CN104285758A - Night mechanical aerobic irrigation method for super rice - Google Patents
Night mechanical aerobic irrigation method for super rice Download PDFInfo
- Publication number
- CN104285758A CN104285758A CN201410508097.7A CN201410508097A CN104285758A CN 104285758 A CN104285758 A CN 104285758A CN 201410508097 A CN201410508097 A CN 201410508097A CN 104285758 A CN104285758 A CN 104285758A
- Authority
- CN
- China
- Prior art keywords
- group
- super hybridization
- hybridization rice
- oxygenation
- soil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G22/00—Cultivation of specific crops or plants not otherwise provided for
- A01G22/20—Cereals
- A01G22/22—Rice
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
Abstract
The invention discloses a night mechanical aerobic irrigation method for super rice. In the whole growth period of super rice, air is added to rhizosphere soil of the rice at night. According to the method, the population diversity of rhizosphere microorganisms of the soil is prompted in the heading period, and the yield of the rice is remarkably increased.
Description
Technical field
The present invention relates to a kind of crop irrigation method, especially a kind of super hybridization rice mechanical enhancement at night irrigation method.
Background technology
Super hybridization rice, i.e. super high-yielding rice kind, under the background that at home and abroad grain security pressure increases day by day, are the key projects of many countries and research unit's research in recent decades.In Japan, have scientist just to start to carry out the breeding research of Super High Yielding Rice in early 1980s, volume increase target strives, within 10 to 15 years, the per mu yield of paddy rice is improved 50%.International Rice Research Institute starts the Breeding program of " super hybridization rice " too in late 1980s, strives for that the rice varieties per mu yield of cultivating at the beginning of 21 century also will increase production 20% ~ 25% than the highest existing kind, but all not yet has large breakthrough at present.China just starts the Breeding program of the super hybridization rice starting oneself in the mid-90 in 20th century, through the scientific research of many scientist's more than ten years, on September 24th, 2012, the per mu yield of the super hybridized rice third phase establishing in large scale presided over by China scientist Academician YUAN Long-ping has broken through 900 kilograms, is in world lead level.Paddy rice is as the main cereal crops of China, account for 1/4th of China's total area under cultivation, the output of paddy rice accounts for 38% of national crop yield, the sowing area of China paddy rice in 2013 is more than 30,000,000 hectares, improve the quality and yield of paddy rice, to raising China's farmers' income and grain security significant, there is wide plantation prospect and social economic value.
The increasing yield and improving quality of current super hybridization rice, mainly from the viewpoint of selecting fine quality, adopting the cultivation method of science, being equipped with good field equipment and using dedicated fertilizer etc., has produced significant effect, but has been difficult to further raising.
Summary of the invention
The invention provides a kind of super hybridization rice mechanical enhancement at night irrigation method increasing super hybridization rice output.
For achieving the above object, the invention provides a kind of super hybridization rice mechanical enhancement at night irrigation method, in the whole vegetative period of super hybridization rice, night is to the aerating of From The Rhizosphere of Rice soil.
Preferably, aerating mode is adopt displacement per minute to be that the air pump of 50L is by being embedded in PVC plastic flexible pipe in water paddy soil to From The Rhizosphere of Rice soil aerating 4 minutes.
Preferably, PVC plastic flexible pipe embedding manner is: first in Tanaka's ditching side by side, bury the PVC plastic flexible pipe that diameter is 5 millimeter side by side underground, one end of this PVC plastic flexible pipe is unified adopts iron wire to carry out tightening closed, 2 holes are pricked every 10cm iron wire, and wrap up with gauze, the PVC hose other end stretches out outside land for growing field crops, open-ended.
Preferably, once, the time is 8:00 in evening in aerating every day.
Preferably, high ground bacillus is produced at rhizosphere soil.
Preferably, aerating twice every day, the time be respectively evening 8:00 and morning 5:30.
Preferably, bacillus subtilis strain is produced at rhizosphere soil.
Preferably, once, the time is 8:00 in evening in every other day aerating.
Preferably, Sphingomonas is produced at rhizosphere soil.
The invention has the beneficial effects as follows: the present invention promotes the population diversity of rhizospheric microflora of soil at heading stage, significantly improves rice yield.
Embodiment
Below by embodiment, the present invention will be further described.
The experiment soil of Super Rice Planting experiment is the reddish yellow mud that Quaternary Loess is grown, middle fertility, topdress to field experiment district is unified before planting, purity nitrogen 12 ~ 15kg is executed according to Rice Cropping every mu, in fertilising, the requirement of the amount ratio 1:1:1.4 of phosphorus, nitrogen, potash fertilizer is applied fertilizer, and this every block area in experiment field is 1.44m
2, the unified fertilizing amount of experiment is, nitrogenous fertilizer: urea 25g/ block, phosphate fertilizer Ca (H
2pO
4)
2, 25g/ block, potash fertilizer: KCL35g/ block.Experiment selects the kind of paddy rice to be deeply excellent 9586.
First in the large Tanaka of test ditching side by side, bury the PVC plastic flexible pipe that diameter is 5 millimeter side by side underground, one end of this PVC plastic flexible pipe is unified adopts iron wire to carry out tightening closed, 2 holes are pricked every 10cm iron wire, and wrap up with gauze, then wrap up with the string bag, Super Rice Planting (conveniently gets root) in the string bag, the PVC hose other end stretches out outside land for growing field crops, open-ended.Dilution hydrogen peroxide is carried out chemical enhancement and is also undertaken by this pipeline.Paddy rice just starts after transplanting seedlings to carry out different gas transmission process and control to super hybridization rice rhizosphere soil.The vegetative period of super hybridization rice is divided into tillering stage by the growing state according to super hybridization rice: time period from June 16 was to August 5; Heading stage: time period from August 6 was to September 14; Maturing stage: time period from September 15 is to three phases on October 15.Each stage divides 10 process.
Table 2.1 oxygenation Irrigation regime group list
T1: adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopt timer determine at 8:00 every morning, be called once-a-day group on daytime.
T2: adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopt timer determine morning every day 8:00 and afternoon 5:30, be called one day daytime twice group.
T3: adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopts timer to be defined as every other day ventilating once, time is 8:00 in morning, is called two days daytime once group.
T4: adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopt timer determine at 8:00 every night, be called once-a-day group at night.
T5: adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopt timer determine every night 8:00 and morning 5:30, be called one day night twice group.
T6: adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopt timer determine every other day at night 8:00 carry out, be called once group at two days nights.
T7: adopt dilution factor to be the H of 0.3 ‰
2o
2irrigate, the processing time be tillering stage+heading stage+maturing stage, also referred to as chemical A group.
T8: adopt dilution factor to be the H of 0.3 ‰
2o
2irrigate, the processing time be tillering stage+heading stage, also referred to as chemical B group.
T9: adopt dilution factor to be the H of 0.3 ‰
2o
2irrigate, the processing time be tillering stage+maturing stage adds once, respectively also referred to as chemical C group.
CK: control group, is left intact.
The every block in experiment field district arranges three PVC hose, and 15 pocket super hybridization rices are planted in every block test region, in the process of ventilation, the blowing mouth of air pump connects six hole current dividers, on average the gas of output is divided into six parts is input to two pieces of test regions respectively, and therefore, the total amount that T1 test region inputs gas every day is about 200L, T2 is about 400L, T3 every two days is that 200L, T5 are 400L every night every night for 200L, T4, T6 every two evenings are 200L, and chemical group irrigates the H of 0.3 ‰ at different times
2o
2, to the irrigation of whole experimental group all with identical process.Total sample number is 300 pockets, and the super hybridization rice of namely planting is divided into 10 processed group, often organizes process and is all 30 pockets.
One, the impact on super hybridization rice rhizosphere soil microorganism population and quantity is irrigated in oxygenation
1. material and reagent
1.1 material
The soil that super hybridization rice experiment field, garden super hybridization rice rhizosphere gathers weeds in Agricultural University Of Hunan
1.2 reagent
Gram’s staining: crystal violet, iodine liquid, sarranine counterstain solutions, aqua sterilisa, purity is the ethanol of 95%
1.3 medium
PDA medium: potato 200g, sucrose (sucrose) 30g, agar (Agar powder) 18g.
2 methods
The collection of 2.1 soil specimens
The soil sample of super hybridization rice experiment field, garden super hybridization rice rhizosphere collection is weeded from Agricultural University Of Hunan.When gathering soil sample, gather band root soil 100g from surface soil 3cm place of super hybridization rice root district, after packing mark, sample is taken back laboratory.
The concrete steps that 2.2 strain separating are differentiated
2.2.1 preparation
Gather soil sample;
Prepare the PDA solid plate cultivating microorganism, be down flat plate about 100 at every turn.(three different dilution factors are chosen in this experiment, and each dilution factor is coated with the flat board of three parallel controls, has ten process, totally 90 flat boards);
The soil specimen fetched is each will do six powers (have 10 process, be exactly 60 test tubes, fill 9 ml physiological salines, sterilization treatment in each pipe, be stand-by) that ten times are diluted to ten;
It is the triangular flask of 250mL that each experiment will prepare about 12 capacity, injects additional about 30 ~ 40 beades of physiological saline of 90mL, be fully released in physiological saline for the mushroom in soil in each triangular flask;
Prepare all kinds of rifle heads of sterilizing;
2.2.2 sampling
The time of every sub-sampling is fixed on 8 o'clock to 10 o'clock morning, gets distance soil surface 3cm, near about 10 grams, the soil of root;
2.2.3 dilute, coating, cultivate
1. take the soil sample of 10 grams at every turn, put on alcolhol burner flame side the conical flask that 99mL aqua sterilisa got by dress, fully shake up concussion 1 ~ 2h under room temperature, bacterium is fully disperseed.
2. the bacteria suspension 1mL in using pipette, extract step 1., put into the test tube that fills 9mL sterile water, and abundant vibration shakes up as after uniform bacteria suspension in electronic vortex oscillator, go this bacteria suspension 1mL to put into an other test tube filling 9mL aqua sterilisa again, the like be diluted to 10 further
6bacteria suspension doubly (often doing 1 bacterium liquid dilution, the rifle head that all must more renew).
3. respectively from diluting 10
4, 10
5, 10
6draw 100 microlitre bacteria suspensions in bacteria suspension doubly, be injected on PDA flat board respectively, same dilution repeats to make 3 culture dishes, the number of finishing.
4. with glass spreading rod, the bacterium liquid on flat board is coated with evenly, (to be coated with from high dilution can to change spreading rod to low dilution order), microorganism slat chain conveyor ware special-purpose sealing film bandages, and be inverted button and be placed on temperature and be about in the constant incubator of 28 DEG C, all need to observe media surface every day and judged whether that microbe colony grows up to.
5. after constant temperature culture after a while, plating medium grows various bacterium colony successively, need the feature according to various bacterium colony, carry out preliminary judgement, judge that these bacterium colonies belong to the edaphon of which type, and utilize electron microscope inspection, if the morphologic appearance of thalline is consistent, then can regards as initial gross separation and go out pure culture.
6. by step 5. in the initial gross separation pure culture of turning out, be transferred in the slant medium of test tube from PDA medium and again carry out cultivating as subsequent use.
2.2.4 selecting of Typical Representative bacterial classification processes (Gram’s staining) with tentatively dyeing
1. slat chain conveyor just can observe the growing state of dull and stereotyped upper bacterium colony for 1 ~ 2 day, and estimates the quantity of the bacterium of some types in soil by colony counting method.Pick out the bacterial classification with role of delegate and do Gram’s staining further.The significance of Gram's stain is just that the character of bacterium is analysed in point discriminating further, is divided into two types most bacterium: Gram-negative bacteria and gram-positive bacteria.Numerous pyococcuss is generally all shown as Gram-positive, and these bacteriums can produce some exotoxins, and most enteron aisle bacterium shows Gram-negative substantially, and these bacteriums can produce endotoxin.According to the Gram-stained character of experiment stained bacteria, the scope of Bacteria Identification can be reduced further, contribute to carrying out separation andpreconcentration to the kind of bacterium further.
2. the concrete steps of Gram's stain: comprise and dyeing first for the first time, next carries out mordant dyeing, again decolours, and finally carry out four steps such as redying, concrete operating procedure and method are:
1) smear is fixed
2) utilize ammonium oxalate crystal violet to dye, the time is about 1 minute
3) tap water
4) drip iodine liquid, by painting face covering coloring, the time is about 1 minute
5) wash, suck moisture with blotting paper
6) be that 95% alcohol drops in painting face with alcoholic strength, and need to carry out slightly shaking to decolour, use aseptic washing after about 20 seconds, then moisture is siphoned away
7) carry out rare dye about 2 minutes with luxuriant red colouring solution for subsequent use, then rinse with sterile water
8) finally carry out natural seasoning, put and check under the microscope
2.2.5 pick out 40 ~ 50 bacterial classifications and extract STb gene clone conserved sequence to do Molecular Identification
First need to carry out the preservation of experimental strain and taking pictures in time of upgrowth situation, and then extract the DNA of bacterial classification.Main employing DNA extraction kit is extracted, and the reagent of oneself preparation of arranging in pairs or groups extracts, and the concrete steps of this experiment are as follows:
1. get a little thalline in mortar, add appropriate Liquid nitrogen precooler, after grinding to form homogenate, add 1mL lysate, then after fully grinding, leave standstill 5-10min.
2. add the sex change liquid of 500ul, after being ground, be respectively charged in centrifuge tube for subsequent use.
3. be in the centrifuge tube that the supernatant pipetted after carrying out centrifugal 10 ~ 15 minutes under the centrifuge of 12000rpm in centrifuge tube is extremely new in centrifugal force size.
4. phenol is used: chloroform: isopropyl alcohol is that the equal-volume of 25:24:1 adds to supernatant 12000rpm in centrifuge tube centrifugal 3 minutes, needs again to repeat this operating procedure once after pipetting supernatant.
5. add equal-volume isopropyl alcohol at-20 DEG C, leave standstill 1-2h or spend the night.
6. the centrifugal 10min of 12000rpm, abandons supernatant.
7. 2 times are precipitated with the ethanol wash of the precooling of 1ml70%.
8., after DNA being dissolved with the distilled water of 50ul, be placed on temperature and control to save backup at-20 DEG C.
2.2.6ITS the amplification of (750bp) sequence or 16sRDNA (1540bp) sequence
1. the primer primer of all selecting ITS general, equal censorship Hua Da genome company synthesizes
ITS1：TCCGTAGGTGAACCTGCGG
ITS4：TCCTCCGCTTATTGATATGC
The component amount of each composition of PCR reaction system is all added according to table 3.1.(cumulative volume is 25 μ L)
PCR response procedures: the first stage is denaturation.Temperature 95 DEG C, time 3min; First carry out sex change headed by second stage, again anneal.Finally carry out the cycle stage extended.Denaturation temperature 94 DEG C, time 1min, annealing temperature 54 DEG C, time 45sec, elongating temperature 72 DEG C, time 45sec, 35Cycles; Phase III is for extending the stage eventually.Temperature 72 DEG C, time 10min.4 DEG C of preservations.
2. primer selects 16S universal primer, and by Hua Da, genome company synthesizes.
27F：AGAGTTTGATCCTGGCTCAG1492R：GGTTACCTTGTTACGACTT。
The each component amount of PCR reaction system is added according to table 3.1.(cumulative volume is 25 μ L)
PCR response procedures: the first stage is denaturation.Temperature 95 DEG C, time 3min; Second stage is sex change-annealing-extension cycle stage.Denaturation temperature 94 DEG C, time 1min, annealing temperature 50 DEG C, time 45sec, elongating temperature 72 DEG C, time 1min, 35Cycles; Phase III is for extending the stage eventually.Temperature 72 DEG C, time 10min.4 DEG C of preservations.
Configuration Ago-Gel, concentration is 1%.Electrophoresis detection PCR primer.Voltage 100V, electrophoresis 20min.After electrophoresis step completes, then in gel imaging system, observe whether obtaining sizable object fragment.
The reaction composition of table 3.1A-16SPCR
Finally need the fragment glue obtained to reclaim, finally send professional order-checking company to check order.
3 results and analysis
The impact on super hybridization rice rhizosphere soil microorganism population is irrigated in 3.1 oxygenation
Table 3.2 represents in the oxygenation Irrigation regime stage, the quantity situation of super hybridization rice rhizosphere soil microorganism population, the impact on super hybridization rice rhizosphere soil microorganism population is irrigated in oxygenation, main manifestations is to microbial bacterial, fungi, the impact of actinomycetes three major types population, as can be seen from the data in above table, in the stage in tillering stage, oxygenation Irrigation regime T1, T2, T4, T7, T8, the population number of T9 group is more than CK group, T3, T5, T6 group is identical with CK group, illustrate that the microbial population diversity of oxygenation process to super hybridization rice root district has positive effect, oxygenation on daytime and chemical enhancement effect more obvious than oxygenation at night, oxygenation Irrigation regime group has facilitation to the population diversity of super hybridization rice rhizosphere soil microorganism on the whole, in the stage at heading stage, oxygenation Irrigation regime group has the population number of T2, T4, T5, T6, T7 group more than CK group, other groups maintain an equal level with CK group, data show in this stage, oxygenation process is also conducive to the development of super hybridization rice root-zone microorganism population diversity on the whole, and oxygenation process at night is more remarkable to super hybridization rice root region soil microbial population diversity influence on development, in the maturing stage, oxygenation process T2, T3, T8 group is identical with CK group, other groups all will lower than CK group, data show the development that can suppress super hybridization rice root-zone microorganism population diversity in this stage oxygenation process, processed group can play and slow down effect daytime, from the whole growth cycle of super hybridization rice, oxygenation process on the whole to the population diversity of rhizospheric microflora of soil to promote.
The impact on super hybridization rice rhizosphere soil microorganism population is irrigated in table 3.2 oxygenation
The impact on super hybridization rice rhizosphere soil bacterial number is irrigated in 3.2 oxygenation
Under oxygenation Irrigation regime, super hybridization rice is different at the oxygenation process rhizosphere soil bacterial number that same vegetative period is different, and same process different times bacterial number is different.Test in laboratory counting is in table 3.3.
The impact on super hybridization rice rhizosphere soil bacterial number is irrigated in table 3.3 oxygenation
As can be seen from above-mentioned data, the impact on the bacterial number of super hybridization rice rhizosphere soil microorganism is irrigated in oxygenation, in the stage in tillering stage, experimental group bacterial number sequencing is T2, T5, T7, T8, T9, CK, T1, T3, T6, T8, as can be seen from sequence, irrigate in oxygenation in tillering stage and difference is affected not quite to the quantity of super hybridization rice rhizosphere soil microorganism bacterium, the most remarkable with group T2 group on daytime; In the stage at heading stage, the successively sequence of experimental group bacterial number is T7, T9, T5, T4, T3, CK, T8, T1, T2, T6, data show that the growth to the quantity of super hybridization rice root district bacterium has facilitation in this oxygenation at night in stage and chemical enhancement, chemical group and night group want significantly, night, group was the most remarkable with T5 group; In the stage in maturing stage, experimental group bacterial number sequencing is T2, T6, T4, T9, T8, T1, T7, CK, T3, T5, and oxygenation process has facilitation to the growth of bacterial number on the whole, the most remarkable with oxygenation process on daytime T2 group.
The impact on super hybridization rice rhizosphere soil fungi is irrigated in 3.3 oxygenation
Under oxygenation Irrigation regime, super hybridization rice is different at the oxygenation process rhizosphere soil fungi that same growth period is different, fungi in the vegetative period also property of there are differences that same process is different.As can be seen from the data of table 3.4, the impact on super hybridization rice rhizosphere soil fungi is irrigated in oxygenation, in the stage in tillering stage, oxygenation is irrigated and generally is just started to occur facilitation to the quantity of fungi, especially with daytime process and chemical treatment group be remarkable, daytime, group was that the most remarkable chemical group is the most remarkable with T7 group with T3 group, in the stage at heading stage, oxygenation irrigation totally has larger facilitation to the generation of super hybridization rice rhizosphere soil fungi and quantity, wherein with T4, T5, T7, T9 group exceeds more compared with control group CK, illustrate and be treated to good in this stage with oxygenation at night, with T4, T5 group is representative, in the stage in maturing stage, the generation of oxygenation process to super hybridization rice rhizosphere soil fungi has obvious inhibitory action, and most of oxygenation processed group does not find fungi, and only in CK group and T8 group, sub-argument goes out fungi.
The impact on super hybridization rice rhizosphere soil fungi is irrigated in table 3.4 oxygenation
3.4 oxygenation are irrigated the actinomycetic impact of super hybridization rice rhizosphere soil
Under oxygenation Irrigation regime, super hybridization rice same time different process rhizosphere soil Population of Actinomycetes is different, and same process different times Population of Actinomycetes is different.Test in laboratory counting is in table 3.5.
Experimental data shows, oxygenation is on the actinomycetic quantity impact of super hybridization rice rhizosphere soil, in the stage in tillering stage, oxygenation Irrigation regime has facilitation to the actinomycetic generation of its rhizosphere soil and quantity, obvious for representing with chemical enhancement processed group T7, T8 group, T1, T4 group is identical with control group, shows with oxygenation on daytime, this stage still can promote that actinomycetic quantity increases; In the stage at heading stage, T5, T6 group exceedes control group CK, T2, T7 group is identical with control group CK, can find out has facilitation in the growth of this oxygenation process at night in stage to super hybridization rice root district Population of Actinomycetes, the highest group of T5 is 4 times of CK group, T6 group is 2 times of CK group, illustrates that this stage promotes that actinomycetic growth is treated to good with oxygenation at night, especially T5 group; In the maturing stage, in oxygenation processed group, only have T2, T3, T8 group to have actinomycetic existence, show there is positive facilitation in the growth of this oxygenation process on daytime in stage to super hybridization rice root district Population of Actinomycetes.
The impact on super hybridization rice rhizosphere soil Population of Actinomycetes is irrigated in table 3.5 oxygenation
4 Gram’s staining interpretations
Purifying is carried out by the bacterium cultivated experimental group rhizosphere soil microorganism, carry out Gram’s staining experiment, result gathers as follows: the display of CK group Bacterial stain result is mainly Gram-positive bacteria, mainly there is Gram-negative bacteria in the Bacterial stain result display in T1 group, the display of T2 group Bacterial stain result mainly has Gram-negative bacteria, mainly there is Gram-negative bacteria in the display of T3 group Bacterial stain result, mainly there is Gram-positive bacteria in the display of T4 group Bacterial stain result, mainly there is Gram-positive bacteria in the display of T5 group Bacterial stain result, mainly there is Gram-positive bacteria in the display of T6 group Bacterial stain result, mainly there is Gram-negative in the display of T7 group Bacterial stain result, Gram-positive bacteria, mainly there is Gram-negative bacteria in the display of T8 group Bacterial stain result, T9 group Bacterial stain result is shown as Gram-negative bacteria, in table 3.6.
Table 3.6 Gram’s staining experimental result
+ represent that positive-expression is negative
The kind situation that 5 super hybridization rice rhizosphere soil microorganism DNA identify
By the microorganism of purifying being carried out DNA qualification and censorship, contrast and statistics, from T1 group soil sample, isolate the microorganisms such as candida, Arthrobacter, bacillus amyloliquefaciens, bacillus pumilus, bacillus subtilis strain; The microorganisms such as bacillus subtilis strain, stratospheric bacillus, chlorella, orange Bacillus are isolated from T2 group soil sample; Soil Gordonia bronchialis is isolated from T3 group soil sample; High ground bacillus is isolated from T4 group soil sample; Bacillus subtilis strain is isolated from T5 group soil sample; Sphingomonas is isolated from T6 group soil sample; Bacillus subtilis strain is isolated from T7 group soil sample; Bacillus mycoides, Escherichia coli are isolated from T8 group soil sample; The microorganisms such as bacillus subtilis, Sphingomonas, purple Bacillus, molten aromatic hydrocarbons Sphingol single-cell are isolated from T9 group soil sample; Flavobacterium is gone out from CK group soil sample sub-argument.Therefrom can find out that some microorganisms in oxygenation processed group have positive effect to plant or environment.
Chlorella, itself is rich in many nutrient components such as protein, edible fibers, vitamin and trace element, and some compositions extracting chlorella can be used for treating peptic ulcer, anti-curing oncoma, strengthen the immunity of body.Also there is radioresistance and prevent and treat the effects such as anaemia, for plant growth, to some pathogenic microorganisms, there is preventive and therapeutic effect.
Orange Bacillus Classification system is SandaracinobacterYurkov, Stackebrandt and Buss, is Gram-negative bacteria, containing carotenoid and bacteriochlorophyll in the cell of this bacterium.
Sphingomonas, Gram-negative bacteria, it is a kind of obligate aerobic and self can Hydrogen Peroxide enzyme material, this bacterial strain has very high metabolic capabilities, physiological characteristic also has several functions, be considered to the microbial resources that a class is novel, to the degraded of the biology of aromatic, there is stronger effect.Have wide practical use in environmental protection and industrial production.
High ground bacillus, research shows to have good antagonism to the former bacterium of the banded sclerotial blight of paddy rice and rice blast fungus etc., but also more responsive to the antibiotic such as penicillins and macrolide.Probe into discovery by carrying out physicochemical property to the active substance of high ground bacillus, the active substance of this type of bacterium can withstand high temperatures and acidity, but responsive to strong basicity, and under basic conditions, this bacterium easily loses activity.
Purple Bacillus, the solid culture medium of microorganism can generate the purple bacterium colony as cheese shape; Can present otherness because of different kinds to the temperature of growth, if adopting ordinary culture medium to cultivate general preference temperature is 25 DEG C, have selectivity to the pH value of growing environment, it is generally acknowledged that the pH that optimum grows is 7.8, pH value can grow below 4.5.In addition also can not grow in the medium at more than 6%NaCl, be the microorganism of a class based on fermentating metabolism.
Flavobacterium is a kind of strictly aerobic microorganism, Gram-negative.This type of growth of microorganism some bacterial strain when solid culture medium can generate more orange or more yellow pigment, and some can not produce this type of pigment.Bacterium colony is generally translucently also has opaque shape once in a while, form is the circle that diameter is about 1 ~ 2nm, and surface has micro-protuberance or protuberance, and observation can be found out smooth and glossy, Quan Yuan, this Pseudomonas can produce acid by carbohydrate but can not aerogenesis in the protein culture medium of low concentration.
6 brief summaries
1. the generation phenomenon failing to find significantly to suppress certain quasi-microorganism on the population impact of super hybridization rice rhizosphere soil microorganism is irrigated in oxygenation, three large populations all occurred in whole vegetative period, from the whole growth cycle of super hybridization rice, oxygenation process on the whole to the population diversity of rhizospheric microflora of soil to promote, from process the phase population number as standard, tillering stage with daytime group and chemical group for representative, daytime group T1, T2 group and chemical group T8, T9 group is good, heading stage is with processed group T4 at night, T5, T6 is good, maturing stage is with processed group T1 on daytime, T2, T8 is good.
2. the affect different phase of oxygenation process on rhizosphere soil bacterial number presents otherness, tillering stage difference little; The growth of bacterial number can be promoted in the oxygenation at night of stage at heading stage and chemical enhancement, with chemical group T7, T9 and night group T5 be good, comparatively control group exceeds 160%, 139%, 69% respectively; In the stage in maturing stage, it is comparatively remarkable that the growth of oxygenation on daytime to the bacterial number in super hybridization rice root district has facilitation, and be good with T2 group, comparatively control group exceeds 200%.On the impact of super hybridization rice rhizosphere soil fungi, in the stage in tillering stage, with oxygenation on daytime group T2, T3, T7, T8, T9, comparatively control group contrast is obvious in oxygenation irrigation, wherein outstanding with T7, T9 group, in the stage at heading stage, oxygenation irrigation totally has larger facilitation to the generation of super hybridization rice rhizosphere soil fungi and quantity, with night processed group and chemical group performance the most remarkable, night group with T4, T5 group for the best, comparatively control group exceeds 60%, and chemical group T7 and T9 group comparatively control group exceed 300% and 200% respectively; In the stage in maturing stage, the generation of oxygenation process to super hybridization rice rhizosphere soil fungi has obvious inhibitory action.Oxygenation has facilitation on the actinomycetic quantity impact of super hybridization rice rhizosphere soil in the stage in tillering stage, comparatively outstanding with chemical enhancement T7, T8, T9 and T1, T4 group, more remarkable in the growth facilitation of oxygenation process at night stage at heading stage to super hybridization rice root district Population of Actinomycetes, with T5 group for the best, comparatively control group exceeds 300%; In the maturing stage, the facilitation that oxygenation process on daytime increases super hybridization rice root district Population of Actinomycetes is more remarkable, has outstanding performance, all exceed control group 100% with T2, T3, T8 group.
3. identified by the DNA of Gram’s staining and sample, from the microorganism of separating, oxygenation is irrigated to be had on the basis of positive role to super hybridization rice rhizosphere soil microorganism population quantity, can promote that some are conducive to the growth of microorganism of plant growth, some harmful microbes are suppressed to grow, from the bacillus subtilis that T1, T2, T5, T7, T9 separate, for obligate aerobic microorganism, to the harmful microorganism Escherichia coli, vibrios, baculoviral etc. be present in water body, there is significant inhibitory action; From the microorganism stratosphere bacillus that T2 group is separated, the generated energy of the novel microbial fuel cell manufactured with stratospheric bacillus is the twice of the fuel cell power generation amount that other microorganism manufactures, and can be collected the new forms of energy utilizing and become human society.The novel microbial fuel cell manufactured with stratospheric bacillus can also become electric power by refuse derived for some in river by purifying river water on the one hand on the other hand; From the Sphingomonas microorganism that T6, T9 group is separated, there is very high metabolic capabilities, physiological characteristic also has several functions, be considered to the microbial resources that a class is novel, to the degraded of the biology of aromatic, there is stronger effect, be with a wide range of applications in environmental protection and industrial production, and these microorganisms do not find and separate in control group, that separates from DNA grows the concrete kind quantity of useful microorganism to super hybridization rice, be good with T1 and T2 group, especially T1 group.
In sum, for population and quantity that super hybridization rice rhizosphere soil is microorganism, be good in tillering stage with oxygenation on daytime and chemical enhancement, once-a-day i.e. T1 group or twice on the one i.e. T2 group process on daytime can be selected, good to be treated to night at heading stage, can select night once-a-day namely T4 group or two days once namely T5 group be good, be good in the maturing stage with oxygenation on daytime processed group T2 or T1.Chemical group can adopt T7 group or T9 group.
Two, the impact on super hybridization rice rhizosphere soil microorganism fiber hydrolization intensity is irrigated in oxygenation
There is various cellulose in large nature, is the chief component of plant tissue.The decomposition of plant residue in soil, is mainly undertaken by microorganism.Cellulolytic microorganism has aerobic microbiological and anaerobe, but mainly still undertaken by aerobic bacteria, these microorganisms should be considered as the basis of natural world ecosystem carbon cycle to the decomposition of fiber, the intensity of microbial decomposition fiber is to increasing soil fertility simultaneously, and the nutrition improving plant has very important meaning.
1 experimental principle
Cotton method is buried in this experiment employing, by specially treated and the cotton sheet that takes weight are embedded in the soil specimen of different disposal, through being generally 10 to 12 days after a period of time, due to the effect of different cellulose decomposition bacteria in different oxygenation process soil specimens, the weight of cotton strap there will be reduction in various degree, and how many quality lost by cotton weighs out the intensity of microbial decomposition cellulose effect in soil specimen.
2 experiment materials
Cotton strap; The H of 0.1%
2sO
4solution; Iodine liquid;
3 operating procedures
The process of cotton strap: first cotton strap is cut into size and is about 6cm × 4cm size, then be immersed in the H that solubility is 0.1%
2sO
4carry out in the aqueous solution boiling process, boil and (illustrate that the starch on cotton is divided substantially) to cotton strap and iodine liquid reaction color are blueness; Take out cotton strap aqua sterilisa to wash away acid unnecessary in cotton, put on coding with pencil and carry out mark, being dry in the baking box of 105 DEG C being placed on temperature, weighing in time after oven dry, installing for subsequent use with clean plastic sack; About for the fresh soil sample fetched from super hybridization rice rhizosphere 80g is divided into two parts, first a copy of it is put in bottom circular culture dish and paves, then cotton strap for subsequent use is laid on soil sample, again another part of soil is overlying on it and paves, cover ware lid band special to seal, be put in 28 DEG C of insulating boxs and cultivate; Take out cotton strap after 10 days, wash away the grogs that cotton strap adheres to clear water lightly, then be placed in 105 DEG C of baking boxs and dry, finally weigh.
4 results calculate
Fiber hydrolization intensity (%)=(before cultivating the rear cotton strap weight of the original weight-cultivation of cotton strap)/cotton strap original weight * 100%
5 interpretations of result
In tillering stage, different process antimicrobial fiber decomposition intensity performances is different, in tillering stage, the sequence from big to small of cotton strap weight-loss ratio is T9, T1, T2, CK, T7, T3, T6, T4, T8, T5, therefrom can find out, initial stage is irrigated in oxygenation, daytime group T1, T2, chemical group T9 is compared with control group CK, want high in this stage antimicrobial fiber decomposition intensity, daytime group T3, night group T6, T4, T5, chemical group T7, the fiber hydrolization intensity performance of T8 microorganism is lower than CK group, T9 is only had to reach significance level, show that oxygenation process on daytime is conducive to strengthening the vital movement of aerobic microbiological, with T1, T2 group is good, in table 4.1.
Table 4.1 oxygenation is irrigated super hybridization rice rhizospheric microorganism fiber hydrolization intensity
Between the heading stage of super hybridization rice, added up by the original weight to cotton strap, experimental result weight, weight loss and weight-loss ratio, different oxygenation Irrigation regime antimicrobial fiber decomposition intensity performance is different, in table 4.2.In data at heading stage, its sequencing is T9, T4, T7, T5, T1, CK, T6, T8, T2, T3, therefrom can find out, in the super hybridization rice stage at heading stage, daytime group T1, night group T4, T5, chemical group T7, T9 is compared with control group, this stage antimicrobial fiber decomposition intensity wants high, daytime group T2, T3, night group T6, the fiber hydrolization intensity performance of the microorganism of chemical group T8 is low, T4, T9 group reaches significance level, data show the vital movement that can strengthen super hybridization rice root district aerobic microbiological in the oxygenation at night of stage at heading stage, with group T4 at night, T5 group is good.
The impact on super hybridization rice rhizospheric microorganism fiber hydrolization intensity is irrigated in table 4.2 oxygenation
At the ripening period of super hybridization rice, added up by the original weight to cotton strap, experimental result weight, weight loss and weight-loss ratio, different oxygenation Irrigation regime antimicrobial fiber decomposition intensity performance is different, in table 4.3.Analyze the maturing stage data we can find, the power sequence from big to small of fiber hydrolization intensity is T2, T3, T4, T1, T9, T8, T7, T5, CK, T6, therefrom can find out, in the stage in super hybridization rice maturing stage, compared with control group CK, this stage antimicrobial fiber decomposition intensity of oxygenation processed group is all high than CK group except night processed group T6, antimicrobial fiber decomposition intensity other groups except T5 group all reach significance level, the vital movement being conducive to super hybridization rice root district aerobic microbiological in this stage oxygenation process can be found out, improve the ability of microbial decomposition fiber, between each processed group, with oxygenation on daytime processed group T2 group for the best.
Table 4.3 oxygenation is irrigated super hybridization rice rhizospheric microorganism fiber hydrolization intensity effect
6 brief summaries
1. the result of fiber hydrolization intensity experiment and microbial population quantity has uniformity, and point daytime evil phase, the decomposition intensity of group was comparatively strong, night at heading stage processed group decomposition intensity comparatively by force, daytime in maturing stage, processed group decomposition intensity was stronger.
2. oxygenation irrigate tillering stage, daytime group T1, chemical group T9 compared with control group CK, comparatively control group exceeds 3.27%, 6.61% respectively; The fiber hydrolization intensity of microorganism wants high, shows to carry out in the tillering stage of super hybridization rice the vital movement that oxygenation process on daytime is conducive to strengthening aerobic microbiological; In the super hybridization rice stage at heading stage, daytime group T1, night group T4, the fiber hydrolization intensity that shows of T5, chemical group T7, T9 microorganism compared with control group wants high, comparatively control group exceeds 2.83%, 8.59%, 4.25%, 5%, 28.53% respectively; Show mainly to carry out in the secondary stage vital movement that oxygenation process at night can strengthen super hybridization rice root district aerobic microbiological, improve the fiber hydrolization intensity of aerobic microbiological; In the stage in super hybridization rice maturing stage compared with control group CK, this stage antimicrobial fiber decomposition intensity of oxygenation processed group is all high than CK group except night processed group T6, and antimicrobial fiber decomposition intensity other groups except T5 group all reach significance level, the vital movement being conducive to super hybridization rice root district aerobic microbiological in this stage oxygenation process can be found out, improve the ability of microbial decomposition fiber, between each processed group of oxygenation, be treated to the best with oxygenation on daytime again.
3. the fiber hydrolization intensity of microorganism is quantity from another one side reflection aerobic microbiological and active index, irrigates can to find out the impact change of the microbial decomposition intensity of super hybridization rice root region soil and can promote the vital movement of root district aerobic microbiological in the different stages to the oxygenation that super hybridization rice carries out different time from this oxygenation.
Three, the impact on the basic economical character of super hybridization rice is irrigated in oxygenation
The impact on super hybridization rice basic agronomic trait in tillering stage is irrigated in 1 oxygenation
At the super hybridization rice oxygenation process initial stage, we observe the tiller number of super hybridization rice and the change of plant height data by principal statistical, and we carry out observation statistics in July 24, August 2, August 8 in test region.
As can be seen from table 5.1 tillering stage super hybridization rice plant height situation, cut-off July 24, the sequencing of super hybridization rice plant height is T8, T7, T6, T5, T4, T2, T1, CK, T3, T9; End July 28, the sequencing of super hybridization rice plant height is T8, T6, T4, T7, T1, T9, T5, T3, CK, T2; End August 2, the sequencing of super hybridization rice plant height is T8, T4, T9, T5, T6, T7, T2, T3, T1, CK; Cut-off completes tillering stage August 8 substantially, and the sequencing of super hybridization rice plant height is T8, T4, T6, T7, T3, T9, T2, T5, T1, CK; From whole tillering stage, along with continuing of oxygenation processing time, the plant height of oxygenation super hybridization rice wants fast compared with the speed that normal control group CK grows, July 24, CK group was still more than two groups of oxygenation processed group, but statistics below finds that CK group starts to lag behind oxygenation processed group, substantially CK group plant height is terminated minimum to tillering stage, oxygenation process minimum group of T1 exceeds CK group 1.7%, also there are differences between different oxygenation process, T8 group is always leading, has whole tillering stage T1, T4, T5, T6, T7, T8 always high than the plant height of normal control group.
The impact on super hybridization rice plant height in tillering stage is irrigated in table 5.1 oxygenation
As can be seen from the tiller number in super hybridization rice tillering stage of table 5.2, cut-off July 24, the sequencing of super hybridization rice tiller number is T6, T8, T5, T4, T2, T1, T7, T3, T9, CK; End July 28, the sequencing of super hybridization rice tiller number is also T6, T8, T5, T4, T2, T1, T7, T3, T9, CK; End August 2, the sequencing of super hybridization rice plant height is T5, T4, T8, T2, T3, T7, T6, T1, T9, CK; Cut-off completes tillering stage August 8 substantially, and the sequencing of super hybridization rice plant height is T3, T5, T2, T8, T1, T6, T4, T7, T9, CK; From whole tillering stage, the super hybridization rice tiller number of oxygenation process is all high than control group CK, terminates the highest group of T3 will exceed 25%, T9 group than control group and also will exceed 15% than CK group to tillering stage, oxygenation process has remarkable effect to tillering of super hybridization rice, is good with processed group on daytime.
The impact on super hybridization rice tiller number in tillering stage is irrigated in table 5.2 oxygenation
2. the impact on super hybridization rice basic agronomic trait at heading stage is irrigated in oxygenation
In the stage at heading stage of super hybridization rice, the agronomic trait of super hybridization rice statistics is mainly added up total tiller number of super hybridization rice at heading stage, available tillering, ineffective tillering number, plant length, root fresh weight, root dry weight, plant weights.
The impact on super hybridization rice economical character index at heading stage is irrigated in table 5.3 oxygenation
As can be seen from table 5.3 heading stage experiment statistics data, for the tiller number of super hybridization rice, total tiller number descending order is T2, T1, T9, T7, CK, T8, T6, T5, T4, T3, therefrom can find out that the tiller action effect of group chemical group on daytime to super hybridization rice is higher than group at night.The available tillering descending order of super hybridization rice is T2, T1, T9, T7, T8, T6, CK, T5, T4, T3, oxygenation on daytime and chemical enhancement contribute to the formation of super hybridization rice effective tiller, and oxygenation process at night also acts on not quite total tiller number and effective tiller.The ineffective tillering number descending order of super hybridization rice is CK, T9, T2, T7, T5, T1, T8, T6, T4, T3, can find out that the ineffective tillering that can reduce super hybridization rice is irrigated in oxygenation.The long sequence of the strain order from high to low of super hybridization rice is T5, T3, T9, T8, T6, T1, T4, T2, T7, CK, can find out that the growth of oxygenation process to the overall plant of super hybridization rice has significant effect during heading stage, the plant height of oxygenation process is all more than or equal to control group, from T1 group, just there is significance statistical significance, the most remarkable with group T5 at night.The leaf of super hybridization rice is wide, and leniently to arrive narrow sequence be T8, T4, T1, T2, T6, T7, T5, T3, T9, CK, and night, group T4 and chemical group T8 was the most remarkable.The sequence from big to small of coming into leaves most of super hybridization rice for T8, T3, T6, T1, T5, T7, CK, T9, T2, T4, can find out that oxygenation process has positive effect to super hybridization rice leaf growth, with chemical group T8 and daytime group T3 the most remarkable.Super hybridization rice weight of root system sorts as T2, T6, T1, T7, CK, T9, T3, T8, T5, T4 from big to small, can find out, the root system dry matter of oxygenation process to super hybridization rice obtains being formed has positive facilitation, the most outstanding with T1, T2, T6 group.The root/shoot ratio sequence from big to small of super hybridization rice is T3, CK, T1, T2, T6, T8, T7, T9, T5, T4, be respectively 15%, 11%, 11%, 11%, 11%, 10%, 9%, 9%, 9%, 8%, oxygenation processed group and normal control group otherness not quite, can find out that the root/shoot ratio impact of oxygenation process on super hybridization rice is little.
3. the impact on maturing stage super hybridization rice Main Agronomic index is irrigated in oxygenation
The index such as total number, examples explain, empty grain number, ripening rate, thousand kernel weight, plant height, strain dry weight affecting the average every fringe of each process of data Main Analysis maturing stage super hybridization rice of the Main Agronomic index on maturing stage super hybridization rice is irrigated in oxygenation.
As can be seen from the data of table 5.4, sort as T8 from high to low at the plant height of the super hybridization rice of maturing stage each oxygenation process, T2, T5, T1, T4, T3, T9, T6, CK, T7, strain dry weight sorts as T3 from big to small, T4, T5, T1, T2, T7, T6, T9, T8, CK, can find out that the accumulation of oxygenation process to the final dry matter of plant has significant facilitation from experimental result, oxygenation process minimum group of T8 group exceeds 2.35% than control group CK, also facilitation is had to the height growth of plant, except T7 group, oxygenation processed group all exceedes control group CK, to exceed in group minimum group of T6 group and the highest group of T8 group respectively than exceeding 1.97% and 9.64%, the sequencing of every total grain panicle number of experimental group paddy rice is T5, T4, T9, T3, T7, T8, CK, T6, T2, T1, the spike number of different oxygenation process to super hybridization rice has larger difference, ripening rate sequencing is T9, T7, T5, T6, T4, T1, T2, T3, T8, CK, although can find out that oxygenation Irrigation regime group is all higher than control group from above-mentioned data, only has T5, T7, T9 to show significantly on ripening rate impact.The sequencing of thousand kernel weight is T1, T2, T9, T5, T7, T6, T4, T3, T8, CK, oxygenation process is on the impact of the thousand kernel weight of super hybridization rice, oxygenation processed group is all high than control group, have once-a-day organize daytime T1, one day daytime twice group of T2, two days nights once organize T5, chemical C group T9 totally four processed group impact performance significantly, respectively higher than CK group 10%, 8%, 6%, 5%.In sum, oxygenation process has facilitation to the height of the plant of super hybridization rice and the accumulation of dry matter, not obvious on the ripening rate impact of super hybridization rice, the most remarkable with the impact of T1 processed group on the thousand kernel weight of super hybridization rice.
The impact on maturing stage super hybridization rice economical character index is irrigated in table 5.4 oxygenation
4 brief summaries
1. irrigate the impact of tillering of super hybridization rice plant comparatively remarkable in oxygenation in tillering stage, illustrate in super hybridization rice tillering stage, oxygenation is irrigated and better can be met the oxygen demand of plant, effectively can promote the growth of plant, comprehensive two indexs can find out with daytime group T2 and chemical group T9 for the best.
2. during heading stage, the growth of oxygenation process to the overall plant of super hybridization rice has significant effect, oxygenation at night group T5, T3 group are on the impact of super hybridization rice plant height significantly, whole oxygenation process also has positive effect to the leaf growth of super hybridization rice, the growth that super hybridization rice leaf is long and leaf is wide can be promoted, carry out the root system dry matter of oxygenation process to super hybridization rice daytime to obtain being formed and there is positive facilitation, with T1, T2 group for the best.
3. irrigate in maturing stage oxygenation, to the spike of rice formation of super hybridization rice, there is facilitation, on the impact of the ripening rate of super hybridization rice with chemical group T7, T9 group and night group T5 be good, the fruit thousand kernel weight of super hybridization rice is affected, the impact of part oxygenation Irrigation regime group is not obvious, more obvious with the impact of T1, T2, T5, T9 group.
In sum, from the thousand kernel weight of super hybridization rice, T1 group is treated to the best, namely adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopt timer determine at 8:00 every morning.
Four, effect
By different oxygenation process to the population quantity of super hybridization rice rhizospheric microorganism, fiber hydrolization intensity, correlation analysis between the impact of the basic economical character of super hybridization rice and three can be found out, oxygenation process can affect the power of the fiber hydrolization intensity of the how many and super hybridization rice rhizospheric microorganism root-zone microorganism of the population quantity of super hybridization rice rhizosphere soil microorganism to promote tillering of super hybridization rice, plant height, blade, the improvement of the functions such as root system, improve ripening rate and the thousand kernel weight of super hybridization rice, super hybridization rice rhizospheric microorganism population quantity, the basic economical character of fiber hydrolization intensity and super hybridization rice has correlation, comprehensive analysis is super hybridization rice rhizosphere soil microorganism population quantity under reason condition everywhere, fiber hydrolization intensity, the factors such as super hybridization rice thousand kernel weight, can draw: in all processed group, with T1 group and T2 group comparatively outstanding, again from the viewpoint of economic benefit and paddy rice thousand kernel weight, best mode is treated to again with T1 group, namely adopt displacement per minute be 50L air pump by be embedded in experiment water paddy soil in PVC plastic flexible pipe to From The Rhizosphere of Rice soil aerating 4 minutes, the gas transmission time adopts timer to determine at 8:00 every morning.Concrete reason, from the angle of microorganism, from be conducive to super hybridization rice rhizosphere soil microorganism population diversity, promote the growth of super hybridization rice rhizospheric microorganism and activity, the aspect such as concrete kind growth of microorganism of promotion useful super hybridization rice biology analyzes, reason is as follows:
2.1 population diversities being conducive to super hybridization rice rhizosphere soil microorganism develop
As can be seen from the data of this experiment, oxygenation process is on the impact of the population quantity of super hybridization rice rhizosphere soil microorganism, although there is not the phenomenon of the growth definitely suppressing certain quasi-microorganism, but from oxygenation processed group and control group in the microbial population throughout the growing season of super hybridization rice and quantity, the diversity development being conducive to super hybridization rice rhizosphere soil microorganism is irrigated in oxygenation, data in table 3.2 are piled up polygram can find out, in tillering stage, employing oxygenation process T1 on daytime or T2 processed group are best, at heading stage, adopt and process T4 or T5 processed group night for best.The maturing stage again should with daytime oxygenation process T1 or T2 group for the best, chemical group can select T9 group, carry out in tillering stage and maturing stage, in the thousand kernel weight of super hybridization rice, T1 group is higher than T2, T4, T5 group and chemical group, and the cost of oxygenation is once a day lower, considers and adopt T1 processed group to be optimal selection.
The growth of 2.2 promotion super hybridization rice rhizosphere aerobic microbiologicals and activity
Because cellulosic decomposition is mainly decomposed by aerobic microbiological, and the soil microbe quantity utilizing colony counting method to detect might not be aerobic microbiological entirely, need micro organism quantity of the same period and fiber hydrolization intensity to combine to analyze, respectively by super hybridization rice tillering stage, heading stage, the micro organism quantity in maturing stage and fiber hydrolization intensity binding analysis, contrast the table 3.3 of this paper, table 3.4, table 3.5 and table 4.1, table 4.2, table 4.3, can find out that the number that the population of microorganism in oxygenation irrigation process and quantity are large becomes positive correlation with the power of the fiber hydrolization intensity of aerobic microbiological, microbial population that oxygenation Irrigation regime detects can be proved based on aerobic microbiological, as can be seen from related data, oxygenation process is compared with control group, growth and the activity of super hybridization rice rhizosphere aerobic microbiological can be promoted, from microbial population, the correlation of the basic agronomic trait of fiber hydrolization intensity and super hybridization rice and the yield data of super hybridization rice are in general, the fiber hydrolization intensity of T1 group is in tillering stage, heading stage, maturing stage is all apparently higher than the fiber hydrolization intensity of control group, and the thousand kernel weight of T1 group is the highest in all processed group, so be treated to the best with T1 group.
2.3 promote the growth of microorganism being of value to super hybridization rice growth
Oxygenation is irrigated and is conducive to microbial growth, the population quantity increase of microorganism all might not be of value to the growth of plant, the kind of the kind being tested and appraised microorganism especially aerobic microbiological is to analyze the judgement that its character can make science, and oxygenation is irrigated and only contributed to the useful microbial growth of plant growth and just have better using value.Identified by the DNA of Gram’s staining and sample, we find, from the bacillus subtilis that T1, T2, T5, T7, T9 separate, obligate aerobic, has significant inhibitory action to the harmful microorganism Escherichia coli, vibrios, baculoviral etc. be present in water body; From the microorganism stratosphere bacillus that T2 group is separated, the generated energy of the novel microbial fuel cell manufactured with stratospheric bacillus is the twice of the fuel cell power generation amount that other microorganism manufactures, and can be collected the new forms of energy utilizing and become human society.The novel microbial fuel cell manufactured with stratospheric bacillus can also become electric power by refuse derived for some in river by purifying river water on the one hand on the other hand.From the Sphingomonas microorganism that T6, T9 group is separated, have very high metabolic capabilities, physiological characteristic also has several functions, is considered to the microbial resources that a class is novel, has stronger effect to the degraded of the biology of aromatic.In environmental protection and industrial production, there is good application prospect.Wherein from T1 group soil sample, isolate the microorganisms such as candida, Arthrobacter, bacillus amyloliquefaciens, bacillus pumilus, bacillus subtilis strain, maximum and the many growths being conducive to super hybridization rice of the microbial population detected, and these microorganisms do not find and separate in control group, other processed group be also part or be not detected, so from being of value to super hybridization rice microbial population growth aspect, with T1 group for the best.
Claims (9)
1. super hybridization rice mechanical enhancement at a night irrigation method, is characterized in that, in the whole vegetative period of super hybridization rice, night is to the aerating of From The Rhizosphere of Rice soil.
2. super hybridization rice mechanical enhancement at night irrigation method according to claim 1, is characterized in that, aerating mode is adopt displacement per minute to be that the air pump of 50L is by being embedded in PVC plastic flexible pipe in water paddy soil to From The Rhizosphere of Rice soil aerating 4 minutes.
3. super hybridization rice mechanical enhancement at night irrigation method according to claim 2, it is characterized in that, PVC plastic flexible pipe embedding manner is: first in Tanaka's ditching side by side, bury the PVC plastic flexible pipe that diameter is 5 millimeter side by side underground, one end of this PVC plastic flexible pipe is unified adopts iron wire to carry out tightening closed, pricks 2 holes, and wrap up with gauze every 10cm iron wire, the PVC hose other end stretches out outside land for growing field crops, open-ended.
4. super hybridization rice mechanical enhancement at the night irrigation method according to claim 1 or 2 or 3, is characterized in that, once, the time is 8:00 in evening in aerating every day.
5. super hybridization rice mechanical enhancement at night irrigation method according to claim 4, is characterized in that, produce high ground bacillus at rhizosphere soil.
6. super hybridization rice mechanical enhancement at the night irrigation method according to claim 1 or 2 or 3, is characterized in that, aerating twice every day, the time be respectively evening 8:00 and morning 5:30.
7. super hybridization rice mechanical enhancement at night irrigation method according to claim 6, is characterized in that, produces bacillus subtilis strain at rhizosphere soil.
8. super hybridization rice mechanical enhancement at the night irrigation method according to claim 1 or 2 or 3, is characterized in that, once, the time is 8:00 in evening in every other day aerating.
9. super hybridization rice mechanical enhancement at night irrigation method according to claim 7, is characterized in that, produces Sphingomonas at rhizosphere soil.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410508097.7A CN104285758B (en) | 2014-09-28 | 2014-09-28 | Super hybridization rice mechanical enhancement at night irrigation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410508097.7A CN104285758B (en) | 2014-09-28 | 2014-09-28 | Super hybridization rice mechanical enhancement at night irrigation method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104285758A true CN104285758A (en) | 2015-01-21 |
| CN104285758B CN104285758B (en) | 2016-08-24 |
Family
ID=52305932
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410508097.7A Expired - Fee Related CN104285758B (en) | 2014-09-28 | 2014-09-28 | Super hybridization rice mechanical enhancement at night irrigation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104285758B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105850674A (en) * | 2016-04-15 | 2016-08-17 | 湖南农业大学 | System and method for rice field aeration irrigation and drainage simulation control |
| CN111109027A (en) * | 2020-01-21 | 2020-05-08 | 江西省农业技术推广总站 | Seedling cultivation method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090126269A1 (en) * | 2007-11-20 | 2009-05-21 | Wilson Daniel J | Apparatus for growing living organisms |
| CN102812885A (en) * | 2012-09-05 | 2012-12-12 | 湖南农业大学 | Sleeve type crop oxygenation irrigation system |
| CN103947494A (en) * | 2014-05-05 | 2014-07-30 | 中国水稻研究所 | Cultivation method for oxygenation, drainage and irrigation to gleyed paddy fields |
-
2014
- 2014-09-28 CN CN201410508097.7A patent/CN104285758B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090126269A1 (en) * | 2007-11-20 | 2009-05-21 | Wilson Daniel J | Apparatus for growing living organisms |
| CN102812885A (en) * | 2012-09-05 | 2012-12-12 | 湖南农业大学 | Sleeve type crop oxygenation irrigation system |
| CN103947494A (en) * | 2014-05-05 | 2014-07-30 | 中国水稻研究所 | Cultivation method for oxygenation, drainage and irrigation to gleyed paddy fields |
Non-Patent Citations (7)
| Title |
|---|
| 徐春梅等: "增氧对水稻根系生长与氮代谢的影响", 《中国水稻科学》 * |
| 徐欢欢等: "输气灌溉对大棚秋黄瓜主要农艺形状的影响", 《华北水利水电学院学报》 * |
| 熊元基等: "不同加氧处理对超级稻种子萌发和幼苗农艺性状的影响", 《江西农业大学学报》 * |
| 肖卫华等: "作物加氧灌溉的研究", 《现代节水高效农业与生态灌区建设（上）》 * |
| 肖卫华等: "加氧灌溉对烟草生长影响规律的研究", 《中国农村水利水电》 * |
| 胡德勇等: "增氧灌溉对大棚秋黄瓜生长特性的影响研究", 《灌溉排水学报》 * |
| 赵锋等: "根际增氧模式的水稻形态、生理及产量响应特征", 《作物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105850674A (en) * | 2016-04-15 | 2016-08-17 | 湖南农业大学 | System and method for rice field aeration irrigation and drainage simulation control |
| CN105850674B (en) * | 2016-04-15 | 2019-01-15 | 湖南农业大学 | A kind of rice field oxygenation fills row's analog control system and method |
| CN111109027A (en) * | 2020-01-21 | 2020-05-08 | 江西省农业技术推广总站 | Seedling cultivation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104285758B (en) | 2016-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104928212B (en) | Bacillus megaterium X3 and preparation method thereof, application | |
| CN102286412B (en) | Bacillus velezensis and application thereof in tomato blight antagonism | |
| CN102876608B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN103627662B (en) | A kind of Bradyrhizobium sp Arachis and uses thereof | |
| CN104263684B (en) | A kind of product siderophore series bacillus and application thereof | |
| CN108660098A (en) | One plant of bacillus subtilis HG-15 and its microbial inoculum with salt tolerant disease prevention growth-promoting are prepared and application | |
| CN105950520B (en) | A kind of rhizobium of efficient phosphate-solubilizing and its application | |
| CN102382791A (en) | Fermentation process of trichoderma | |
| CN110205273A (en) | A kind of bacillus amyloliquefaciens and its application with growth promotion and resistant effect | |
| CN110591957B (en) | Salt-tolerant alfalfa rhizobia and application thereof | |
| CN102329756A (en) | Streptomyces albospinus strain BWL15-4 for preventing and treating banana vascular wilt and application thereof | |
| CN102168042A (en) | Pseudomonas aeruginosa and application thereof | |
| CN104371945A (en) | Citrobacter freundii with phosphorus-dissolving potassium-dissolving capability and application thereof | |
| CN103642734A (en) | Microbacterium maritypicum and application thereof in preventing sugar beet disease-causing organisms | |
| CN101519644B (en) | Sinorhizobium sp. and application thereof | |
| CN104303954A (en) | Daytime mechanical oxygenation and irrigation method of super rice | |
| CN102329755A (en) | Nonabsorbent streptomyces ahygroscopicus strain BWL58 for preventing and treating banana vascular wilt and application thereof | |
| CN105176893B (en) | A kind of bacillus amyloliquefaciens and its application for preventing crop damping-off | |
| CN107099475A (en) | One plant of Methylotrophic bacillus and its preparation and application of microbial inoculum | |
| CN109735468A (en) | One plant with wide spectrum dross characteristic soybean slowly raw rhizobium and its application and with its preparation compound nitragin | |
| CN112342173B (en) | Bacillus belgii and application thereof | |
| CN107467075B (en) | Application of bacillus pumilus as rice growth promoter | |
| CN104285575A (en) | Super rice oxygen aeration irrigation method | |
| CN100575476C (en) | The bacterial strain B 211 of control cotton verticillium wilt | |
| CN102899280A (en) | Bacillus subtilis HAS and application thereof in preventing and treating sugarcane smut |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160824 Termination date: 20180928 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |