CN110408633A - A kind of prokaryotic expression preparation method of BTV1 VP2 albumen - Google Patents

Abstract

The application belongs to animal vaccine preparation technical field, and in particular to a kind of using technique for gene engineering prepare BTV1(blue tongue disease 1 type viral) the preparation method patent application matters of VP2 albumen.1 type virus VP 2 protein gene coding sequence VP2U of blue tongue disease is by 2886bp base composition, and specific base sequence is as shown in SEQ ID NO.1.When specific prokaryotic expression preparation BTV1 VP2 albumen, comprising: PCR amplification, digestion connect construction recombination plasmid pET28-VP2U with plasmid pET28, conversion, inducing expression and etc..The application is by the optimization to correlative coding gene, further by means of the technical advantage of prokaryotic expression system, has established certain technical foundation for fermentation preparation BTV1 VP2 albumen.Preliminary experimental results show that the destination protein expression quantity in fermented liquid supernatant can reach 58.4 μ g/ml, and good technique basis can be established for industrialized production.

Description

A kind of prokaryotic expression preparation method of BTV1 VP2 albumen

Technical field

The application belongs to animal vaccine preparation technical field, and in particular to a kind of to prepare BTV1 using technique for gene engineering The preparation method patent application matters of (1 type of blue tongue disease virus) VP2 albumen.

Background technique

Blue tongue disease (Bluetougue, BT) be it is a kind of by blue tongue rims (bluetongue virus, BTV) with Storehouse midge, she The insects such as mosquito are medium, the deadly infectious disease of severe infections ruminant, this main infringement ruminant livestock of virus, Ke Yiyin It sends out high fever, depression and oral cavity, nasal cavity and gastrointestinal tract mucosa and the symptoms such as ulcerative inflammation variation occurs, by International Animal Health Tissue (OIE) is defined as the infectious disease of statutory report, which has also been set to a kind of animal epidemic by the Ministry of Agriculture, China.Based on above-mentioned Pathogenic factor, it will thus be seen that substantial connection is distributed with insect vector in the generation and distribution of blue tongue disease, mainly breaks out in Storehouse midge A large amount of movable summer and autumn, the low-lying more water areas of humidity are especially more common in, and occur mainly in Perenniporia martius.Mesh Before, blue tongue disease brings serious threat to the aquaculture industry in the whole world, causes the great attention of world stakeholder.

Studies have shown that BTV belongs to arc reovirus virus section Orbivirus blue tongue virus subgroup, there are 27 kinds of serotypes, respectively Without cross protection between serotype.Up to the present, had 7 serotypes (BTV1, BTV2, BTV3, BTV4, BTV12, BTV15, BTV16) it is found in China.Wherein BTV1 and BTV16 is Chinese popular most wide.BTV genome about 19218bp, Molecular weight 1.3 × 10⁷, it is the maximum RNA virus of molecular mass, genome is the double-stranded RNA of 10 segments, wherein 4 small Segment (S7-S10), 3 middle segments (M4-M6), 3 large fragments (L1-L3), segment genome be separately encoded 3 it is non-structural Albumen (NS1-NS3), 7 structural proteins (VP1-VP7).

Complete BTV particle is in icosahedral symmetry structure, no cyst membrane.BTV has the double-deck protein coat, L2 and M5 base Because the VP2 and VP5 of coding are the main components for constituting BTV shell, what viral inner casing, that is, core capsid was mainly encoded by L3 and S7 Major structural protein VP3 and VP7 and secondary structure albumen VP1, VP4, VP6 are constituted, related with the duplication of BTV virus.BTV's Shell has the VP2 tripolymer protrusion of 60 similar triangular shapes, and outside penetrates egg around the spherical tripolymer of 120 VP5, i.e. film White, middle layer has 260 VP7 tripolymers to constitute, and internal layer includes the 120 VP3 monomers almost wrapped up by VP7 layers.

VP2 albumen encoded by L2 gene, contain 956 amino acid, about 110 kDa of size, be virus main type it is special Property antigen and hemagglutinin, combined with the virulence of virus, receptor, cell suction-operated and raise the related VP2 of main specific immunity It is related with the generation of neutralizing antibody, it is BTV serotype specific proteins；BTV has hemagglutinin, can be aggregated the O-shaped red of sheep and people Cell, hemagglutination activity is related with VP2, and hemagglutination-inhibition test can be used for BTV parting.And VP5 albumen can enhance neutralizing antibody It generates, therefore can be improved the effect of vaccine；VP3 and VP7 albumen is more conservative, BTV antigenic determinant is all had, in BTV The stabilization of portion's structure plays a significant role.

Currently, the vaccine of prevention and control blue tongue disease mainly has inactivated vaccine, attenuated vaccine, genetic engineering subunit vaccine etc.. Wherein, attenuated vaccine can stimulate body to generate powerful protective immune response, it is also possible to causing some side reactions: such as pregnant The phase be pregnent using meeting teratogenesis and miscarriage, reduces lactating mammal yield, generates viremia virusemia etc., while returning strong wind there is also virulence Danger.Genetic engineering subunit vaccine have the advantages that safety, it is cheap, be applicable to various serotype, have good application prospect, But current genetic engineering subunit vaccine is also in conceptual phase.And VP2 albumen is the main type specific antigen and blood clotting of BTV Fibroin is the major target of BTV subunit vaccine research, and therefore, there is an urgent need to largely prepare BTV in production and scientific research VP2 albumen.

Currently, the industrialized production of recombinant exogenous protein, it is desirable to be able to the engineering of high efficiency stable expression exogenous genes products Bacterium, and it is capable of the technology and technique of large-scale culture fermentation.However, in existing research engineering bacteria VP2 albumen table Barely satisfactory up to measuring, purifying and concentration need to expend a large amount of human and material resources, financial resources, it is difficult to reach industrialized production and application.Cause This, needs to develop a kind of VP2 protein fermentation technique that can increase substantially engineering bacteria yield, to shorten production week Phase, the production efficiency for reducing production cost, improving BTV VP2 albumen are the prevention and treatment of BTV and the research and development of novel subunit vaccine The Research foundation provided with production.

Summary of the invention

The application main purpose is that the solubility for providing a kind of viral (BTV1) VP2 albumen of 1 type of soluble blue glossopathy is former Nuclear expression preparation method, to establish certain technical foundation for related vaccines preparation.

Details are as follows for the technical solution that the application is taken.

1 type virus VP 2 protein gene coding sequence VP2U of blue tongue disease, by 2886bp base composition, specific base sequence is such as Shown in SEQ ID NO.1.

Utilize the BTV1 VP2 albumen pronucleus expression preparation side of the 1 type virus VP 2 protein gene coding sequence of blue tongue disease Method includes the following steps:

(1) PCR amplification

It is as follows to design PCR amplification VP2U gene order primer sequence:

VP2U-F:5 '-CGGGATCCATGGACGAGCTGGGTAT -3 ', (5 ' end " GGATCC " partial sequences are in sequence BamH I restriction enzyme site)

VP2U-R:5 '-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT -3 '；(5 ' ends " CTCGAG " are partially Xho in sequence I restriction enzyme site)

Using the recombinant plasmid pUC-VP2U containing 1 type virus VP 2 protein gene coding sequence VP2U of blue tongue disease as template, carry out PCR amplification, when PCR amplification, the design of 50 μ l reaction systems is as follows:

PrimeSTAR HS(Premix) enzyme, 25 μ l；

Upstream primer F, 1 μ l；

Downstream primer R, 1 μ l；

Template plasmid pUC-VP2U, 1 μ l；

Sterile deionized water, 22 μ l；

PCR reaction condition are as follows: 95 DEG C of 3 min of initial denaturation；94 DEG C of denaturation 30 s, 56 DEG C of annealing 30 s, 72 DEG C of 2 min of extension, altogether 30 circulations；72 DEG C of 10 min of extension；

To spare after pcr amplification product recycling, purification；

(2) digestion, and be attached with plasmid pET28

BamH I, Xho I double digestion are carried out to the pcr amplification product recycled in step (1), while plasmid pET28 is carried out BamH I, Xho I double digestion recycle target fragment；

The target fragment recycled is attached using T4 DNA ligase, 16 DEG C of connections are overnight；

(3) it converts, screen, obtain and recombinate correct recombinant plasmid pET28-VP2U

After the connection product Transformed E .coli competent cell DH5 α in step (2), resistance screening, and further progress are carried out Double digestion identification and sequencing identification, confirmation, which obtains, recombinates correct recombinant plasmid pET28-VP2U；

(4) conversion, inducing expression

Recombinant plasmid pET28-VP2U constructed in step (3) is converted into e. coli bl21 (DE3) competent cell, is obtained Express the E. coli expression strains pET28-VP2U-BL21 of BTV1 VP2 albumen；

It is further inoculated in culture medium, utilizes IPTG inducing expression BTV1 VP2 albumen；

After inducing expression, it is further centrifuged and is crushed thallus, supernatant is collected by centrifugation after resuspension, as contains BTV1 VP2 egg White supernatant, the antigen that further can be used as in vaccine preparation after purification are applied.

In step (4), the culture medium is the LB liquid medium containing 50 μ g/mL Kana+ or is that is mould containing card The basal fermentation medium of 50 μ g/mL of element；

The basal fermentation medium, component are as follows: 12g/L peptone, 24g/L yeast extract, 16.43g/L K₂HPO₄• 3H₂O, 2.31g/L KH₂PO₄, 5.04g/L glycerol.

In step (4), when IPTG inducing expression, the final concentration of 0.1 ~ 1.0mM of IPTG, inducing expression temperature is 20 DEG C ~ 37 DEG C, the inducing expression time is 6 ~ 12h.

In step (4), when purification operations, first by after 0.22 μm of membrane filtration of supernatant fluid, then with nickel affinity chromatography method into Row purifying.

In the prior art, when obtaining BTV1 VP2 albumen using genetic engineering, although there is more eukaryotic expression system to study And application, but in view of prokaryotic expression system lower production costs, be easy to the advantages that preparing of fermenting, therefore it is still necessary to regard to albumen The building of prokaryotic expression system is furtherd investigate.

In general, compared with prior art, major technique advantage is embodied in following aspects the application:

(1) present invention makes it be more suitable for the high efficiency in escherichia coli host by optimizing to BTV1 VP2 encoding gene Express target protein；And by optimization front and back BTV1 VP2 gene amalgamation and expression situation in Escherichia coli experimental analysis, BTV1 VP2 original gene is expressed in pET28a carrier almost without destination protein, and the BTV1 VP2 base after optimizing in the present invention Because the solubility in pET28a carrier is significantly increased, and this soluble destination protein there remains greater activity；

(2) present invention system optimization has been carried out to the expression condition of BTV1 VP2 albumen, especially to scale fermentation during Thallus fermentation density, fermentation condition have carried out preliminary optimization, (produce in the unit volume unit time to improve the specific production rate of product The yield of object) establish preliminary technical foundation.

Generally, the application is by the optimization to correlative coding gene, further by means of the technology of prokaryotic expression system Advantage has established certain technical foundation for fermentation preparation BTV1 VP2 albumen.Preliminary experimental results show in fermented liquid supernatant Destination protein expression quantity can reach 58.4 μ g/ml, this numerical value is apparently higher than destination protein BTV1 VP2 in other prokaryotic expressions Yield in system can establish good technical foundation for industrialized production.

Detailed description of the invention

Fig. 1 is the amplification of VP2 target gene；Wherein, M is DL15000 molecular weight marker；1 is (left to optimize preceding VP2 gene Figure)；2 be VP2 gene (right figure) after optimization；

Fig. 2 is the double digestion qualification figure of recombinant plasmid, wherein M is DL2000 molecular weight marker；1 is pET28a-VP2U plasmid；2 For pET28a-VP2U plasmid double enzyme digestion product；3 be pET28a-VP2 plasmid；4 be pET28a-VP2 plasmid double enzyme digestion product；

Fig. 3 is the SDS-PAGE qualification figure of recombinant VP 2 albumen inducing expression condition optimizing in Escherichia coli, wherein M is standard Albumen Marker；A is IPTG concentration optimization: 1-6 is respectively final concentration of: 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 The IPTG inducing expression result of mM, 1.0 mM；B is inducing temperature optimization: 1-2 is respectively 20 DEG C of inducing expression ultrasound supernatants and sinks It forms sediment；3-4 is respectively 25 DEG C of inducing expression ultrasound supernatants and precipitating；5-6 is respectively 30 DEG C of inducing expression ultrasound supernatants and precipitating；C Time-optimized for inducing expression: 1-4 is respectively destination protein expression after inducing expression 6h, 8h, 10h, 12h；

Fig. 4 is SDS-PAGE qualification figure of the recombinant VP 2 albumen in expression in escherichia coli, wherein M is standard protein Marker；1 For the recombinant VP 2 albumen ultrasound supernatant of VP2U gene expression；2 be the recombinant VP 2 albumen ultrasound precipitation of VP2U gene expression；3 are The recombinant VP 2 albumen ultrasound supernatant of original VP2 gene expression；4 be the recombinant VP 2 albumen ultrasound precipitation of original VP2 gene expression；

Fig. 5 is SDS-PAGE and Western-Blot qualification figure (the left figure SDS-PAGE of recombinant VP 2 albumen after purification；Right figure It is standard protein Marker for Western-Blot), M；1 is non-induction bacterium negative control；2 be the VP2 albumen of purifying；

Fig. 6 is BTV1 inactivation of viruses SDS-PAGE qualification result, wherein M is standard protein Marker；1 is the BTV1 after concentration Inactivation of viruses.

Fig. 7 is DOT-ELISA qualification result, wherein 1 is BTV1 inactivation of viruses；2 be the VP2 albumen of purifying；3 be not lure Lead bacterium negative control.

Specific embodiment

Explanation is further explained to the application below with reference to embodiment.Before introducing specific embodiment, with regard to following realities It applies Experimental Background situation in part in example and briefly introduces and be described as follows.

Biomaterial:

PET-28a plasmid, Novagen(Merck, Germany) Products；

Identify the BTV1 inactivation of viruses used, research institute give by Yunnan provincial animal husbandry and veterinary；

Major experimental reagent:

High-fidelity thermal starting PrimeSTAR HS(Premix in PCR amplification) enzyme, TaKaLa Products；

Restriction enzyme BamHI, Xho I, NEB(New England Biolabs, Inc.) Products；

Other situations:

Instrument and equipment involved in following embodiments is routine instrument device unless otherwise instructed；

Related reagent is commercially available conventional reagent unless otherwise instructed；

Related test method is unless otherwise instructed conventional method, with reference to " molecular cloning: laboratory manual " (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in is operated.

Embodiment 1

It should be noted that existing BTV1 VP2 gene order is limited to genome of E.coli sequence when carrying out prokaryotic expression Column and virus gene sequence otherness, cause VP2 albumen obtained by practical expression mostly to exist with inclusion bodies, therefore cause table Lower up to efficiency, to overcome this defect, inventor carries out existing BTV1 VP2 gene (GenBank:JX101695.1) sequence Detailed bioinformatic analysis, all uses the highest codon of frequency of use to its all amino acid, passes through simultaneously The secondary structure for optimizing its mRNA, in conjunction with restriction enzyme site during the amendment and the subsequent expression of cooperation to optimal codon frequency Evade, thus design obtain a completely new BTV1 VP2 DNA sequence dna, sequence 2886bp, such as SEQ ID Shown in NO.1.

After further transferring to Sangon Biotech (Shanghai) Co., Ltd. to synthesize designed gene order, it is transformed into Enter in pUC57 plasmid, in case subsequent experimental application, this recombinant plasmid name are as follows: pUC-VP2U.

The BTV1 VP2 gene order (VP2U) optimized, specific base sequence are as follows:

ATGGACGAGCTGGGTATCCCAATCTACAAGCAAGGATTCCCTGAGCACCTGCTGCACGGCTACGAGTTCACT ATTGACAGCTCTACCAAGATCCAGTCAGTTGGCGGTCGTCACGACGTGACTAAGCTGCCCGAAATGAACGCCTACG ACATCAAGGCTGAATCCATCCGCACCGCCCTGTGGTACAACCCTGTTCGTAACGACGGTTTCGTCCTGCCTCGTGT CCTCGACATCACCCTGCGCGGATACGACGGAAAGCGTGCCGTGATCGACTCCAGCAAGCACAAGATCTTCCACACT GACGAGAGGTGGGTCCAGTGGATGATGAAGGACTCAATGGACGCTCAACCCCTCAAGGTCGGCCTGGACGACCGCA CACAAAAGATCGCTCACTCATTGCACAATTGTGTTGTGAAGATCGACTCTAAGAAGGCTGACACCATGTCTTACCA CGTGGAACCTATCGAAGACCCCAGTAAGGGCTGTCTCCACACCCGTGCCATGCTGTGGAACCACCTGGTTCGCATC GAAATGTCCCACGCCGCCCAAGAAATCGCTTACACACTGAAGCCTACCTACGACATCGTCGTCCACGCTGAACGCC GTGACAGGTCACAACCCTTCCAGCCTGGAGACCAGACCCTGATCAACTTCGGTCGCGGTCAGAAGGTTCAGATGAA CCACAACAGCTACGAGAAGATGGTTGAAGGCCTGGCTCACCTCGTGATCCGCGGAAAGACTCCTGAGCTGATCCGT GACGAAATCGCTAAGCTCGACGAGATCTGCAATCGCTGGATCAGGTCCCGTCACGACCCTGGTGAAATCAAGGCCT ACGAACTCTGCAAAATCCTCTCCACAGTTGGACGTAAGATGCTCGACCAGGAAAAGGAACCAGCTGACGAAGCCTC TTTGAGCATCCGTTTCCAAGAAGCTATCGACAACAAGTTCCGCCAGCATGACCCTGAACGCCTGAAAATCTTTGAG CACCGTAACCAGCGCCGTGATGAGGACAGGTTCTACATCCTCCTGATGATCGCTGCCTCTGACACATTCAACACTC GCGTCTGGTGGTCCAACCCATACCCCTGTCTGCGTGGAACCCTGATGGCTTCTGAAACCAAGCTGGGTGACGTGTA TTCTATGATGCGCAGCTGGTACGACTGGTCTGTTCGTCCTACATACACTCCCCACGAAAAGAGCAGAGAGCAGGAA AAGTACATCTACGGACGCGTGAACCTGTTCGACTACGTCGCCGAACCAGGCACAAAGATCATCCATTGGGAATACA AGTTGAACCAGCAAACAAAAGACATCACATACGAGCAGGGTAACCCATGCGACCTGTTCCCCGACGACGACGAAGC CATCATCACTAAGTTCGATGACGTCGCTTACGGACAGATGGTTTCCGACCTGATCAACGGCGGATGGGATCAGGAG AGGTTCAAGATGCACAAGATCCTCAAGAGCCAGGGCAACGTGCTGACCATCGATTTCGAAAAGGACGCTAAGCTGA CAAGTAACGAAGGCGTTACAATGCCAGAATACTTCGACAAGTGGATCATCGCCCCAATGTTCAACGCTAAGTTGCG CATCAAGCACAGCGAGATCGCCCAAAGAAGAGACGACGATCCTATGGTTAAGAGAACACTCAGCCCTATCGCTTTC GACCCTATCGTCCTCCAACGTCTCACTCTCGCTCGTTACTACGACATCAGGCCCGCTATCATGGGTCAGGCCCTGT CACGTCAACAAGGCCAGTCTACTTACGATGAGGAGGTCTCCAAGATCGAAGGATACGCTGAGATCCTCCAGCGTCG TGGAATCGTGCAAATCCCTAAGAAGCCATGCCCCACTGTCACCGCTCAGTACACACTGGAACGCTACGCCCTCTTC CTGATCAACATCTTGGAGCAGCACGTGATCCGCTCCACCGATGAGGATGTCATCTACAGCCACCCTCGTGTGGACC ACAAGCTGGAAATCTACGGTGAATCCATCGTTGACATCTCCCAGATCGTGATCTTCGTGTTCGACTTTTTGTTCGA GCGTAGGCGCACCGTCCGCGGCGTGTACGAGTCCCGTTACATGGTGACCCGTATCCGCGACGCCCAGGGCCAGAAC AGGATCAACGTCATCACTGAGTTCTTCCCAACTTTCGGCTACTACCTGAACCGTATCAAGGAGGCCACCATCATGC AGGAAATCATGTACCTGAATTTCCTGCCCTTGTTCTTCCTGGTTAGCGACAACATCATGTACACCCATAAGCAATG GTCAGTCCCACTGCTGCTGTACGCTCACGAACTGAAGGTCATCCCTCTGGAGGTGGGTTCATACAATGACCGCTGT GGCCTGATTTCATACGTTGAGTACATGGTGTTCTTCCCCTCTAAGGCTTTCAGGACAAGCAAGTTGGACGAAGTGC AGCCTAAGATCGCTAGGGAGATGCTCAAATACTACACCAACACAAAGATCTTCGAAGGTGGTATCAACCTGAACGT GATCACCACTAAGCAGCTCCTGTACGAGACATACCTGGCTTCCCTGTGCGGTGGACTCTCTGATGGAATCGTGTGG TACCTCCCTATTACACACCCATCTAAGTGTCTGGTCGCCGTTGAGGTCTCCGATGAGAGGGTGCCAGCTTCCATCC GCGCCAGTCGCATCAAGCTGCGCTTCCCTCTGAGCGTTAAGCACCTGAAGGGTATCGTTGTGATCCAAATCGACGA AGAAGGCAAGTTCACAGTTTACTCCGAGGGAATCGTTAGCCACCGTATCTGTAAGAAGAACCTGCTGAAGTACATG TGTGACATCGTCCTGCTCAAGTTCTCCGGCCACGTGTTCGGAAACGACGAGATGCTGACTAAGCTCCTCAACGTTT AA。

Embodiment 2

On that basis of example 1, the VP2U recombination after optimization is transferred to matter further using plasmid pET28 as carrier by inventor Recombinant plasmid expression vector pET28-VP2U is constructed in grain pET28, consequently facilitating subsequent prokaryotic expression, specific recombinant plasmid The building process of expression vector pET28-VP2U is briefly discussed below.

It should be noted that for convenient for proving expression effect after the optimization of the application gene order, with existing BTV1 VP2 base Because (GenBank:JX101695.1) is as control, inventor equally entrusts Sangon Biotech (Shanghai) Co., Ltd.) limited liability company Recombinant plasmid name has been synthetically prepared it are as follows: pUC-VP2.On this basis, inventor is equally prepared for recombinant plasmid expression vector PET28-VP2 is using as control.

(1) PCR amplification

VP2U gene order after PCR amplification optimization (primer synthesizes offer by Sangon Biotech (Shanghai) Co., Ltd.) When, primer sequence design is as follows:

VP2U-F:5 '-CGGGATCCATGGACGAGCTGGGTAT -3 ', (5 ' end " GGATCC " partial sequences are in sequence BamH I restriction enzyme site)

VP2U-R:5 '-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT -3 '；(5 ' ends " CTCGAG " are partially Xho in sequence I restriction enzyme site)

When PCR amplification VP2 gene order (primer synthesizes offer by Sangon Biotech (Shanghai) Co., Ltd.), primer sequence Column design is as follows:

(5 ' end " GGATCC " partial sequences are BamH to VP2-F:5 '-CGGGATCCATGGATGAGTTAGGCATA -3 ' in sequence I restriction enzyme site)

(5 ' ends " CTCGAG " are partially VP2-R:5 '-CCGCTCGAGTCATACGTTGAGAAGTTTTGTTA -3 ' in sequence Xho I restriction enzyme site)

Using pUC-VP2U plasmid or pUC-VP2 as template, PCR amplification is carried out, when PCR amplification, the design of 50 μ l reaction systems is as follows:

PrimeSTAR HS(Premix) enzyme, 25 μ l；

Upstream primer F, 1 μ l；

Downstream primer R, 1 μ l；

Template plasmid pUC-VP2U or pUC-VP2 plasmid, 1 μ l；

Sterile deionized water, 22 μ l；

PCR reaction condition are as follows: 95 DEG C of 3 min of initial denaturation；94 DEG C of denaturation 30 s, 56 DEG C of annealing 30 s, 72 DEG C of 2 min of extension, altogether 30 circulations；72 DEG C of 10 min of extension.

The detection of 1% agarose gel electrophoresis of mass fraction is carried out to pcr amplification product, as a result as shown in Figure 1.Analysis can be with Find out, the pcr amplification product size of optimization front and back gene is each about 2893 bp, is consistent with expection, it was demonstrated that overall length has successfully been obtained The forward and backward BTV1 VP2 gene of codon optimization.

Further to spare after pcr amplification product recycling, purification.

(2) digestion, and be attached with plasmid pET28

To recycled in step (1) pcr amplification product (former BTV1 VP2 gene or optimization after BTV1 VP2U gene) into Row BamH I, Xho I double digestion, while BamH I, Xho I double digestion are carried out to plasmid pET28, then be utilized respectively DNA recycling Kit recycles target fragment；

The target fragment recycled is attached using T4 DNA ligase, 16 DEG C of connections are overnight.

(3) it converts, screen, obtain and recombinate correct recombinant plasmid I (pET28-VP2U) and recombinant plasmid I I(pET28- VP2)

After the connection product Transformed E .coli competent cell DH5 α in step (2), resistance screening, further picking are carried out After monoclonal is cultivated, extracts positive bacterium colony plasmid and carry out double digestion identification.

Qualification result is as shown in Figure 2.Analysis is as can be seen that double digestion post-fragment size and VP2 and VP2U target gene are big It is small to be consistent, illustrate that recombinant vector successfully constructs.

Further, the plasmid of the double digestion positive is sent to Sheng Gong bioengineering Co., Ltd and carries out sequencing identification, it is ensured that It obtains and constructs correct recombinant plasmid I (pET28-VP2U) and recombinant plasmid I I(pET28-VP2).

And to containing constructing correct recombinant plasmid I (pET28-VP2U) and recombinant plasmid I I(pET28-VP2) large intestine After bacillus further cultivates amplification, extracts construct correct recombinant plasmid I (pET28-VP2U) and recombinant plasmid I I respectively (pET28-VP2), in case further converting and expressing VP2 albumen.

Embodiment 3

On the basis of embodiment 2, inventor is by constructed recombinant plasmid I (pET28-VP2U) and recombinant plasmid I I(pET28- VP2 e. coli bl21 (DE3) competent cell) is converted respectively, obtains the Escherichia coli table of expression BTV1 VP2 albumen respectively Up to bacterial strain pET28-VP2U-BL21 and pET28-VP2-BL21, preliminary expression verifying is then carried out, specific experiment process is brief It is described below.

(1) strain culturing and inducing expression

E. coli expression strains pET28-VP2U-BL21 and pET28-VP2-BL21 are inoculated in containing 50 μ g/mL respectively It cultivates in the LB liquid medium of Kana+ to OD₆₀₀When value about 0.8, IPTG to final concentration of 0.3mM is added, then in 25 DEG C Inducing expression 10h.

(2) protein purification and identification

Bacterium solution 5 mL, 12000r/min after taking inducing expression are centrifuged 10min, discard supernatant, collect thallus；

After thallus is resuspended with 1mL PBS, (the ultrasonication time is 10min, ultrasonic 3s, interval 3s, and power is for ultrasonication 45w)；

12000 r/min are centrifuged 15 min and isolate supernatant precipitating, are identified respectively with SDS-PAGE.

Qualification result is as shown in Figure 3.It can be seen from the figure that pET28-VP2U-BL21 expresses bacterium after codon optimization There is the expression of BTV1 VP2 recombinant protein in strain at about 120kDa, and amount of soluble expression is high, and not optimized pET28-VP2- BL21 is expressed in bacterial strain and is just expressed without BTV1 VP2 recombinant protein；It is solvable to illustrate that codon optimization has been obviously improved recombinant protein Property expression quantity it is high.

(3) inducing expression condition optimizing

On above-mentioned experiment basis, induced for inducer IPTG concentration, inducing expression time, inducing temperature etc. in step (1) Expression condition is advanced optimized.Specific experiment process and result are briefly discussed below.

(1) IPTG concentration optimization: strain 1:100 will be activated overnight and be inoculated in the LB liquid training containing 50 μ g/mL Kana+ It supports in base and cultivates to OD₆₀₀When value about 0.8, it is separately added into final concentration of: 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 The IPTG of mM, 1.0 mM, identify destination protein expression through SDS-PAGE by 30 DEG C, collect thallus after inducing expression 8h；As a result It was found that IPTG concentration is little (Fig. 3 A) to the general impacts of destination protein expression quantity, but for practical operation angle, due to 0.2 MM dosage easier to control, thus it is subsequent using 0.2 mM as using concentration；

(2) inducing expression temperature optimization: strain 1:100 will be activated overnight and be inoculated in the LB liquid training containing 50 μ g/mL Kana+ It supports in base and cultivates to OD₆₀₀When value about 0.8, the IPTG of final concentration of 0.2 mM is added, is lured respectively at 20 DEG C, 25 DEG C, 37 DEG C Thallus is collected after leading expression 10h, identifies destination protein expression through SDS-PAGE after ultrasonication；As a result, it has been found that mesh at 20 DEG C Solubility expression of protein amount highest (Fig. 3 B)；

(3) inducing expression is time-optimized: will be activated overnight strain 1:100 and be inoculated in the LB liquid training containing 50 μ g/mL Kana+ It supports in base and cultivates to OD₆₀₀When value about 0.8, the IPTG of final concentration of 0.2 mM is added, in 20 DEG C of difference inducing expression 6h, Thallus is collected after 8h, 10h, 12h, SDS-PAGE identifies destination protein expression；As a result, it has been found that purpose egg when inducing expression 10h White amount of soluble expression highest (Fig. 3 C).

To sum up the experimental results showed that, the more excellent expression of recombinant protein and operating condition are as follows: IPTG concentration be 0.2mM, induction temperature Destination protein expression quantity highest (Fig. 4) when 20 DEG C of degree, 10 h of induction.

Embodiment 4

On the basis of embodiment 4, inventor further utilize constructed E. coli expression strains pET28-VP2U-BL21 into Small-scale fermented and cultured of having gone is tested, and to investigate its practical situations, specific experiment process is described as follows.

(1) bacterial strain activates

By -80 DEG C of glycerol tubes save genetically engineered E.coli pET28-VP2U-BL21 bacterial strain containing 50 μ g/mL cards that The LB solid culture primary surface streak inoculation of mycin, is then inverted overnight incubation in 37 DEG C of constant incubators for plate；

Second day, the strain after activation is inoculated into seed culture medium (the Kana+/LB fluid nutrient medium, wherein it is mould to block that of 50mL Plain concentration be 50 μ g/mL) in, 37 DEG C shaken cultivation 14 hours, in this, as seed liquor.

It is to be understood that E. coli expression strains pET28-VP2U-BL21 is after converting successfully in the present embodiment It convenient for saving, therefore uses -80 DEG C of glycerol tubes and saves, in practical application, after converting successfully, can directly be inoculated in seed Fermentation preparation seed liquor, is first activated without being inoculated in LB solid medium in culture medium.

(2) fermented and cultured

In fermentor, 5L basal fermentation medium, 121 DEG C of sterilizing 20min are cooled to 35 DEG C, adjust pH=6.8, inoculation step (1) prepared seed liquor 50mL(inoculative proportion, 1:100 in), it should be noted that before inoculation, in basal fermentation medium Kanamycins to concentration is 50 μ g/mL after sterilizing is added；

Maximal ventilatory volume is 50%, and ventilatory capacity range is 100~150VVM；Maximum speed of agitator is 50%, speed of agitator 150~ 300r/min, 37 DEG C are cultivated 3 hours or so.

The basal fermentation medium, component are as follows: 12g/L peptone, 24g/L yeast extract, 16.43g/L K₂HPO₄• 3H₂O, 2.31g/L KH₂PO₄, 5.04g/L glycerol.

(3) inducible protein is expressed

OD to fermentation liquid in step (2)₆₀₀When for 7.0-8.0 or so (at 37 DEG C culture 3 hours or so), by fermentation liquid temperature Degree is down to 20 DEG C, and the inducer IPTG of final concentration of 0.2mmol/L is added, and continues the induction table that fermentation carries out destination protein for 24 hours It reaches；

In fermentation process, by ventilation and stirring operation, dissolved oxygen amount is controlled between 20~30%.

(4) protein extraction and purifying

To after fermentation, 8000r/min is centrifuged 20min and collects thallus, thallus after inducing expression then is resuspended with PBS, then high It crushes broken or ultrasonication, and further 12000r/min is centrifuged 15min, takes supernatant of bacteria solution, after 0.22 μm of membrane filtration, use nickel Affinity chromatography is purified.

When specific nickel affinity chromatography method carries out purification process, it can refer to following steps and operated: first using equilibrium liquid (50mMTris-HCl, 300mM NaCl, 10mM imidazoles) balance；Again with cleaning solution (50mM Tris-HCl, 300mM NaCl, 40mM imidazoles) elution foreign protein；Finally purpose is eluted with eluent (50mM Tris-HCl, 300mM NaCl, 250mM imidazoles) Albumen.

It should be noted that measurement result shows that thallus is dry in fermentation liquid after fermentation by taking certain more excellent experiment as an example Weight is up to 126.5g/L, and dry cell weight accounting reaches 12.65% after centrifugation, this result shows that, fermentation is adjusted, ferment effect is Preferably, preferable fermentation basis can be established for the preparation of practical albumen.

And albumen after purification is identified, as a result as shown in Figure 5.It can be seen that SDS-PAGE and Western Blot As a result show that recombinant protein purification effect is preferable, analysis shows, VP2 purity is about 80%.

(5) the expression contents measurement of BTV1 VP2 recombinant protein

On the basis of the purifying protein obtained by step (3), using BCA determination of protein concentration kit, using ELISA sandwich method, hair Bright people is further determined the expression quantity situation of BTV1 VP2 recombinant protein in fermentation liquid, and specific continuous mode brief introduction is such as Under.

Firstly, being diluted to a series of concentration with the purifying destination protein stoste for having measured concentration, specifically have: 2 μ g/mL, 1 μ g/mL, 0.5 μ g/mL, 0.25 μ g/mL, 0.125 μ g/mL are detected in this, as normal concentration by ELISA, and concentration is used It is ordinate, corresponding OD₄₅₀Detected value does abscissa, establishes standard linear regression equation.

Secondly, a series of multiples are diluted to by supernatant of bacteria solution is broken after fermentation, specifically: 50,100,200,400 times.

Finally, the OD measured to supernatant of bacteria solution broken after fermentation₄₅₀Value acquires corresponding concentration by standard linear regression equation (unit is μ g/mL) is ferment broken supernatant of bacteria solution destination protein concentration multiplied by extension rate (unit is μ g/mL).

Since broken bacterium solution is by thallus weight in wet base: broken bacterium buffer=1:10 is prepared, so the destination protein of fermentation thalli Expression quantity (unit is μ g/g thallus) are as follows: 10 × broken supernatant of bacteria solution destination protein concentration of fermenting (unit is μ g/mL), multiplied by hair Zymotic fluid cell density (unit is g thallus/L fermentation liquid), then for fermentation purpose expressing quantity concentration, (unit is μ g/L fermentation Liquid).Specific formula is as follows:

Broken supernatant of bacteria solution destination protein concentration (the μ g/mL)=extension rate × standard destination protein concentration (μ g/mL) of fermentation × OD₄₅₀(broken supernatant of bacteria solution of fermenting)/OD₄₅₀(standard destination protein concentration)；

Supernatant of bacteria solution destination protein concentration (μ g/mL) is broken in fermentation purpose expressing quantity concentration (μ g/L fermentation liquid)=10 × fermentation × fermentation liquid cell density (g thallus/L fermentation liquid).

BTV1 VP2 fermentation expression result in different batches fermentation liquid is measured, as a result as shown in the table:

。

From upper table result can be seen that the present invention by the optimization to BTV1 VP2 protein gene expression sequence, can not only Enough in expression in escherichia coli BTV1 VP2 albumen, and amount of soluble expression is higher, can satisfy the requirement of industrialized production.

(6) BTV1 VP2 recombinant protein activity identification

For the availability for determining BTV1 VP2 albumen prepared by the application, inventor further carries out Testing and appraisal to its activity, Specific experiment process is briefly discussed below.

(1) inactivation of viruses BTV1 hyper-immune serum is prepared

By (the SDS-PAGE qualification result of concentration restrovirus is as shown in Figure 6) after the concentration of BTV1 inactivation of viruses, it is complete that Freund is added Immunogene is made in adjuvant emulsion, and by the method for dorsal sc multi-point injection, female BAl BIc/c mouse 3 of 4~8 week old is immunized Only, 50 μ of immunizing dose l/；

BALB/c mouse is carried out with dosage in the same way after being emulsified every 3 weeks with incomplete Freund's adjuvant and immunizing antigen Booster immunization is immunized 3 times altogether, finally obtains hyper-immune serum.

(2) BTV1 VP2 protein active measures

Determination of activity, concrete operations are carried out using DOT ELISA method are as follows:

Strip NC film is soaked completely in phosphate buffer (PBS), room temperature is dried；

The BTV1 VP2 protein site for taking 1 μ l to purify is on NC film, then the albumen for taking 1 μ l inactivation BTV1 virus and 1 μ l not to induce Respectively as positive control and negative control, using the diluted positive serum of 1:500 as primary antibody, the diluted HRP label of 1:5000 Sheep anti mouse as secondary antibody, AEC colour developing.

Experimental result (result is as shown in Figure 7) shows that the BTV1 VP2 albumen obtained through prokaryotic expression system can be with BTV1 disease Specific reaction occurs for the immune mice serum of poison, illustrates that BTV1 VP2 albumen has sound response originality, can be used for into one Walk vaccine preparation application.

SEQUENCE LISTING

<110>Zhengzhou University

Henan Zhong Ze bioengineering Co., Ltd

<120>a kind of prokaryotic expression preparation method of BTV1 VP2 albumen

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 2886

<212> DNA

<213> bluetongue virus

<400> 1

atggacgagc tgggtatccc aatctacaag caaggattcc ctgagcacct gctgcacggc 60

tacgagttca ctattgacag ctctaccaag atccagtcag ttggcggtcg tcacgacgtg 120

actaagctgc ccgaaatgaa cgcctacgac atcaaggctg aatccatccg caccgccctg 180

tggtacaacc ctgttcgtaa cgacggtttc gtcctgcctc gtgtcctcga catcaccctg 240

cgcggatacg acggaaagcg tgccgtgatc gactccagca agcacaagat cttccacact 300

gacgagaggt gggtccagtg gatgatgaag gactcaatgg acgctcaacc cctcaaggtc 360

ggcctggacg accgcacaca aaagatcgct cactcattgc acaattgtgt tgtgaagatc 420

gactctaaga aggctgacac catgtcttac cacgtggaac ctatcgaaga ccccagtaag 480

ggctgtctcc acacccgtgc catgctgtgg aaccacctgg ttcgcatcga aatgtcccac 540

gccgcccaag aaatcgctta cacactgaag cctacctacg acatcgtcgt ccacgctgaa 600

cgccgtgaca ggtcacaacc cttccagcct ggagaccaga ccctgatcaa cttcggtcgc 660

ggtcagaagg ttcagatgaa ccacaacagc tacgagaaga tggttgaagg cctggctcac 720

ctcgtgatcc gcggaaagac tcctgagctg atccgtgacg aaatcgctaa gctcgacgag 780

atctgcaatc gctggatcag gtcccgtcac gaccctggtg aaatcaaggc ctacgaactc 840

tgcaaaatcc tctccacagt tggacgtaag atgctcgacc aggaaaagga accagctgac 900

gaagcctctt tgagcatccg tttccaagaa gctatcgaca acaagttccg ccagcatgac 960

cctgaacgcc tgaaaatctt tgagcaccgt aaccagcgcc gtgatgagga caggttctac 1020

atcctcctga tgatcgctgc ctctgacaca ttcaacactc gcgtctggtg gtccaaccca 1080

tacccctgtc tgcgtggaac cctgatggct tctgaaacca agctgggtga cgtgtattct 1140

atgatgcgca gctggtacga ctggtctgtt cgtcctacat acactcccca cgaaaagagc 1200

agagagcagg aaaagtacat ctacggacgc gtgaacctgt tcgactacgt cgccgaacca 1260

ggcacaaaga tcatccattg ggaatacaag ttgaaccagc aaacaaaaga catcacatac 1320

gagcagggta acccatgcga cctgttcccc gacgacgacg aagccatcat cactaagttc 1380

gatgacgtcg cttacggaca gatggtttcc gacctgatca acggcggatg ggatcaggag 1440

aggttcaaga tgcacaagat cctcaagagc cagggcaacg tgctgaccat cgatttcgaa 1500

aaggacgcta agctgacaag taacgaaggc gttacaatgc cagaatactt cgacaagtgg 1560

atcatcgccc caatgttcaa cgctaagttg cgcatcaagc acagcgagat cgcccaaaga 1620

agagacgacg atcctatggt taagagaaca ctcagcccta tcgctttcga ccctatcgtc 1680

ctccaacgtc tcactctcgc tcgttactac gacatcaggc ccgctatcat gggtcaggcc 1740

ctgtcacgtc aacaaggcca gtctacttac gatgaggagg tctccaagat cgaaggatac 1800

gctgagatcc tccagcgtcg tggaatcgtg caaatcccta agaagccatg ccccactgtc 1860

accgctcagt acacactgga acgctacgcc ctcttcctga tcaacatctt ggagcagcac 1920

gtgatccgct ccaccgatga ggatgtcatc tacagccacc ctcgtgtgga ccacaagctg 1980

gaaatctacg gtgaatccat cgttgacatc tcccagatcg tgatcttcgt gttcgacttt 2040

ttgttcgagc gtaggcgcac cgtccgcggc gtgtacgagt cccgttacat ggtgacccgt 2100

atccgcgacg cccagggcca gaacaggatc aacgtcatca ctgagttctt cccaactttc 2160

ggctactacc tgaaccgtat caaggaggcc accatcatgc aggaaatcat gtacctgaat 2220

ttcctgccct tgttcttcct ggttagcgac aacatcatgt acacccataa gcaatggtca 2280

gtcccactgc tgctgtacgc tcacgaactg aaggtcatcc ctctggaggt gggttcatac 2340

aatgaccgct gtggcctgat ttcatacgtt gagtacatgg tgttcttccc ctctaaggct 2400

ttcaggacaa gcaagttgga cgaagtgcag cctaagatcg ctagggagat gctcaaatac 2460

tacaccaaca caaagatctt cgaaggtggt atcaacctga acgtgatcac cactaagcag 2520

ctcctgtacg agacatacct ggcttccctg tgcggtggac tctctgatgg aatcgtgtgg 2580

tacctcccta ttacacaccc atctaagtgt ctggtcgccg ttgaggtctc cgatgagagg 2640

gtgccagctt ccatccgcgc cagtcgcatc aagctgcgct tccctctgag cgttaagcac 2700

ctgaagggta tcgttgtgat ccaaatcgac gaagaaggca agttcacagt ttactccgag 2760

ggaatcgtta gccaccgtat ctgtaagaag aacctgctga agtacatgtg tgacatcgtc 2820

ctgctcaagt tctccggcca cgtgttcgga aacgacgaga tgctgactaa gctcctcaac 2880

gtttaa 2886

Claims (7)

1. 1 type virus VP 2 protein gene coding sequence VP2U of blue tongue disease, which is characterized in that sequence VP2U is by 2886bp base group At specific base sequence is as shown in SEQ ID NO.1.

2. utilizing the BTV1 VP2 albumen pronucleus expression preparation method of coded sequence VP2U described in claim 1, which is characterized in that Include the following steps:

(1) PCR amplification

It is as follows to design PCR amplification VP2U gene order primer sequence:

VP2U-F:5 '-CGGGATCCATGGACGAGCTGGGTAT -3 ',

VP2U-R:5 '-CCGCTCGAGTTAAACGTTGAGGAGCTTAGT -3 '；

Using the recombinant plasmid pUC-VP2U containing 1 type virus VP 2 protein gene coding sequence VP2U of blue tongue disease as template, carry out PCR amplification；To spare after pcr amplification product recycling, purification；

(2) digestion, and be attached with plasmid pET28

BamH I, Xho I double digestion are carried out to the pcr amplification product recycled in step (1), while plasmid pET28 is carried out BamH I, Xho I double digestion recycle target fragment；

The target fragment recycled is attached using T4 DNA ligase；

(3) it converts, screen, obtain and recombinate correct recombinant plasmid pET28-VP2U

After the connection product Transformed E .coli competent cell DH5 α in step (2), resistance screening, and further progress are carried out Double digestion identification and sequencing identification, confirmation, which obtains, recombinates correct recombinant plasmid pET28-VP2U；

(4) conversion, inducing expression

Recombinant plasmid pET28-VP2U constructed in step (3) is converted into e. coli bl21 competent cell, is expressed The E. coli expression strains pET28-VP2U-BL21 of BTV1 VP2 albumen；

It is further inoculated in culture medium, utilizes IPTG inducing expression BTV1 VP2 albumen；

After inducing expression, it is further centrifuged and is crushed thallus, supernatant is collected by centrifugation after resuspension, as contains BTV1 VP2 egg White supernatant.

3. BTV1 VP2 albumen pronucleus expression preparation method as claimed in claim 2, which is characterized in that in step (1), PCR expands When increasing, the design of 50 μ l reaction systems is as follows:

PrimeSTAR HS Premix enzyme, 25 μ l；

Upstream primer F, 1 μ l；

Downstream primer R, 1 μ l；

Template plasmid pUC-VP2U, 1 μ l；

Sterile deionized water, 22 μ l；

PCR reaction condition are as follows: 95 DEG C of 3 min of initial denaturation；94 DEG C of denaturation 30 s, 56 DEG C of annealing 30 s, 72 DEG C of 2 min of extension, altogether 30 circulations；72 DEG C of 10 min of extension.

4. BTV1 VP2 albumen pronucleus expression preparation method as claimed in claim 2, which is characterized in that in step (4), the training Support the basal fermentation culture that base is the LB liquid medium containing 50 μ g/mL Kana+ or is 50 μ g/mL containing kanamycin Base；

The basal fermentation medium, component are as follows: 12g/L peptone, 24g/L yeast extract, 16.43g/L K₂HPO₄• 3H₂O, 2.31g/L KH₂PO₄, 5.04g/L glycerol.

5. BTV1 VP2 albumen pronucleus expression preparation method as claimed in claim 2, which is characterized in that in step (4), IPTG is lured When leading expression, the final concentration of 0.1 ~ 1.0mM of IPTG, inducing expression temperature is 20 DEG C ~ 37 DEG C, and the inducing expression time is 6 ~ 12h.

6. BTV1 VP2 albumen pronucleus expression preparation method as claimed in claim 5, which is characterized in that in step (4), IPTG is lured When leading expression, the final concentration of 0.2mM of IPTG, inducing expression temperature is 20 DEG C, and the inducing expression time is 10h.

7. BTV1 VP2 albumen pronucleus expression preparation method as claimed in claim 2, which is characterized in that in step (4), to containing When the supernatant purification operations of BTV1 VP2 albumen, first by after 0.22 μm of membrane filtration of supernatant fluid, then with nickel affinity chromatography method It is purified.