CN110408633B - Prokaryotic expression preparation method of BTV1 VP2 protein - Google Patents

Abstract

The application belongs to the technical field of animal vaccine preparation, and particularly relates to a preparation method for preparing BTV1 (bluetongue 1 virus) VP2 protein by using a genetic engineering technology. The coding sequence VP2U of the gene of the VP2 protein of the bluetongue 1 virus consists of 2886bp bases, and the specific base sequence is shown as SEQ ID NO. 1. The specific prokaryotic expression preparation of the BTV1 VP2 protein comprises the following steps: PCR amplification, restriction enzyme digestion, connection with plasmid pET28 to construct recombinant plasmid pET28-VP2U, transformation, induction expression and other steps. The method lays a certain technical foundation for preparing the BTV1 VP2 protein by fermentation by optimizing related encoding genes and further by means of the technical advantages of a prokaryotic expression system. Preliminary experiment results show that the expression level of the target protein in the supernatant of the fermentation liquor can reach 58.4 mu g/ml, and a good technical foundation can be laid for industrial production.

Description

A kind of prokaryotic expression preparation method of BTV1 VP2 protein

technical field

The present application belongs to the technical field of animal vaccine preparation, and specifically relates to a patent application for a preparation method of BTV1 (Bluetongue Type 1 virus) VP2 protein using genetic engineering technology.

Background technique

Bluetongue (BT) is a serious infectious ruminant disease caused by bluetongue virus (BTV) using Culicoides, Aedes mosquitoes and other insects as vectors. This virus mainly affects ruminant livestock. It can cause symptoms such as high fever, depression, and ulcerative inflammatory changes in the oral, nasal and gastrointestinal mucosa. It has been defined as a statutory reportable infectious disease by the International Organization for Animal Health (OIE), and the Ministry of Agriculture of my country has also designated the disease as a Animal diseases. Based on the above-mentioned causes, it can be seen that the occurrence and distribution of bluetongue are closely related to the distribution of vector insects. The outbreak mainly occurs in summer and autumn when Culicoides are active, especially in low-lying, humid and watery areas, and mainly occurs in tropical areas. and subtropical. At present, bluetongue disease has brought a serious threat to the global aquaculture industry, which has attracted great attention from relevant people around the world.

Studies have shown that BTV belongs to the bluetongue virus subgroup of the Circovirus family of Reoviridae, with 27 serotypes, and there is no cross-protection between serotypes. So far, 7 serotypes (BTV1, BTV2, BTV3, BTV4, BTV12, BTV15, BTV16) have been found in my country. Among them, BTV1 and BTV16 are the most popular in China. The genome of BTV is about 19218bp and the molecular weight is 1.3×10 ⁷ . It is the RNA virus with the largest molecular weight. The genome is double-stranded RNA with 10 segments, including 4 small segments (S7-S10) and 3 medium segments (M4-M6). , 3 large segments (L1-L3), segmental genome encoding 3 non-structural proteins (NS1-NS3) and 7 structural proteins (VP1-VP7).

Intact BTV particles have an icosahedral symmetric structure without capsule. BTV has a double-layered protein capsid. VP2 and VP5 encoded by L2 and M5 genes are the main components of the BTV shell. The inner shell of the virus, the core capsid, is mainly composed of L3 and S7. The main structural proteins VP3 and VP7 and the minor structural proteins It is composed of VP1, VP4 and VP6 and is related to the replication of BTV virus. There are 60 triangular-like VP2 trimers in the outer shell of BTV, surrounded by 120 VP5 globular trimers, that is, membrane penetrating proteins, the middle layer is composed of 260 VP7 trimers, and the inner layer contains almost 120 VP3 monomers completely wrapped by the VP7 layer.

The VP2 protein is encoded by the L2 gene, contains 956 amino acids, and is about 110 kDa in size. It is the main type-specific antigen and hemagglutinin protein of the virus. It is related to the virulence, receptor binding, cell adsorption and animal specificity of the virus. Immune-related VP2 is related to the production of neutralizing antibodies and is a BTV serotype-specific protein; BTV has hemagglutinin, which can agglutinate O-type red blood cells of sheep and humans, and its hemagglutination activity is related to VP2, and hemagglutination inhibition test can be used for BTV Type. The VP5 protein can enhance the production of neutralizing antibodies, so it can improve the efficacy of the vaccine; VP3 and VP7 proteins are relatively conservative, and both have BTV antigenic determinants, which play an important role in the stability of the internal structure of BTV.

At present, vaccines for the prevention and control of bluetongue mainly include inactivated vaccines, attenuated vaccines, and genetically engineered subunit vaccines. Among them, the attenuated vaccine can stimulate the body to produce a strong protective immune response, but it may also cause some side effects: such as teratogenicity and abortion when used during pregnancy, reduce the production of lactating animals, produce viremia, etc., and also have virulence The risk of returning to strength. Genetically engineered subunit vaccines have the advantages of being safe, inexpensive, and applicable to a variety of serotypes, and have good application prospects, but at present, genetically engineered subunit vaccines are still in the research stage. The VP2 protein is the main type-specific antigen and hemagglutinin protein of BTV, and is the main target of BTV subunit vaccine research. Therefore, it is urgent to produce a large amount of BTVVP2 protein in both production and scientific research.

At present, the industrial production of recombinant exogenous proteins requires engineered bacteria that can efficiently and stably express foreign gene products, as well as technologies and processes that can cultivate fermentation engineering bacteria on a large scale. However, the VP2 protein expression levels of engineered bacteria in existing studies are all unsatisfactory, and purification and concentration require a lot of manpower, material resources, and financial resources, and it is difficult to achieve industrial production applications. Therefore, there is an urgent need to develop a VP2 protein fermentation process that can greatly improve the yield of engineered bacteria, in order to shorten the production cycle, reduce production costs, and improve the production efficiency of BTV VP2 protein, which is beneficial for the prevention and treatment of BTV and the research and development of new subunit vaccines. Production provides the research basis.

SUMMARY OF THE INVENTION

The main purpose of this application is to provide a soluble prokaryotic expression preparation method of soluble bluetongue virus type 1 (BTV1) VP2 protein, so as to lay a certain technical foundation for the preparation of related vaccines.

The technical solution adopted in this application is described in detail as follows.

The coding sequence VP2U of the VP2 protein gene of the bluetongue type 1 virus is composed of 2886 bp bases, and the specific base sequence is shown in SEQ ID NO.1.

Utilize the BTV1 VP2 protein prokaryotic expression preparation method of the bluetongue type 1 virus VP2 protein gene coding sequence, comprising the following steps:

(1) PCR amplification

The primer sequences used to design PCR amplification of VP2U gene sequence are as follows:

VP2U-F: 5'-CGGGATCCATGGACGAGCTGGGTAT-3', (the "GGATCC" part of the sequence at the 5' end of the sequence is the BamH I restriction site)

VP2U-R: 5'-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT-3'; (the "CTCGAG" part of the 5' end of the sequence is the Xho I restriction site)

The recombinant plasmid pUC-VP2U containing the coding sequence VP2U of the VP2 protein gene of bluetongue virus type 1 was used as a template for PCR amplification. During PCR amplification, the 50 μl reaction system was designed as follows:

PrimeSTAR® HS (Premix) enzyme, 25 μl;

Upstream primer F, 1 μl;

Downstream primer R, 1 μl;

Template plasmid pUC-VP2U, 1 μl;

Sterilized deionized water, 22 μl;

PCR reaction conditions were: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 2 min, a total of 30 cycles; extension at 72°C for 10 min;

The PCR amplification products are recovered and purified for later use;

(2) Enzyme digestion and ligation with plasmid pET28

The PCR amplification product recovered in step (1) was double digested with BamH I and Xho I, and the plasmid pET28 was double digested with BamH I and Xho I to recover the target fragment;

The recovered target fragments were ligated with T4 DNA ligase, and ligated at 16°C overnight;

(3) Transform and screen to obtain the correct recombinant plasmid pET28-VP2U

After transforming the ligation product in step (2) into E.coli competent cell DH5α, carry out resistance screening, and further carry out double digestion identification and sequencing identification to confirm that the correct recombinant plasmid pET28-VP2U is obtained;

(4) Transformation and induction of expression

The recombinant plasmid pET28-VP2U constructed in step (3) was transformed into E. coli BL21 (DE3) competent cells to obtain an E. coli expression strain pET28-VP2U-BL21 expressing BTV1 VP2 protein;

It was further inoculated into the medium, and the expression of BTV1 VP2 protein was induced by IPTG;

After the induction and expression, the cells are further centrifuged and broken, and the supernatant is collected by centrifugation after resuspending, which is the supernatant containing the BTV1VP2 protein, which can be used as an antigen in vaccine preparation after further purification.

In step (4), the medium is an LB liquid medium containing 50 μg/mL Kana+ or a basal fermentation medium containing 50 μg/mL kanamycin;

The basic fermentation medium is composed of: 12 g/L peptone, 24 g/L yeast extract, 16.43 g/L K ₂ HPO ₄ •3H ₂ O, 2.31 g/L KH ₂ PO ₄ , and 5.04 g/L glycerol.

In step (4), when IPTG induces expression, the final concentration of IPTG is 0.1-1.0 mM, the induction expression temperature is 20°C to 37°C, and the induction expression time is 6 to 12 hours.

In step (4), during the purification operation, the supernatant liquid is first filtered with a 0.22 μm filter membrane, and then purified by nickel affinity chromatography.

In the prior art, when using genetic engineering to obtain BTV1 VP2 protein, although there are many eukaryotic expression system research and application, but in view of the advantages of prokaryotic expression system production cost is low, easy to ferment preparation and other advantages, it is still necessary to study the prokaryotic expression of the protein. The construction of the expression system was studied in depth.

In general, compared with the prior art, the main technical advantages of the present application are reflected in the following aspects:

(1) The present invention optimizes the BTV1 VP2 encoding gene to make it more suitable for high-efficiency expression of the target protein in the E. coli host; and through the experimental analysis of the fusion expression of the BTV1 VP2 gene in E. coli before and after optimization, BTV1 VP2 original The gene has almost no target protein expression in the pET28a vector, while the solubility of the optimized BTV1VP2 gene in the pET28a vector is significantly increased in the present invention, and the soluble target protein still maintains a high activity;

(2) The present invention systematically optimizes the expression conditions of the BTV1 VP2 protein, especially preliminarily optimizes the bacterial fermentation density and fermentation conditions in the large-scale fermentation process, in order to improve the specific productivity of the product (product per unit volume per unit time). output) and laid the initial technical foundation.

In general, the present application has laid a certain technical foundation for the fermentation and preparation of BTV1 VP2 protein by optimizing the relevant coding genes and further relying on the technical advantages of the prokaryotic expression system. Preliminary experimental results show that the expression level of the target protein in the supernatant of the fermentation broth can reach 58.4 μg/ml, which is significantly higher than the yield of the target protein BTV1 VP2 in other prokaryotic expression systems, which can lay a good technical foundation for industrial production. .

Description of drawings

Figure 1 is the amplification of the VP2 target gene; M is the molecular weight marker of DL15000; 1 is the VP2 gene before optimization (left picture); 2 is the VP2 gene after optimization (right picture);

Figure 2 is the double-enzyme digestion identification map of the recombinant plasmid, wherein M is the molecular weight marker of DL2000; 1 is the pET28a-VP2U plasmid; 2 is the double-enzyme digestion product of the pET28a-VP2U plasmid; 3 is the pET28a-VP2 plasmid; 4 is the pET28a-VP2 Plasmid double digestion product;

Figure 3 is the SDS-PAGE identification chart of the optimized induction and expression conditions of recombinant VP2 protein in E. coli, where M is the standard protein Marker; A is the IPTG concentration optimization: 1-6 are the final concentrations: 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, 1.0 mM IPTG-induced expression results; B is the induction temperature optimization: 1-2 were 20 ℃ induced expression ultrasonic supernatant and precipitate; 3-4 were 25 ℃ induced expression ultrasonic supernatant and precipitation; 5-6 are the supernatant and precipitation induced to express at 30°C, respectively; C is the optimization of the induction expression time: 1-4 are the expression of the target protein after 6h, 8h, 10h, and 12h of induction, respectively;

Figure 4 is the SDS-PAGE identification chart of recombinant VP2 protein expressed in E. coli, wherein M is the standard protein Marker; 1 is the ultrasonic supernatant of the recombinant VP2 protein expressed by the VP2U gene; 2 is the ultrasonic precipitation of the recombinant VP2 protein expressed by the VP2U gene ; 3 is the ultrasonic supernatant of recombinant VP2 protein expressed by the original VP2 gene; 4 is the ultrasonic precipitation of the recombinant VP2 protein expressed by the original VP2 gene;

Figure 5 shows the SDS-PAGE and Western-Blot identification of the purified recombinant VP2 protein (the left picture is SDS-PAGE; the right picture is Western-Blot), M is the standard protein Marker; 1 is the negative control of uninduced bacteria; 2 is the Purified VP2 protein;

Figure 6 is the identification result of BTV1 inactivated virus by SDS-PAGE, wherein, M is the standard protein Marker; 1 is the concentrated BTV1 inactivated virus.

Figure 7 is the DOT-ELISA identification results, wherein, 1 is the BTV1 inactivated virus; 2 is the purified VP2 protein; 3 is the negative control of uninduced bacteria.

Detailed ways

The application will be further explained below in conjunction with the examples. Before introducing specific embodiments, a brief introduction and description of some experimental backgrounds in the following embodiments are as follows.

biomaterials:

pET-28a plasmid, product of Novagen (Merck, Germany);

The BTV1 inactivated virus used in the identification was donated by the Yunnan Academy of Animal Husbandry and Veterinary Sciences;

Main experimental reagents:

High-fidelity hot-start PrimeSTAR® HS (Premix) enzyme for PCR amplification, a product of TaKaLa;

Restriction endonucleases BamHI, Xho I, products of NEB (New England Biolabs, Inc.);

Other cases:

The instruments and equipment involved in the following examples are conventional instruments and equipment unless otherwise specified;

The reagents involved are commercially available conventional reagents unless otherwise specified;

The test methods involved, unless otherwise specified, are conventional methods, and can be operated with reference to the conditions described in "Molecular Cloning: Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 1989).

Example 1

It should be noted that the existing BTV1 VP2 gene sequence is limited by the difference between the Escherichia coli genome sequence and the viral gene sequence during prokaryotic expression, resulting in the fact that the VP2 protein obtained from the actual expression mostly exists in the form of inclusion bodies, thus causing a relatively high expression efficiency. Low, in order to overcome this defect, the inventors conducted a detailed bioinformatics analysis of the existing BTV1 VP2 gene (GenBank: JX101695.1) sequence, and adopted the most frequently used codons for all amino acids. The secondary structure of mRNA, combined with the modification of the optimal codon frequency and the avoidance of the restriction enzyme cleavage site in the subsequent expression process, designed and obtained a brand-new BTV1 VP2 DNA sequence with a full length of 2886bp, as shown in SEQ ID NO. 1 shown.

The designed gene sequence was further synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and then transformed into the pUC57 plasmid for subsequent experimental applications. The recombinant plasmid was named: pUC-VP2U.

The optimized BTV1 VP2 gene sequence (VP2U), the specific base sequence is as follows:

ATGGACGAGCTGGGTATCCCAATCTACAAGCAAGGATTCCCTGAGCACCTGCTGCACGGCTACGAGTTCACTATTGACAGCTCTACCAAGATCCAGTCAGTTGGCGGTCGTCACGACGTGACTAAGCTGCCCGAAATGAACGCCTACGACATCAAGGCTGAATCCATCCGCACCGCCCTGTGGTACAACCCTGTTCGTAACGACGGTTTCGTCCTGCCTCGTGTCCTCGACATCACCCTGCGCGGATACGACGGAAAGCGTGCCGTGATCGACTCCAGCAAGCACAAGATCTTCCACACTGACGAGAGGTGGGTCCAGTGGATGATGAAGGACTCAATGGACGCTCAACCCCTCAAGGTCGGCCTGGACGACCGCACACAAAAGATCGCTCACTCATTGCACAATTGTGTTGTGAAGATCGACTCTAAGAAGGCTGACACCATGTCTTACCACGTGGAACCTATCGAAGACCCCAGTAAGGGCTGTCTCCACACCCGTGCCATGCTGTGGAACCACCTGGTTCGCATCGAAATGTCCCACGCCGCCCAAGAAATCGCTTACACACTGAAGCCTACCTACGACATCGTCGTCCACGCTGAACGCCGTGACAGGTCACAACCCTTCCAGCCTGGAGACCAGACCCTGATCAACTTCGGTCGCGGTCAGAAGGTTCAGATGAACCACAACAGCTACGAGAAGATGGTTGAAGGCCTGGCTCACCTCGTGATCCGCGGAAAGACTCCTGAGCTGATCCGTGACGAAATCGCTAAGCTCGACGAGATCTGCAATCGCTGGATCAGGTCCCGTCACGACCCTGGTGAAATCAAGGCCTACGAACTCTGCAAAATCCTCTCCACAGTTGGACGTAAGATGCTCGACCAGGAAAAGGAACCAGCTGACGAAGCCTCTTTGAGCATCCGTTTCCAAGAAGCTATCGACAACAAGTTCCGCCAGCATGACCCTGAACGCCTGAAAATCTTTGAGCACCGTAACCAGCGCC GTGATGAGGACAGGTTCTACATCCTCCTGATGATCGCTGCCTCTGACACATTCAACACTCGCGTCTGGTGGTCCAACCCATACCCCTGTCTGCGTGGAACCCTGATGGCTTCTGAAACCAAGCTGGGTGACGTGTATTCTATGATGCGCAGCTGGTACGACTGGTCTGTTCGTCCTACATACACTCCCCACGAAAAGAGCAGAGAGCAGGAAAAGTACATCTACGGACGCGTGAACCTGTTCGACTACGTCGCCGAACCAGGCACAAAGATCATCCATTGGGAATACAAGTTGAACCAGCAAACAAAAGACATCACATACGAGCAGGGTAACCCATGCGACCTGTTCCCCGACGACGACGAAGCCATCATCACTAAGTTCGATGACGTCGCTTACGGACAGATGGTTTCCGACCTGATCAACGGCGGATGGGATCAGGAGAGGTTCAAGATGCACAAGATCCTCAAGAGCCAGGGCAACGTGCTGACCATCGATTTCGAAAAGGACGCTAAGCTGACAAGTAACGAAGGCGTTACAATGCCAGAATACTTCGACAAGTGGATCATCGCCCCAATGTTCAACGCTAAGTTGCGCATCAAGCACAGCGAGATCGCCCAAAGAAGAGACGACGATCCTATGGTTAAGAGAACACTCAGCCCTATCGCTTTCGACCCTATCGTCCTCCAACGTCTCACTCTCGCTCGTTACTACGACATCAGGCCCGCTATCATGGGTCAGGCCCTGTCACGTCAACAAGGCCAGTCTACTTACGATGAGGAGGTCTCCAAGATCGAAGGATACGCTGAGATCCTCCAGCGTCGTGGAATCGTGCAAATCCCTAAGAAGCCATGCCCCACTGTCACCGCTCAGTACACACTGGAACGCTACGCCCTCTTCCTGATCAACATCTTGGAGCAGCACGTGATCCGCTCCACCGATGAGGATGTCATCTACAGCCACCCTCGTGTGGACCACAAGCTGGAAATCTACGGTGAATCCAT CGTTGACATCTCCCAGATCGTGATCTTCGTGTTCGACTTTTTGTTCGAGCGTAGGCGCACCGTCCGCGGCGTGTACGAGTCCCGTTACATGGTGACCCGTATCCGCGACGCCCAGGGCCAGAACAGGATCAACGTCATCACTGAGTTCTTCCCAACTTTCGGCTACTACCTGAACCGTATCAAGGAGGCCACCATCATGCAGGAAATCATGTACCTGAATTTCCTGCCCTTGTTCTTCCTGGTTAGCGACAACATCATGTACACCCATAAGCAATGGTCAGTCCCACTGCTGCTGTACGCTCACGAACTGAAGGTCATCCCTCTGGAGGTGGGTTCATACAATGACCGCTGTGGCCTGATTTCATACGTTGAGTACATGGTGTTCTTCCCCTCTAAGGCTTTCAGGACAAGCAAGTTGGACGAAGTGCAGCCTAAGATCGCTAGGGAGATGCTCAAATACTACACCAACACAAAGATCTTCGAAGGTGGTATCAACCTGAACGTGATCACCACTAAGCAGCTCCTGTACGAGACATACCTGGCTTCCCTGTGCGGTGGACTCTCTGATGGAATCGTGTGGTACCTCCCTATTACACACCCATCTAAGTGTCTGGTCGCCGTTGAGGTCTCCGATGAGAGGGTGCCAGCTTCCATCCGCGCCAGTCGCATCAAGCTGCGCTTCCCTCTGAGCGTTAAGCACCTGAAGGGTATCGTTGTGATCCAAATCGACGAAGAAGGCAAGTTCACAGTTTACTCCGAGGGAATCGTTAGCCACCGTATCTGTAAGAAGAACCTGCTGAAGTACATGTGTGACATCGTCCTGCTCAAGTTCTCCGGCCACGTGTTCGGAAACGACGAGATGCTGACTAAGCTCCTCAACGTTTAA。

Example 2

On the basis of Example 1, the inventors further used plasmid pET28 as a carrier, and recombined the optimized VP2U into plasmid pET28 to construct a recombinant plasmid expression vector pET28-VP2U, thereby facilitating subsequent prokaryotic expression. The specific recombinant plasmid expression vector pET28 - The construction process of VP2U is briefly described below.

It should be noted that, in order to prove the expression effect of the optimized gene sequence of the present application, with the existing BTV1 VP2 gene (GenBank: JX101695.1) as a control, the inventor also entrusted Sangon Bioengineering (Shanghai) Co., Ltd. The recombinant plasmid was named: pUC-VP2. On this basis, the inventors also prepared a recombinant plasmid expression vector pET28-VP2 as a control.

(1) PCR amplification

When the optimized VP2U gene sequence was amplified by PCR (the primers were synthesized and provided by Sangon Bioengineering (Shanghai) Co., Ltd.), the primer sequences were designed as follows:

VP2U-F: 5'-CGGGATCCATGGACGAGCTGGGTAT-3', (the "GGATCC" part of the sequence at the 5' end of the sequence is the BamH I restriction site)

VP2U-R: 5'-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT-3'; (the "CTCGAG" part of the 5' end of the sequence is the Xho I restriction site)

When PCR amplifying the VP2 gene sequence (the primers were synthesized and provided by Sangon Bioengineering (Shanghai) Co., Ltd.), the primer sequences were designed as follows:

VP2-F: 5'-CGGGATCCATGGATGAGTTAGGCATA-3' (the "GGATCC" part of the sequence at the 5' end of the sequence is the BamH I restriction site)

VP2-R: 5'-CCGCTCGAGTCATACGTTGAGAAGTTTTGTTA-3' (the "CTCGAG" part at the 5' end of the sequence is the Xho I restriction site)

Using pUC-VP2U plasmid or pUC-VP2 as the template, PCR amplification was performed. During PCR amplification, the 50 μl reaction system was designed as follows:

PrimeSTAR® HS (Premix) enzyme, 25 μl;

Upstream primer F, 1 μl;

Downstream primer R, 1 μl;

Template plasmid pUC-VP2U or pUC-VP2 plasmid, 1 μl;

Sterilized deionized water, 22 μl;

The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 2 min, a total of 30 cycles; extension at 72°C for 10 min.

The PCR amplification products were detected by mass fraction 1% agarose gel electrophoresis, and the results are shown in Figure 1. It can be seen from the analysis that the PCR amplification products of the gene before and after optimization are about 2893 bp in size, which is in line with the expectation, which proves that the BTV1 VP2 gene before and after the full-length codon optimization was successfully obtained.

The PCR amplification product is further recovered and purified for later use.

(2) Enzyme digestion and ligation with plasmid pET28

The PCR amplification product (original BTV1 VP2 gene or the optimized BTV1 VP2U gene) recovered in step (1) was subjected to BamH I and Xho I double digestion, and plasmid pET28 was simultaneously subjected to BamH I and Xho I double digestion, Then use the DNA recovery kit to recover the target fragment;

The recovered target fragments were ligated with T4 DNA ligase and ligated at 16°C overnight.

(3) Transform and screen to obtain the correct recombinant plasmid I (pET28-VP2U) and recombinant plasmid II (pET28-VP2)

After the ligation product in step (2) was transformed into E. coli competent cells DH5α, resistance screening was carried out, and after further picking single clones for cultivation, positive colony plasmids were extracted for double-enzyme digestion identification.

The identification results are shown in Figure 2. It can be seen from the analysis that the size of the fragment after double digestion is consistent with the size of the VP2 and VP2U target genes, indicating that the recombinant vector was successfully constructed.

Further, the double-enzyme digestion-positive plasmids were sent to Sangon Bioengineering Co., Ltd. for sequencing and identification to ensure that the correctly constructed recombinant plasmid I (pET28-VP2U) and recombinant plasmid II (pET28-VP2) were obtained.

After further culturing and amplifying the Escherichia coli containing the correctly constructed recombinant plasmid I (pET28-VP2U) and recombinant plasmid II (pET28-VP2), the correctly constructed recombinant plasmid I (pET28-VP2U) and recombinant plasmid II (pET28-VP2U) and II ( pET28-VP2) for further transformation and expression of VP2 protein.

Example 3

On the basis of Example 2, the inventors transformed the constructed recombinant plasmid I (pET28-VP2U) and recombinant plasmid II (pET28-VP2) into E. coli BL21 (DE3) competent cells, respectively, and obtained large intestine expressing BTV1 VP2 protein. Bacillus expresses strains pET28-VP2U-BL21 and pET28-VP2-BL21, and then carried out preliminary expression verification. The specific experimental process is briefly described as follows.

(1) Strain culture and induction of expression

The E. coli expression strains pET28-VP2U-BL21 and pET28-VP2-BL21 were respectively inoculated into LB liquid medium containing 50 μg/mL Kana+ and cultured to an OD ₆₀₀ value of about 0.8, IPTG was added to a final concentration of 0.3 mM, and then Expression was induced at 25°C for 10h.

(2) Protein purification and identification

Take 5 mL of the induced expression bacterial solution, centrifuge at 12000 r/min for 10 min, discard the supernatant, and collect the bacterial cells;

After resuspending the cells with 1 mL of PBS, ultrasonically disrupted (ultrasonic fragmentation time is 10 min, ultrasonic for 3 s, intermittent for 3 s, power is 45 w);

The supernatant and pellet were separated by centrifugation at 12000 r/min for 15 min, and identified by SDS-PAGE respectively.

The identification results are shown in Figure 3. It can be seen from the figure that the recombinant protein of BTV1 VP2 is expressed at about 120kDa in the pET28-VP2U-BL21 expression strain after codon optimization, and the soluble expression level is high, while that in the unoptimized pET28-VP2-BL21 expression strain No BTV1 VP2 recombinant protein was expressed; indicating that codon optimization significantly improved the soluble expression of recombinant protein.

(3) Optimization of inducible expression conditions

On the basis of the above experiments, the inducing expression conditions such as the concentration of the inducer IPTG, the induction expression time, and the induction temperature in step (1) were further optimized. The specific experimental process and results are briefly introduced as follows.

(1) IPTG concentration optimization: Inoculate 1:100 of the overnight activated strains in LB liquid medium containing 50 μg/mL Kana+ and culture to an OD ₆₀₀ value of about 0.8, add the final concentrations: 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, 1.0 mM IPTG, 30 ℃, after induction expression for 8 h, collected the bacteria, and identified the expression of the target protein by SDS-PAGE; the results showed that the IPTG concentration had little effect on the overall expression of the target protein (Fig. 3A), but from a practical point of view, since 0.2 mM is easier to control the dosage, 0.2 mM is used as the application concentration in the following applications;

(2) Optimization of induction expression temperature: Inoculate overnight activated strains at 1:100 in LB liquid medium containing 50 μg/mL Kana+ and culture to an OD ₆₀₀ value of about 0.8, add IPTG with a final concentration of 0.2 mM, respectively. The cells were collected after inducing expression at 20°C, 25°C and 37°C for 10 hours. After ultrasonication, the expression of the target protein was identified by SDS-PAGE. The results showed that the soluble expression of the target protein was the highest at 20°C (Figure 3B).

(3) Optimization of induction expression time: Inoculate 1:100 of the overnight activated strains in LB liquid medium containing 50 μg/mL Kana+ and culture to an OD ₆₀₀ value of about 0.8, add IPTG with a final concentration of 0.2 mM, at 20 After inducing expression at ℃ for 6h, 8h, 10h, and 12h, the cells were collected, and the expression of the target protein was identified by SDS-PAGE; the results showed that the soluble expression of the target protein was the highest when the expression was induced for 10h (Figure 3C).

To sum up, the experimental results showed that the optimal expression and operating conditions of the recombinant protein were: IPTG concentration of 0.2 mM, induction temperature of 20 °C, and induction of 10 h for the highest expression of the target protein (Figure 4).

Example 4

On the basis of Example 4, the inventor further used the constructed Escherichia coli expression strain pET28-VP2U-BL21 to conduct a small-scale fermentation culture experiment to investigate its practical application. The specific experimental process is briefly described as follows.

(1) Strain activation

The genetically engineered bacteria E.coli pET28-VP2U-BL21 strain stored in -80 ℃ glycerol tube was streaked on the surface of LB solid medium containing 50 μg/mL kanamycin, and then the plate was inverted in a 37 ℃ constant temperature incubator Incubate overnight;

The next day, the activated strains were inoculated into 50 mL of seed medium (Kana+/LB liquid medium, in which the concentration of kanamycin was 50 μg/mL), and shaken at 37°C for 14 hours, which was used as the seed liquid .

It should be explained that in this example, after the successful transformation of the Escherichia coli expression strain pET28-VP2U-BL21, in order to facilitate preservation, a -80°C glycerol tube was used for preservation. In practical applications, after successful transformation, it can be directly inoculated in The seed liquid is prepared by fermentation in the seed medium, without the need to inoculate the LB solid medium for activation.

(2) Fermentation culture

In the fermenter, 5L basic fermentation medium, sterilized at 121°C for 20min, cooled to 35°C, adjusted to pH=6.8, inoculated with 50mL of the seed solution prepared in step (1) (inoculation ratio, 1:100), note that Yes, before inoculation, add sterilized kanamycin to the basal fermentation medium to a concentration of 50 μg/mL;

The maximum ventilation rate was 50%, and the ventilation rate range was 100-150 VVM; the maximum stirring speed was 50%, the stirring speed was 150-300 r/min, and the culture was carried out at 37 °C for about 3 hours.

The basic fermentation medium is composed of: 12 g/L peptone, 24 g/L yeast extract, 16.43 g/L K ₂ HPO ₄ •3H ₂ O, 2.31 g/L KH ₂ PO ₄ , and 5.04 g/L glycerol.

(3) Induced protein expression

When the OD ₆₀₀ of the fermentation broth in step (2) is about 7.0-8.0 (that is, when cultured at 37°C for about 3 hours), the temperature of the fermentation broth is lowered to 20°C, and the inducer IPTG with a final concentration of 0.2mmol/L is added. Continue to ferment for 24h to induce the expression of the target protein;

During the fermentation process, the amount of dissolved oxygen is controlled between 20 and 30% through aeration and stirring operations.

(4) Protein extraction and purification

After the fermentation, the cells were collected by centrifugation at 8000r/min for 20min, then resuspended with PBS to induce the expression of the cells, and then crushed by high pressure or sonication, and further centrifuged at 12000r/min for 15min, and the supernatant of the bacterial liquid was taken and filtered with a 0.22 μm membrane. After filtration, purification was performed by nickel affinity chromatography.

When purifying by nickel affinity chromatography, please refer to the following steps: first equilibrate with equilibration solution (50mM Tris-HCl, 300mM NaCl, 10mM imidazole); then use washing solution (50mM Tris-HCl, 300mM NaCl, 40mM imidazole) to elute the impurity protein; finally, use the eluent (50 mM Tris-HCl, 300 mM NaCl, 250 mM imidazole) to elute the target protein.

It should be noted that, taking a certain optimal experiment as an example, the measurement results after fermentation showed that the dry weight of the bacteria in the fermentation broth could reach 126.5g/L, and the proportion of the dry weight of the bacteria after centrifugation reached 12.65%. It shows that the fermentation regulation and fermentation effect are excellent, which can lay a good fermentation foundation for the actual protein preparation.

The purified protein was identified, and the results are shown in Figure 5. It can be seen that: SDS-PAGE and Western Blot results show that the recombinant protein purification effect is good, analysis shows that the purity of VP2 is about 80%.

(5) Determination of expression content of BTV1 VP2 recombinant protein

On the basis of the purified protein obtained in step (3), using the BCA protein concentration determination kit and the ELISA sandwich method, the inventors further determined the expression of BTV1 VP2 recombinant protein in the fermentation broth. The specific determination process is as follows.

First, dilute the purified target protein stock solution with the determined concentration to a series of concentrations, specifically: 2 µg/mL, 1 µg/mL, 0.5 µg/mL, 0.25 µg/mL, 0.125 µg/mL, as the standard concentration, through For ELISA detection, use the concentration as the ordinate and the corresponding OD ₄₅₀ detection value as the abscissa to establish a standard linear regression equation.

Next, the supernatant of the fermented bacteria-broken liquid was diluted into a series of multiples, specifically: 50, 100, 200, and 400 times.

Finally, the OD ₄₅₀ value measured in the supernatant of the fermented bacteria-broken liquid was obtained by a standard linear regression equation to obtain the corresponding concentration (unit: µg/mL), and then multiplied by the dilution factor to obtain the target protein concentration of the fermented bacteria-broken liquid supernatant ( The unit is µg/mL).

Since the bacteria breaking liquid is prepared by the wet weight of the bacteria body: bacteria breaking buffer = 1:10, the expression amount of the target protein of the fermented bacteria (unit is µg/g bacteria) is: 10 × fermentation bacteria breaking liquid supernatant The concentration of the target protein (unit: µg/mL), multiplied by the bacterial density of the fermentation broth (unit: g bacterial cell/L fermentation broth), is the expression concentration of the fermentation target protein (unit: µg/L fermentation broth). The specific formula is as follows:

The concentration of target protein in the supernatant of the fermentation broth (µg/mL) = dilution factor × standard target protein concentration (µg/mL) × OD ₄₅₀ (supernatant of the fermentation broth) / OD ₄₅₀ (standard target protein concentration);

The concentration of fermentation target protein expression (µg/L fermentation broth) = 10×the concentration of target protein in the supernatant of the fermentation broth (µg/mL)×the bacterial density of the fermentation broth (g bacterial cells/L fermentation broth).

The fermentation expression results of BTV1 VP2 in different batches of fermentation broth were determined, and the results are shown in the following table:

。

.

It can be seen from the results in the above table that the present invention can not only express BTV1 VP2 protein in Escherichia coli by optimizing the expression sequence of BTV1 VP2 protein gene, but also has a high soluble expression level, which can meet the requirements of industrial production.

(6) Activity identification of BTV1 VP2 recombinant protein

In order to determine the availability of the BTV1 VP2 protein prepared in this application, the inventors further detected and identified its activity. The specific experimental process is briefly described as follows.

(1) Preparation of inactivated virus BTV1 hyperimmune serum

After the BTV1 inactivated virus was concentrated (the SDS-PAGE identification result of the concentrated virus is shown in Figure 6), it was emulsified with Freund's complete adjuvant to make an immunogen, and the immunogen was immunized for 4 to 8 weeks by subcutaneous injection at multiple points on the back. 3 female BALB/c mice of age, the immunization dose was 50 μl/mice;

BALB/c mice were boosted with the same method and dose after emulsification with incomplete Freund's adjuvant and immunizing antigen every 3 weeks, and immunized three times in total, and finally obtained hyperimmune serum.

(2) Determination of BTV1 VP2 protein activity

The activity was determined by DOT ELISA, and the specific operations were as follows:

Wet the strip-shaped NC membrane completely in phosphate buffered saline (PBS) and dry it at room temperature;

Take 1 μl of purified BTV1 VP2 protein and spot it on the NC membrane, and then take 1 μl of inactivated BTV1 virus and 1 μl of uninduced protein as positive control and negative control, respectively, use 1:500 diluted positive serum as primary antibody, 1:5000 dilution HRP-conjugated goat anti-mouse was used as the secondary antibody, and AEC was developed.

The experimental results (the results are shown in Figure 7) show that the BTV1 VP2 protein obtained by the prokaryotic expression system can react specifically with the serum of mice immunized with BTV1 virus, indicating that the BTV1 VP2 protein has good reactogenicity and can be used for further vaccine preparation application.

SEQUENCE LISTING

<110> Zhengzhou University

Henan Zhongze Biological Engineering Co., Ltd.

<120> A kind of prokaryotic expression preparation method of BTV1 VP2 protein

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 2886

<212> DNA

<213> bluetongue virus

<400> 1

atggacgagc tgggtatccc aatctacaag caaggattcc ctgagcacct gctgcacggc 60

tacgagttca ctattgacag ctctaccaag atccagtcag ttggcggtcg tcacgacgtg 120

actaagctgc ccgaaatgaa cgcctacgac atcaaggctg aatccatccg caccgccctg 180

tggtacaacc ctgttcgtaa cgacggtttc gtcctgcctc gtgtcctcga catcaccctg 240

cgcggatacg acggaaagcg tgccgtgatc gactccagca agcacaagat cttccacact 300

gacgagaggt gggtccagtg gatgatgaag gactcaatgg acgctcaacc cctcaaggtc 360

ggcctggacg accgcacaca aaagatcgct cactcattgc acaattgtgt tgtgaagatc 420

gactctaaga aggctgacac catgtcttac cacgtggaac ctatcgaaga ccccagtaag 480

ggctgtctcc acacccgtgc catgctgtgg aaccacctgg ttcgcatcga aatgtcccac 540

gccgcccaag aaatcgctta cacactgaag cctacctacg acatcgtcgt ccacgctgaa 600

cgccgtgaca ggtcacaacc cttccagcct ggagaccaga ccctgatcaa cttcggtcgc 660

ggtcagaagg ttcagatgaa ccacaacagc tacgagaaga tggttgaagg cctggctcac 720

ctcgtgatcc gcggaaagac tcctgagctg atccgtgacg aaatcgctaa gctcgacgag 780

atctgcaatc gctggatcag gtcccgtcac gaccctggtg aaatcaaggc ctacgaactc 840

tgcaaaatcc tctccacagt tggacgtaag atgctcgacc aggaaaagga accagctgac 900

gaagcctctt tgagcatccg tttccaagaa gctatcgaca acaagttccg ccagcatgac 960

cctgaacgcc tgaaaatctt tgagcaccgt aaccagcgcc gtgatgagga caggttctac 1020

atcctcctga tgatcgctgc ctctgacaca ttcaacactc gcgtctggtg gtccaaccca 1080

tacccctgtc tgcgtggaac cctgatggct tctgaaacca agctgggtga cgtgtattct 1140

atgatgcgca gctggtacga ctggtctgtt cgtcctacat acactcccca cgaaaagagc 1200

agagagcagg aaaagtacat ctacggacgc gtgaacctgt tcgactacgt cgccgaacca 1260

ggcacaaaga tcatccattg ggaatacaag ttgaaccagc aaacaaaaga catcacatac 1320

gagcagggta acccatgcga cctgttcccc gacgacgacg aagccatcat cactaagttc 1380

gatgacgtcg cttacggaca gatggtttcc gacctgatca acggcggatg ggatcaggag 1440

aggttcaaga tgcacaagat cctcaagagc cagggcaacg tgctgaccat cgatttcgaa 1500

aaggacgcta agctgacaag taacgaaggc gttacaatgc cagaatactt cgacaagtgg 1560

atcatcgccc caatgttcaa cgctaagttg cgcatcaagc acagcgagat cgcccaaaga 1620

agagacgacg atcctatggt taagagaaca ctcagcccta tcgctttcga ccctatcgtc 1680

ctccaacgtc tcactctcgc tcgttactac gacatcaggc ccgctatcat gggtcaggcc 1740

ctgtcacgtc aacaaggcca gtctacttac gatgaggagg tctccaagat cgaaggatac 1800

gctgagatcc tccagcgtcg tggaatcgtg caaatcccta agaagccatg ccccactgtc 1860

accgctcagt acacactgga acgctacgcc ctcttcctga tcaacatctt ggagcagcac 1920

gtgatccgct ccaccgatga ggatgtcatc tacagccacc ctcgtgtgga ccacaagctg 1980

gaaatctacg gtgaatccat cgttgacatc tcccagatcg tgatcttcgt gttcgacttt 2040

ttgttcgagc gtaggcgcac cgtccgcggc gtgtacgagt cccgttacat ggtgacccgt 2100

atccgcgacg cccagggcca gaacaggatc aacgtcatca ctgagttctt cccaactttc 2160

ggctactacc tgaaccgtat caaggaggcc accatcatgc aggaaatcat gtacctgaat 2220

ttcctgccct tgttcttcct ggttagcgac aacatcatgt acacccataa gcaatggtca 2280

gtcccactgc tgctgtacgc tcacgaactg aaggtcatcc ctctggaggt gggttcatac 2340

aatgaccgct gtggcctgat ttcatacgtt gagtacatgg tgttcttccc ctctaaggct 2400

ttcaggacaa gcaagttgga cgaagtgcag cctaagatcg ctagggagat gctcaaatac 2460

tacaccaaca caaagatctt cgaaggtggt atcaacctga acgtgatcac cactaagcag 2520

ctcctgtacg agacatacct ggcttccctg tgcggtggac tctctgatgg aatcgtgtgg 2580

tacctcccta ttacacaccc atctaagtgt ctggtcgccg ttgaggtctc cgatgagagg 2640

gtgccagctt ccatccgcgc cagtcgcatc aagctgcgct tccctctgag cgttaagcac 2700

ctgaagggta tcgttgtgat ccaaatcgac gaagaaggca agttcacagt ttactccgag 2760

ggaatcgtta gccaccgtat ctgtaagaag aacctgctga agtacatgtg tgacatcgtc 2820

ctgctcaagt tctccggcca cgtgttcgga aacgacgaga tgctgactaa gctcctcaac 2880

gtttaa 2886

Claims (6)

1. The bluetongue disease type 1 virus VP2 protein gene VP2U is characterized in that the gene VP2U consists of 2886bp bases, and the specific base sequence is shown as SEQ ID NO. 1.

2. The method for preparing the BTV1 VP2 protein by prokaryotic expression by using the gene VP2U in claim 1, which is characterized by comprising the following steps:

(1) PCR amplification

The primer sequences for designing the sequence of the PCR amplified gene VP2U are as follows:

VP2U-F：5’- CGGGATCCATGGACGAGCTGGGTAT -3’，

VP2U-R：5’-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT -3’；

carrying out PCR amplification by taking a recombinant plasmid pUC-VP2U containing the protein gene VP2U of the bluetongue 1 virus VP2 as a template; recovering and purifying PCR amplification products for later use;

(2) cut and connected with a plasmid pET28

Carrying out BamH I and Xho I double enzyme digestion on the PCR amplification product recovered in the step (1), simultaneously carrying out BamH I and Xho I double enzyme digestion on a plasmid pET28, and recovering a target fragment;

connecting the recovered target fragments by using T4 DNA ligase;

(3) transforming and screening to obtain recombinant plasmid pET28-VP2U with correct recombination

Transforming the connecting product in the step (2) into E.coli competent cell DH5 alpha, performing resistance screening, and further performing double enzyme digestion identification and sequencing identification to confirm that a recombinant plasmid pET28-VP2U with correct recombination is obtained;

(4) transformation and inducible expression

Transforming the recombinant plasmid pET28-VP2U constructed in the step (3) into escherichia coli BL21 competent cells to obtain an escherichia coli expression strain pET28-VP2U-BL21 for expressing BTV1 VP2 protein;

further inoculating the strain in a culture medium, and inducing and expressing BTV1 VP2 protein by IPTG;

and after the induction expression is finished, further centrifuging and crushing the thalli, and centrifuging and collecting supernatant after heavy suspension, namely the supernatant containing BTV1 VP2 protein.

3. The method for prokaryotic expression and preparation of the BTV1 VP2 protein according to claim 2, wherein in the step (1), a 50 μ l reaction system is designed as follows during PCR amplification:

PrimeSTAR HS Premix enzyme, 25 mul;

upstream primer F, 1. mu.l;

downstream primer R, 1. mu.l;

template plasmid pUC-VP2U, 1. mu.l;

sterilizing deionized water, 22 μ l;

the PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 2min for 30 cycles; extension at 72 ℃ for 10 min.

4. The method for preparing the BTV1 VP2 protein through prokaryotic expression according to claim 2, wherein in the step (4), when IPTG is subjected to induced expression, the final concentration of IPTG is 0.1-1.0 mM, the induced expression temperature is 20-37 ℃, and the induced expression time is 6-12 h.

5. The method for preparing the BTV1 VP2 protein through prokaryotic expression according to claim 4, wherein in the step (4), when IPTG is used for induction expression, the final concentration of IPTG is 0.2mM, the induction expression temperature is 20 ℃, and the induction expression time is 10 h.

6. The method for preparing BTV1 VP2 protein through prokaryotic expression according to claim 2, wherein in the step (4), when the supernatant containing BTV1 VP2 protein is purified, the supernatant is filtered by a 0.22 μm filter membrane and then purified by nickel affinity chromatography.

Images