGAACCAGCTGACGAAGCCTCTTTGAGCATCCGTTTCCAAGAAGCTATCGACAACAAGTTCCGCCAGCATGACCCTGAACGCCTGAAAATCTTTGAGCACCGTAACCAGCGCCGTGATGAGGACAGGTTCTACATCCTCCTGATGATCGCTGCCTCTGACACATTCAACACTCGCGTCTGGTGGTCCAACCCATACCCCTGTCTGCGTGGAACCCTGATGGCTTCTGAAACCAAGCTGGGTGACGTGTATTCTATGATGCGCAGCTGGTACGACTGGTCTGTTCGTCCTACATACACTCCCCACGAAAAGAGCAGAGAGCAGGAAAAGTACATCTACGGACGCGTGAACCTGTTCGACTACGTCGCCGAACCAGGCACAAAGATCATCCATTGGGAATACAAGTTGAACCAGCAAACAAAAGACATCACATACGAGCAGGGTAACCCATGCGACCTGTTCCCCGACGACGACGAAGCCATCATCACTAAGTTCGATGACGTCGCTTACGGACAGATGGTTTCCGACCTGATCAACGGCGGATGGGATCAGGAGAGGTTCAAGATGCACAAGATCCTCAAGAGCCAGGGCAACGTGCTGACCATCGATTTCGAAAAGGACGCTAAGCTGACAAGTAACGAAGGCGTTACAATGCCAGAATACTTCGACAAGTGGATCATCGCCCCAATGTTCAACGCTAAGTTGCGCATCAAGCACAGCGAGATCGCCCAAAGAAGAGACGACGATCCTATGGTTAAGAGAACACTCAGCCCTATCGCTTTCGACCCTATCGTCCTCCAACGTCTCACTCTCGCTCGTTACTACGACATCAGGCCCGCTATCATGGGTCAGGCCCTGTCACGTCAACAAGGCCAGTCTACTTACGATGAGGAGGTCTCCAAGATCGAAGGATACGCTGAGATCCTCCAGCGTCGTGGAATCGTGCAAATCCCTAAGAAGCCATGCCCCACTGTCACCGCTCAGTACACACTGGAACGCTACGCCCTCTTCCTGATCAACATCTTGGAGCAGCACGTGATCCGCTCCACCGATGAGGATGTCATCTACAGCCACCCTCGTGTGGACCACAAGCTGGAAATCTACGGTGAATCCATCGTTGACATCTCCCAGATCGTGATCTTCGTGTTCGACTTTTTGTTCGAGCGTAGGCGCACCGTCCGCGGCGTGTACGAGTCCCGTTACATGGTGACCCGTATCCGCGACGCCCAGGGCCAGAACAGGATCAACGTCATCACTGAGTTCTTCCCAACTTTCGGCTACTACCTGAACCGTATCAAGGAGGCCACCATCATGCAGGAAATCATGTACCTGAATTTCCTGCCCTTGTTCTTCCTGGTTAGCGACAACATCATGTACACCCATAAGCAATGGTCAGTCCCACTGCTGCTGTACGCTCACGAACTGAAGGTCATCCCTCTGGAGGTGGGTTCATACAATGACCGCTGTGGCCTGATTTCATACGTTGAGTACATGGTGTTCTTCCCCTCTAAGGCTTTCAGGACAAGCAAGTTGGACGAAGTGCAGCCTAAGATCGCTAGGGAGATGCTCAAATACTACACCAACACAAAGATCTTCGAAGGTGGTATCAACCTGAACGTGATCACCACTAAGCAGCTCCTGTACGAGACATACCTGGCTTCCCTGTGCGGTGGACTCTCTGATGGAATCGTGTGGTACCTCCCTATTACACACCCATCTAAGTGTCTGGTCGCCGTTGAGGTCTCCGATGAGAGGGTGCCAGCTTCCATCCGCGCCAGTCGCATCAAGCTGCGCTTCCCTCTGAGCGTTAAGCACCTGAAGGGTATCGTTGTGATCCAAATCGACGAAGAAGGCAAGTTCACAGTTTACTCCGAGGGAATCGTTAGCCACCGTATCTGTAAGAAGAACCTGCTGAAGTACATGTGTGACATCGTCCTGCTCAAGTTCTCCGGCCACGTGTTCGGAAACGACGAGATGCTGACTAAGCTCCTCAACGTTTAA。

example 2

Based on example 1, the inventors further used plasmid pET28 as a vector, and transformed the optimized VP2U into plasmid pET28 to construct recombinant plasmid expression vector pET28-VP2U, thereby facilitating subsequent prokaryotic expression, and the construction process of the specific recombinant plasmid expression vector pET28-VP2U is briefly described as follows.

In order to prove the expression effect of the optimized gene sequence, the inventor also synthesized and prepared recombinant plasmids by the same corporation of Tokyo Biotechnology engineering (Shanghai) GmbH, using the existing BTV1 VP2 gene (GenBank: JX 101695.1) as a control, and named as: pUC-VP 2. On the basis of this, the inventors also prepared a recombinant plasmid expression vector pET28-VP2 as a control.

(I) PCR amplification

When the VP2U gene sequence after optimization of PCR amplification (primers are synthesized by Biotechnology, Shanghai, Inc.) is provided, the primer sequence is designed as follows:

VP 2U-R: 5'-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT-3', respectively; (the 5' end of the sequence "CTCGAG" is Xho I cleavage site)

When the VP2 gene sequence is amplified by PCR (primers are synthesized and provided by Biotechnology engineering (Shanghai) Co., Ltd.), the primer sequence is designed as follows:

VP 2-F: 5'-CGGGATCCATGGATGAGTTAGGCATA-3' (5 ' GGATCC part of the sequence is BamH I site)

VP 2-R: 5'-CCGCTCGAGTCATACGTTGAGAAGTTTTGTTA-3' (the 5 ' end of the sequence "CTCGAG" is Xho I site)

PCR amplification was carried out using pUC-VP2U plasmid or pUC-VP2 as a template, and a 50. mu.l reaction system was designed as follows:

PrimeSTAR HS (Premix) enzyme, 25. mu.l;

upstream primer F, 1. mu.l;

downstream primer R, 1. mu.l;

1. mu.l of the template plasmid pUC-VP2U or pUC-VP2 plasmid;

sterilizing deionized water, 22 μ l;

the PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 2min for 30 cycles; extension at 72 ℃ for 10 min.

The PCR amplification product was detected by agarose gel electrophoresis at 1% mass fraction, and the results are shown in FIG. 1. Analysis shows that the sizes of PCR amplification products of the genes before and after optimization are about 2893 bp, which is consistent with the expectation, and proves that the BTV1 VP2 genes before and after full-length codon optimization are successfully obtained.

Further recovering and purifying PCR amplification products for later use.

(II) cleavage, and ligation with plasmid pET28

Carrying out BamH I and Xho I double enzyme digestion on the PCR amplification product (original BTV1 VP2 gene or optimized BTV1 VP2U gene) recovered in the step (I), simultaneously carrying out BamH I and Xho I double enzyme digestion on plasmid pET28, and respectively recovering target fragments by using a DNA recovery kit;

the recovered target fragments were ligated by using T4 DNA ligase, and ligated overnight at 16 ℃.

(III) transforming and screening to obtain recombinant plasmid I (pET 28-VP 2U) and recombinant plasmid II (pET 28-VP 2) with correct recombination

And (5) transforming the ligation product in the step (II) into E.coli competent cells DH5 alpha, performing resistance screening, further selecting a single clone for culture, and extracting positive colony plasmids for double enzyme digestion identification.

The results of the identification are shown in FIG. 2. Analysis shows that the size of the fragment after double enzyme digestion is consistent with that of the target genes of VP2 and VP2U, which indicates that the recombinant vector is successfully constructed.

Further, the plasmid with positive double enzyme digestion is sent to the biological engineering company Limited for sequencing identification, so as to ensure that a correctly constructed recombinant plasmid I (pET 28-VP 2U) and a recombinant plasmid II (pET 28-VP 2) are obtained.

And after the escherichia coli containing the correctly constructed recombinant plasmid I (pET 28-VP 2U) and the recombinant plasmid II (pET 28-VP 2) are further cultured and amplified, the correctly constructed recombinant plasmid I (pET 28-VP 2U) and the correctly constructed recombinant plasmid II (pET 28-VP 2) are respectively extracted for further transformation and expression of the VP2 protein.

Example 3

On the basis of example 2, the inventors transformed the constructed recombinant plasmid I (pET 28-VP 2U) and recombinant plasmid II (pET 28-VP 2) into competent cells of Escherichia coli BL21 (DE 3), respectively, to obtain Escherichia coli expression strains pET28-VP2U-BL21 and pET28-VP2-BL21 expressing BTV1 VP2 protein, respectively, and then performed preliminary expression verification, and the specific experimental procedures are briefly described below.

(I) Strain culture and inducible expression

Escherichia coli expression strains pET28-VP2U-BL21 and pET28-VP2-BL21 were inoculated into LB liquid medium containing 50. mu.g/mL Kana +, respectively, and cultured to OD₆₀₀At a value of about 0.8, IPTG was added to a final concentration of 0.3mM, followed by induction of expression at 25 ℃ for 10 h.

(II) protein purification and characterization

Taking 5 mL of bacteria liquid after induction expression, centrifuging for 10min at 12000r/min, discarding supernatant, and collecting thalli;

after the thalli is re-suspended by 1mL of PBS, carrying out ultrasonic disruption (the ultrasonic disruption time is 10min, the ultrasonic disruption time is 3s, the intermittent treatment time is 3s, and the power is 45 w);

the supernatant and the precipitate were separated by centrifugation at 12000r/min for 15min and identified by SDS-PAGE, respectively.

The results of the identification are shown in FIG. 3. As can be seen from the figure, BTV1 VP2 recombinant protein is expressed at about 120kDa in pET28-VP2U-BL21 expression strain after codon optimization, and the soluble expression amount is high, while BTV1 VP2 recombinant protein is not expressed in pET28-VP2-BL21 expression strain without optimization; the codon optimization obviously improves the high soluble expression quantity of the recombinant protein.

(III) optimization of induced expression conditions

On the basis of the experiment, induced expression conditions such as the concentration of an inducer IPTG, induced expression time, induced temperature and the like in the step (I) are further optimized. The specific experimental procedures and results are briefly described as follows.

(1) And (3) IPTG concentration optimization: the overnight activated strain 1:100 was inoculated into LB liquid medium containing 50. mu.g/mL Kana + and cultured to OD₆₀₀At a value of about 0.8, the final concentrations were added separately: 0.1 mM, 0.2mM, 0.4 mM, 0.6 mM, 0.8 mM and 1.0mM IPTG, thalli are collected after induced expression for 8 hours at the temperature of 30 ℃, and the expression condition of the target protein is identified by SDS-PAGE; as a result, the IPTG concentration has little influence on the expression amount of the target protein (FIG. 3A), but from the practical operation point of view, the dosage of 0.2mM is easier to control, so that 0.2mM is used as the application concentration in the subsequent steps;

(2) optimizing inducible expression temperature: the overnight-activated strain 1:100 was inoculated into LB liquid medium containing 50. mu.g/mL Kana + and cultured to OD₆₀₀When the value is about 0.8, adding IPTG with the final concentration of 0.2mM, respectively carrying out induction expression at 20 ℃, 25 ℃ and 37 ℃ for 10h, collecting thalli, carrying out ultrasonic disruption, and identifying the expression condition of the target protein by SDS-PAGE; as a result, the highest soluble expression level of the target protein was found at 20 ℃ (FIG. 3B);

(3) optimizing the induction expression time: the overnight activated strain 1:100 was inoculated into LB liquid medium containing 50. mu.g/mL Kana + and cultured to OD₆₀₀When the value is about 0.8, adding IPTG with the final concentration of 0.2mM, inducing and expressing for 6h, 8h, 10h and 12h at the temperature of 20 ℃, and collecting the bacteriaIn vivo, SDS-PAGE identifies the expression of the target protein; as a result, the highest soluble expression level of the target protein was found when 10 hours of inducible expression was observed (FIG. 3C).

The experimental results show that the better expression and operation conditions of the recombinant protein are as follows: the expression level of the target protein was the highest when the IPTG concentration was 0.2mM, the induction temperature was 20 ℃ and the induction time was 10 hours (FIG. 4).

Example 4

On the basis of example 4, the inventors further carried out small-scale fermentation culture experiments by using the constructed Escherichia coli expression strain pET28-VP2U-BL21 to examine the practical application conditions, and the specific experimental procedures are briefly described as follows.

(I) Strain activation

The genetic engineering bacteria E.coli pET28-VP2U-BL21 strain preserved in a glycerin tube at the temperature of-80 ℃ is streaked on the surface of LB solid culture medium containing 50 mu g/mL kanamycin, and then a plate is inversely cultured in an incubator at the constant temperature of 37 ℃ for overnight;

the next day, the activated strain was inoculated into 50mL of a seed medium (Kana +/LB liquid medium, in which kanamycin concentration was 50. mu.g/mL) and cultured with shaking at 37 ℃ for 14 hours to obtain a seed solution.

It should be noted that, in this example, the escherichia coli expression strain pET28-VP2U-BL21 is stored in a glycerol tube at-80 ℃ for convenience of storage after successful transformation, and in practical applications, after successful transformation, it can be directly inoculated into a seed culture medium for fermentation to prepare a seed solution without being inoculated into an LB solid culture medium for activation.

(II) fermentation culture

Sterilizing 5L of basic fermentation medium at 121 ℃ for 20min in a fermentation tank, cooling to 35 ℃, adjusting pH =6.8, inoculating 50mL (inoculation ratio, 1: 100) of the seed solution prepared in the step one, and adding sterilized kanamycin into the basic fermentation medium to a concentration of 50 mug/mL before inoculation;

the maximum ventilation amount is 50%, and the ventilation amount range is 100-150 VVM; the maximum stirring speed is 50%, the stirring speed is 150-300 r/min, and the culture is carried out for about 3 hours at 37 ℃.

(III) Induction of protein expression

OD of the fermentation broth in step (2)₆₀₀When the temperature is about 7.0-8.0 (namely when the culture is carried out for about 3 hours at 37 ℃), cooling the temperature of the fermentation liquor to 20 ℃, adding an inducer IPTG with the final concentration of 0.2mmol/L, and continuing to ferment for 24 hours to carry out the induced expression of the target protein;

in the fermentation process, the dissolved oxygen is controlled to be 20-30% through aeration and stirring operations.

(IV) protein extraction and purification

After fermentation is finished, centrifuging at 8000r/min for 20min to collect thalli, then resuspending with PBS to induce the thalli after expression, then crushing under high pressure or ultrasonically crushing, further centrifuging at 12000r/min for 15min, taking supernatant of the bacterial liquid, filtering with a 0.22 mu m filter membrane, and purifying by using a nickel affinity chromatography.

When the specific nickel affinity chromatography is used for purification, the following steps can be referred to for operation: firstly, balancing with an equilibrium solution (50mM Tris-HCl, 300mM NaCl, 10mM imidazole); eluting the hybrid protein with a washing solution (50mM Tris-HCl, 300mM NaCl, 40mM imidazole); finally, the target protein was eluted with an eluent (50mM Tris-HCl, 300mM NaCl, 250mM imidazole).

It should be noted that, taking a certain preferred experiment as an example, the determination result after the fermentation is finished shows that the dry weight of the thallus in the fermentation liquid can reach 126.5g/L, and the dry weight of the thallus after centrifugation reaches 12.65%, which shows that the fermentation regulation and fermentation effects are preferred, and a better fermentation foundation can be laid for the actual protein preparation.

The purified protein was identified, and the results are shown in FIG. 5. It can be seen that: the SDS-PAGE and Western Blot results show that the recombinant protein has better purification effect, and analysis shows that the purity of VP2 is about 80%.

(V) determination of expression level of BTV1 VP2 recombinant protein

On the basis of the purified protein obtained in the step (3), the BCA protein concentration determination kit is utilized, an ELISA sandwich method is adopted, and the expression quantity of the BTV1 VP2 recombinant protein in the fermentation liquor is further determined by the inventor, and the specific determination process is briefly described as follows.

Firstly, diluting the purified target protein stock solution with measured concentration into a series of concentrations, which are specifically as follows: 2 mug/mL, 1 mug/mL, 0.5 mug/mL, 0.25 mug/mL and 0.125 mug/mL serving as standard concentrations are detected by ELISA, the concentrations are used as vertical coordinates, and corresponding OD (optical density) values are obtained₄₅₀And (5) making the detection value as a horizontal coordinate, and establishing a standard linear regression equation.

Secondly, diluting the supernatant of the fermented bacteria-breaking liquid into a series of multiples, specifically: 50. 100, 200 and 400 times.

Finally, the OD measured from the fermented supernatant of the disrupted solution is measured₄₅₀And obtaining the corresponding concentration (unit is microgram/mL) through a standard linear regression equation, and multiplying the corresponding concentration by the dilution factor to obtain the protein concentration (unit is microgram/mL) of the fermented bacteria solution supernatant.

Since the bacteria breaking solution is prepared by the wet weight of the bacteria and the bacteria breaking buffer solution being 1:10, the expression amount of the target protein of the fermented bacteria (unit is mug/g bacteria) is as follows: and (4) 10 times of fermenting the protein concentration (unit is microgram/mL) of the supernatant of the bacteria breaking liquid, and multiplying the fermentation liquid bacterial density (unit is gram bacterial/L fermentation liquid) to obtain the protein expression amount concentration (unit is microgram/L fermentation liquid) of the fermentation target. The specific formula is as follows:

diluting multiple times of standard target protein concentration (mug/mL) multiplied by OD (origin-destination) of the supernatant of the fermented bacteria-breaking liquid₄₅₀(supernatant of fermentation broth)/OD₄₅₀(standard protein of interest concentration);

fermenting the expression amount concentration of the target protein (mu g/L fermentation liquid) to 10 times the protein concentration of the supernatant of the fermentation broken bacteria liquid (mu g/mL) times the bacterial density of the fermentation liquid (g bacterial body/L fermentation liquid).

The results of the fermentation expression of BTV1 VP2 in different batches of fermentation liquor are measured, and the results are shown in the following table:

。

as can be seen from the results in the table above, the BTV1 VP2 protein gene expression sequence is optimized, so that the BTV1 VP2 protein can be expressed in escherichia coli, the soluble expression level is high, and the requirement of industrial production can be met.

(six) BTV1 VP2 recombinant protein activity identification

To determine the availability of the BTV1 VP2 protein prepared in the present application, the inventors further examined and identified its activity, and the specific experimental procedures are briefly described as follows.

(1) Preparation of inactivated virus BTV1 hyperimmune serum

After the BTV1 inactivated virus is concentrated (the SDS-PAGE identification result of the concentrated virus is shown in figure 6), Freund's complete adjuvant is added for emulsification to prepare immunogen, 3 female BALB/c mice with the age of 4-8 weeks are immunized by a back subcutaneous multipoint injection method, and the immunization dose is 50 mul/mouse;

the BALB/c mice are boosted by the same method and dosage after emulsified by Freund's incomplete adjuvant and immunizing antigen every 3 weeks for 3 times, and finally, hyperimmune serum is obtained.

(2) Determination of BTV1 VP2 protein Activity

Performing activity determination by using a DOT ELISA method, which comprises the following specific steps:

completely soaking the strip NC membrane in Phosphate Buffer Solution (PBS), and airing at room temperature;

mu.l of purified BTV1 VP2 protein was spotted onto NC membranes, and 1. mu.l of inactivated BTV1 virus and 1. mu.l of uninduced protein were used as positive and negative controls, respectively, at a rate of 1: 500 dilutions of positive serum were used as primary antibody, 1: 5000 dilution of HRP-labeled goat anti-mouse was used as a secondary antibody, and AEC was used for color development.

The experimental results (the results are shown in fig. 7) show that the BTV1 VP2 protein obtained by a prokaryotic expression system can perform specific reaction with the serum of a mouse immunized by BTV1 virus, which indicates that the BTV1 VP2 protein has good reactogenicity and can be used for further vaccine preparation and application.

SEQUENCE LISTING

<110> Zhengzhou university

Biological engineering Co., Ltd, Zhongze, Henan

<120> prokaryotic expression preparation method of BTV1 VP2 protein

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 2886

<212> DNA

<213> bluetongue virus

<400> 1

atggacgagc tgggtatccc aatctacaag caaggattcc ctgagcacct gctgcacggc 60

tacgagttca ctattgacag ctctaccaag atccagtcag ttggcggtcg tcacgacgtg 120

actaagctgc ccgaaatgaa cgcctacgac atcaaggctg aatccatccg caccgccctg 180

tggtacaacc ctgttcgtaa cgacggtttc gtcctgcctc gtgtcctcga catcaccctg 240

cgcggatacg acggaaagcg tgccgtgatc gactccagca agcacaagat cttccacact 300

gacgagaggt gggtccagtg gatgatgaag gactcaatgg acgctcaacc cctcaaggtc 360

ggcctggacg accgcacaca aaagatcgct cactcattgc acaattgtgt tgtgaagatc 420

gactctaaga aggctgacac catgtcttac cacgtggaac ctatcgaaga ccccagtaag 480

ggctgtctcc acacccgtgc catgctgtgg aaccacctgg ttcgcatcga aatgtcccac 540

gccgcccaag aaatcgctta cacactgaag cctacctacg acatcgtcgt ccacgctgaa 600

cgccgtgaca ggtcacaacc cttccagcct ggagaccaga ccctgatcaa cttcggtcgc 660

ggtcagaagg ttcagatgaa ccacaacagc tacgagaaga tggttgaagg cctggctcac 720

ctcgtgatcc gcggaaagac tcctgagctg atccgtgacg aaatcgctaa gctcgacgag 780

atctgcaatc gctggatcag gtcccgtcac gaccctggtg aaatcaaggc ctacgaactc 840

tgcaaaatcc tctccacagt tggacgtaag atgctcgacc aggaaaagga accagctgac 900

gaagcctctt tgagcatccg tttccaagaa gctatcgaca acaagttccg ccagcatgac 960

cctgaacgcc tgaaaatctt tgagcaccgt aaccagcgcc gtgatgagga caggttctac 1020

atcctcctga tgatcgctgc ctctgacaca ttcaacactc gcgtctggtg gtccaaccca 1080

tacccctgtc tgcgtggaac cctgatggct tctgaaacca agctgggtga cgtgtattct 1140

atgatgcgca gctggtacga ctggtctgtt cgtcctacat acactcccca cgaaaagagc 1200

agagagcagg aaaagtacat ctacggacgc gtgaacctgt tcgactacgt cgccgaacca 1260

ggcacaaaga tcatccattg ggaatacaag ttgaaccagc aaacaaaaga catcacatac 1320

gagcagggta acccatgcga cctgttcccc gacgacgacg aagccatcat cactaagttc 1380

gatgacgtcg cttacggaca gatggtttcc gacctgatca acggcggatg ggatcaggag 1440

aggttcaaga tgcacaagat cctcaagagc cagggcaacg tgctgaccat cgatttcgaa 1500

aaggacgcta agctgacaag taacgaaggc gttacaatgc cagaatactt cgacaagtgg 1560

atcatcgccc caatgttcaa cgctaagttg cgcatcaagc acagcgagat cgcccaaaga 1620

agagacgacg atcctatggt taagagaaca ctcagcccta tcgctttcga ccctatcgtc 1680

ctccaacgtc tcactctcgc tcgttactac gacatcaggc ccgctatcat gggtcaggcc 1740

ctgtcacgtc aacaaggcca gtctacttac gatgaggagg tctccaagat cgaaggatac 1800

gctgagatcc tccagcgtcg tggaatcgtg caaatcccta agaagccatg ccccactgtc 1860

accgctcagt acacactgga acgctacgcc ctcttcctga tcaacatctt ggagcagcac 1920

gtgatccgct ccaccgatga ggatgtcatc tacagccacc ctcgtgtgga ccacaagctg 1980

gaaatctacg gtgaatccat cgttgacatc tcccagatcg tgatcttcgt gttcgacttt 2040

ttgttcgagc gtaggcgcac cgtccgcggc gtgtacgagt cccgttacat ggtgacccgt 2100

atccgcgacg cccagggcca gaacaggatc aacgtcatca ctgagttctt cccaactttc 2160

ggctactacc tgaaccgtat caaggaggcc accatcatgc aggaaatcat gtacctgaat 2220

ttcctgccct tgttcttcct ggttagcgac aacatcatgt acacccataa gcaatggtca 2280

gtcccactgc tgctgtacgc tcacgaactg aaggtcatcc ctctggaggt gggttcatac 2340

aatgaccgct gtggcctgat ttcatacgtt gagtacatgg tgttcttccc ctctaaggct 2400

ttcaggacaa gcaagttgga cgaagtgcag cctaagatcg ctagggagat gctcaaatac 2460

tacaccaaca caaagatctt cgaaggtggt atcaacctga acgtgatcac cactaagcag 2520

ctcctgtacg agacatacct ggcttccctg tgcggtggac tctctgatgg aatcgtgtgg 2580

tacctcccta ttacacaccc atctaagtgt ctggtcgccg ttgaggtctc cgatgagagg 2640

gtgccagctt ccatccgcgc cagtcgcatc aagctgcgct tccctctgag cgttaagcac 2700

ctgaagggta tcgttgtgat ccaaatcgac gaagaaggca agttcacagt ttactccgag 2760

ggaatcgtta gccaccgtat ctgtaagaag aacctgctga agtacatgtg tgacatcgtc 2820

ctgctcaagt tctccggcca cgtgttcgga aacgacgaga tgctgactaa gctcctcaac 2880

gtttaa 2886

Claims

1. The bluetongue disease type 1 virus VP2 protein gene VP2U is characterized in that the gene VP2U consists of 2886bp bases, and the specific base sequence is shown as SEQ ID NO. 1.

2. The method for preparing the BTV1 VP2 protein by prokaryotic expression by using the gene VP2U in claim 1, which is characterized by comprising the following steps:

(1) PCR amplification

The primer sequences for designing the sequence of the PCR amplified gene VP2U are as follows:

VP2U-F：5’- CGGGATCCATGGACGAGCTGGGTAT -3’，

VP2U-R：5’-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT -3’；

carrying out PCR amplification by taking a recombinant plasmid pUC-VP2U containing the protein gene VP2U of the bluetongue 1 virus VP2 as a template; recovering and purifying PCR amplification products for later use;

(2) cut and connected with a plasmid pET28

connecting the recovered target fragments by using T4 DNA ligase;

(4) transformation and inducible expression

Transforming the recombinant plasmid pET28-VP2U constructed in the step (3) into escherichia coli BL21 competent cells to obtain an escherichia coli expression strain pET28-VP2U-BL21 for expressing BTV1 VP2 protein;

and after the induction expression is finished, further centrifuging and crushing the thalli, and centrifuging and collecting supernatant after heavy suspension, namely the supernatant containing BTV1 VP2 protein.

3. The method for prokaryotic expression and preparation of the BTV1 VP2 protein according to claim 2, wherein in the step (1), a 50 μ l reaction system is designed as follows during PCR amplification:

PrimeSTAR HS Premix enzyme, 25 mul;

upstream primer F, 1. mu.l;

downstream primer R, 1. mu.l;

template plasmid pUC-VP2U, 1. mu.l;

sterilizing deionized water, 22 μ l;

4. The method for preparing the BTV1 VP2 protein through prokaryotic expression according to claim 2, wherein in the step (4), when IPTG is subjected to induced expression, the final concentration of IPTG is 0.1-1.0 mM, the induced expression temperature is 20-37 ℃, and the induced expression time is 6-12 h.

5. The method for preparing the BTV1 VP2 protein through prokaryotic expression according to claim 4, wherein in the step (4), when IPTG is used for induction expression, the final concentration of IPTG is 0.2mM, the induction expression temperature is 20 ℃, and the induction expression time is 10 h.

6. The method for preparing BTV1 VP2 protein through prokaryotic expression according to claim 2, wherein in the step (4), when the supernatant containing BTV1 VP2 protein is purified, the supernatant is filtered by a 0.22 μm filter membrane and then purified by nickel affinity chromatography.