CN104262475A - An antimicrobial peptide [L6, K11]-IsCT and its preparation method and application of antimicrobial peptide [L6, K11]-IsCT - Google Patents
An antimicrobial peptide [L6, K11]-IsCT and its preparation method and application of antimicrobial peptide [L6, K11]-IsCT Download PDFInfo
- Publication number
- CN104262475A CN104262475A CN201410031498.8A CN201410031498A CN104262475A CN 104262475 A CN104262475 A CN 104262475A CN 201410031498 A CN201410031498 A CN 201410031498A CN 104262475 A CN104262475 A CN 104262475A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- isct
- sequence
- aag
- att
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43522—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from scorpions
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Insects & Arthropods (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
An antibacterial peptide [L<6>, K<11>]-IsCT, preparing method thereof and applications of the antibacterial peptide [L<6>, K<11>]-IsCT are disclosed. The sequence of the antibacterial peptide is ILGKILKGIKKLF. The preparing method includes: a step of designing the gene sequence 5'ATTTTGGGTAAGATTTTGAAGGGTATTAAGAAGTTGTTT3' of the antibacterial peptide according to a protein sequence of the antibacterial peptide [L<6>, K<11>]-IsCT and pichia pastoris codon preferences; a step of adding a sequence coding a Kex2 cleavage site and an Not I enzyme digestion sequence to the 5' end of the target gene, and adding a Flag labeler, a termination codon and a Not I enzyme digestion sequence to the 3' end of the target gene; a step of obtaining PCR products of two target genes through PCR, and constructing a recombinant plasmid; a step of introducing the recombinant plasmid pPICZ[alpha]A-IsCT into pichia pastoris to construct recombinant pichia pastoris; and a step of culturing on a culture medium containing ZeocinTM to obtain a monosome clone. By mixing the antibacterial peptide into feed according to a ratio of 5000-5500 unit/kg for a month continuously, a plurality of pig diseases can be prevented and treated.
Description
Technical field
The present invention relates to biological technical field, specifically a kind of antibacterial peptide [L
6, K
11]-IsCT and preparation method thereof and antibacterial peptide [L
6, K
11] application of-IsCT.
Background technology
Antibacterial peptide has good broad-spectrum antibacterial performance, has restraining effect in various degree to intestinal bacteria, Pseudomonas aeruginosa, streptococcus aureus etc.Research in recent years finds that many antibacterial peptides also all have some fungi, virus and cancer cells etc. and strongly kills activity.In recent years, microbiotic spreads unchecked use as additive on pig feed, it can destroy normal microflora in chitling road, during hello microbiotic, resistibility is poor, health normal development is influenced, and the mankind after consumption, and microbiotic will be put aside in vivo, make human body produce a large amount of Resistant strain, finally cause the drug-fast increase of human body.For microbiotic, there is noresidue, height of tiring, the advantage such as toxicological harmless effect are the potential substitute of microbiotic.
Scorpion is the one tradition rare Chinese medicine of China, just describes the medicinal history of scorpion before more than 2000 year.It has antitumor, desinsection, antibacterial and antibiotic effect, and its effect is mainly derived from the venom of scorpion tail poison gland secretion.The main component of venom be a class be made up of 10-100 amino acid there is multiple bioactive micromolecule polypeptide, they can selectivity, specific with the Interaction between membrane proteina on cytolemma, thus change cell to the transparency of ion, regulate the various physiological processes such as various kinds of cell metabolic process and emiocytosis, hormonal action and signal transduction such as cell volume, pH, membrane potential, excitability.Therefore, the antibacterial peptide extracted from scorpion toxin has important theoretical significance and application and development is worth.
Derive from one Cytotoxic (cytotoxic) linear peptides in Madagascar's black pawl scorpion (Opisthacanthus madagascariensis) venom, its molecular weight is 1502.9Da, be made up of 13 amino-acid residues not containing halfcystine, be rich in hydrophobic amino acid (3 Ile, 2 Leu) and basic aminoacids (2 Lys), there is good bacteriostasis property, but owing to having hemolytic activity to mammalian erythropoietin, so its application receives certain restriction.
Report is had to point out, as the derivative of IsCT, [L
6, K
11]-IsCT has extremely low hemolytic, its molecular size range is 1459 Da, has a wide range of applications, at present.For the application based theoretical of this series products in animal-feed.
Summary of the invention
The object of the invention is design and synthesis antibacterial peptide [L
6, K
11]-IsCT gene, import in pichia spp and express, prepare pig feed addictive, replace the microbiotic be suitable in current feed, to reach prevention and therapy pig disease, overcome the adverse consequences that abuse of antibiotics brings and the object reducing production cost.
A kind of novel synthetic antibacterial peptide, comprises following sequence: ILGKILKGIKKLF.
Further, the corresponding DNA sequence dna of described antibacterial peptide sequence is: 5 ' ATT TTG GGT AAG ATT TTG AAG GGT ATT AAG AAG TTG TTT 3 '.
A kind of antibacterial peptide [L
6, K
11] preparation method of-IsCT comprises the following steps: (1), according to antibacterial peptide [L
6, K
11]-IsCT protein sequence and pichia spp codon preference design this antibacterial peptide gene sequence 5 ' ATT TTG GGT AAG ATT TTG AAG GGT ATT AAG AAG TTG TTT 3 ';
(2), at 5 ' end of goal gene add sequence and Not I cleavage sequence of encoded K ex2 cleavage site, hold 3 ' and add Flag label and terminator codon and Not I cleavage sequence;
(3), by PCR obtain the PCR primer of two goal gene, be then connected to carrier pPICZ α A construction recombination plasmid by Sac II with Not I double digestion;
(4), recombinant yeast pichia pastoris is built by recombinant plasmid pPICZ alpha A-IsCT importing pichia spp;
(5), monomer clone is being obtained containing the YPDZ solid medium of ZeocinTM is cultivated;
Further, step (5) culture medium prescription:
Yeast extract 1.0 g
Peptone 2.0 g
Glucose 2.0 g
ZeocinTM 100 μL
Agar 2.0 g
Add water to 100 mL
Culture condition: 30 DEG C;
(6), cultivate in picking monomer clone and BMGY substratum;
Further, step (6) culture medium prescription:
Yeast extract 2.0 g
Peptone 4.0 g
YNB 2.7 g
Water 160 mL
10% glycerine 20 mL
PH6.0 phosphoric acid buffer 20 mL
Culture condition: 30 DEG C, 250 rpm, 24 h.
(7), by nutrient solution 6000 rpm in step (6), 10 min, remove supernatant, connect proper amount of strains and add abduction delivering in BMMY substratum;
Further, step (7) is cultivated and formula:
Yeast extract 2.0 g
Peptone 4.0 g
YNB 2.7 g
Water 176 mL
PH6.0 phosphoric acid buffer 20 mL
500 μ L methyl alcohol are added after sterilizing
Culture condition: controlling initial OD value is 1, shake-flask culture, 30 DEG C, 250 rpm, surveys OD600 every 24 h sampling (0.25 mL) and adds corresponding methyl alcohol (0.25 mL), cultivating 120 h;
(8), by fermented liquid 6000 rpm, 10 min in (7), collect supernatant, adjust pH 6.5-7.0, with 0.22 μm of membrane filtration, fungistatic effect is remarkable;
A kind of antibacterial peptide [L
6, K
11] application of-IsCT, admix by 5000-5500 unit/kg and can prevent and treat multiple swine disease in feed continuous one month.
Antibacterial peptide [L of the present invention
6, K
11]-IsCT, disease resisting effect is good, reduces pig to antibiotic dependence, increases substantially pork quality.
Accompanying drawing illustrates:
Fig. 1: [L
6, K
11]-IsCT amphipathic molecule α-helixstructure figure;
Fig. 2: prepare multiple copied recombinant bacterium techniqueflow;
Fig. 3 inserts the corresponding colony counts that different fragments length obtains;
Fig. 4: fermented liquid is to the fungistatic effect of Gram-negative bacteria and positive bacteria;
Fig. 5: fermented liquid electrophoresis result;
Fig. 6: antibacterial peptide [L
6, K
11] (moving phase is 30% acetonitrile and 1% to-IsCT efficient liquid phase chromatographic analysis.TFA, elutriant is 45% acetonitrile);
Embodiment
Implementation process:
According to antibacterial peptide [L
6, K
11]-IsCT protein sequence design dna sequence;
5’TCCCCGCGGGGA ATT TTG GGT AAG ATT TTG AAG GGT ATT AAG AAG TTG TTT ATTTGCGGCCGCTTTA 3’
Corresponding polydeoxyribonucleotide fragment is synthesized with DNA synthesizer;
Design and synthesis primer 1:5 ' TCCCCGCGGGGAATTTTGGG 3 '
Primer 2: 3 ' CAAATAAACGCCGGCGAAAT 5 '
Gene amplification is carried out by PCR by 2 and 3;
Antibacterial peptide gene and carrier pPICZ α A restriction enzyme Not I and Sac II double digestion are are also connected and composed recombinant plasmid with T4DNA ligase enzyme;
Recombinant plasmid transformed pichia spp is formed recombinant yeast pichia pastoris pPICZ α A-IsCT/X33;
With YPDZ solid medium screening positive clone containing ZeocinTM;
Picking some positive colony in BMGY substratum 30 DEG C, 250 rpm, are cultured to OD600 and reach 2-6(about 24 h);
By nutrient solution in 8 6000 rpm, 10 min, remove supernatant, and connect appropriate thalline and go in BMMY and cultivate, controlling initial OD600 is 1,30 DEG C, 250 rpm.Survey OD600 every 24 h sampling (0.25 mL) and add 1% methyl alcohol (0.25 mL);
10, bacterium liquid ferments after 120 h in 9,6000 rpm, 10 min, collects supernatant and adjusts pH to 6.5-7.0 and with 0.22 μm of membrane filtration;
11, nutrient agar (3.3%) after high-temperature sterilization, treat that its temperature drops to about 45 DEG C, add 1-2 and drip TTC reagent, add for examination intestinal bacteria ATCC8739 in 1:1000 ratio, mixing, import sterile petri dish, every ware 25 mL, punch on substratum with aseptic stainless steel tube after it solidifies, substratum aseptic syringe needle in hole is chosen, then flame back cover in addition, make substratum can fully and plate merge, every hole adds to liquid level and flushes with liquid nutrient medium (about 70 μ L), make marks in flat plate bottom, plate is placed in 37 DEG C of incubators and cultivates 15-24 h, observe fungistatic effect,
12, intestinal bacteria are replaced to repeat 11 steps with streptococcus aureus ATCC25923;
13, measure anti-microbial activity by Hultmark method, reach 5000 units/mL;
14, concentrated broth is admixed in feed by 5000-5500 unit/kg pig of feeding, and compare experiment, the upgrowth situation of observed and recorded pig.
Embodiment one: bacteriostatic activity contrasts
Adopt agar plate diffusion process to antibacterial peptide [L
6, K
11] fungicidal activity of-IsCT detects, and be contrast with penicillin.
Bacterial classification is recovered, inoculation nutrient agar plate 37 DEG C spends the night, picking monomer to be cloned in LB nutrient solution 37 DEG C and to spend the night next day, dilution bacterial concentration is 105-106cfu/mL, be inoculated in 25 mL LB solid mediums by each dull and stereotyped 25 μ L bacterium liquid, solidify rear punching, every hole access concentration is that (penicillin is positive control for 1 mg/mL 80 μ L bacterium liquid, penicillin and ultrapure water, ultrapure water is negative control), cultivate 8h for 37 DEG C, measure inhibition zone size, judge sterilizing ability, and observe inhibition zone change in a week, judge sterilization time length length.The results are shown in Table 1.
Table 11 mg/mL bacterium liquid, the Determination of Antibacterial Activity of penicillin to different bacterium compare
"+" represents 5mm
In upper table+number more multilist show that sterilizing ability is stronger.Can find out that this antibacterial peptide is suitable with microbiotic germicidal action from upper table.In other one week, inhibition zone does not change, and shows that the sterilizing ability time length is long.
Embodiment two: hemolysis in vitro detects
HRBC adds in 40 DEG C of solid LB nutrient solutions according to the ratio of 1:20, is down flat plate, solidifies rear punching by every dull and stereotyped 25 mL, and every hole access concentration is 1 mg/mL 80 μ L antibacterial peptide solution [L
6, K
11]-IsCT, IsCT, tween 80 and ultrapure water (tween 80 is positive control, and ultrapure water is negative control), cultivate 24h for 37 DEG C, observe whether to have haemolysis to iris out within 72h existing, determined whether hemolytic action.The results are shown in Table 2.
Haemolysis circle whether is there is in table 2 antibacterial peptide 72 h
| Antibacterial peptide (1 mg/mL) | Whether there is haemolysis circle | There is haemolysis circle time (h) |
| IsCT | Have | 48 |
| [L 6, K 11]-IsCT | Nothing | 0 |
There is not inhibition zone in " 0 " representative
Antibacterial peptide [L
6, K
11]-IsCT there will be slight hemolysis phenomenon after placement 120 h, shows antibacterial peptide [L
6, K
11]-IsCT haemolysis walks alone extremely low, can ignore.
Embodiment three: containing antibacterial peptide [L
6, K
11]-IsCT feed is on the impact of sow reproductive performance and piglet growth
The pregnant data of table 3
| Group | Sow (head) | Adacrya spot (head) | Constipation (head) |
| Test group | 120 | 85 | 30 |
| Control group | 124 | 65 | 45 |
Table 4 is given a birth data
| Group group | Sow (head) | Produce son (head) | Average product (head) | Total birth weight (jin) | Average birth weight (jin) | Mummy number (head) | Weak young number (head) | Stillborn foetus number (head) |
| Examination test group | 120 | 1369 | 11.40 | 3526.5 | 2.58 | 0 | 33（2.41%） | 31（2.26%） |
| To control group | 124 | 1421 | 11.46 | 3362 | 2.58 | 3 | 80（5.63%） | 54(3.8%) |
Select the sow 244 that same kind, body weight are close, be divided into 2 treatment group at random, test 66 days full phases.Test group is fed containing antibacterial peptide feed, and control group fed normal diet, scale of feeding is identical.Can find out that antibacterial peptide is obviously better than normal diet to treatment sow tear spot and constipation from above two tables, and in farrowing qualitatively higher than control group.Antibacterial peptide is conducive to solving the breeding of ubiquitous sow and production performance problem.
Table 5 antibacterial peptide feed is on the impact of the daily growth indexes of piglet
| Project | Test group | Control group |
| Test head number | 15 | 15 |
| Average age in days | 32 | 32 |
| First starting weight (jin) | 230 | 228 |
| Average weight (jin) | 15．33 | 15．2 |
| Total feed consumption (jin) | 289 | 320 |
| Every day feed consumption/head g | 321．11 | 355．56 |
| Test number of days | 30 | 30 |
| Terminate head number | 15 | 14 |
| End heavy (jin) | 468 | 380 |
| Average weight (jin) | 31．2 | 27．14 |
| Net gain (jin) | 238 | 152 |
| Average daily gain g/ head | 264 | 181 |
| Sickness rate (%) | 6 | 20 |
Table 6 antibacterial peptide feed is on the impact of piglet sickness rate
| Project | Test group | Control group | Improvement rate |
| Dead (head) | Nothing | 1 | 17% |
| Diarrhoea (head) | 6% | 20% | 14% |
| Cough and breathe heavily (head) | 2 | 4 | 50% |
| By hair fluffy (head) | 1 | 2 | 50% |
Piglet 30 after the close wean of age in days, body weight, physique is picked out, random point two groups in table 5.With the baby pig feedstuff on pig farm for control group daily ration, peptide light S100 group piglet diet be then on the basis of control group daily ration 1---14 days by 0.1% amount add, 15----27 days by 0.05% add.Other daily feedings and managements remain unchanged, test period 30 days.Test group feed usage quantity is starkly lower than control group, but far above control group on weight increases, and sickness rate is also fewer than control group a lot, and in table 6, test group piglet sickness rate is lower than control group, illustrates that the prevention of antibacterial peptide feed to weight gain of piglets and disease has very large promoter action.
Claims (4)
1. a novel synthetic antibacterial peptide, is characterized in that, comprises following sequence: ILGKILKGIKKLF.
2. the novel synthetic antibacterial peptide of one according to claim 1, is characterized in that, the corresponding DNA sequence dna of described antibacterial peptide sequence is: 5 ' ATT TTG GGT AAG ATT TTG AAG GGT ATT AAG AAG TTG TTT3 '.
3. an antibacterial peptide [L
6, K
11] preparation method of-IsCT, it is characterized in that, comprise the following steps:
(1), according to antibacterial peptide [L
6, K
11]-IsCT protein sequence and pichia spp codon preference design this antibacterial peptide gene sequence 5 ' ATT TTG GGT AAG ATT TTG AAG GGT ATT AAG AAG TTG TTT3 ';
(2), at 5 ' end of goal gene add sequence and Not I cleavage sequence of encoded K ex2 cleavage site, hold 3 ' and add Flag label and terminator codon and Not I cleavage sequence;
(3), by PCR obtain the PCR primer of two goal gene, be then connected to carrier pPICZ α A construction recombination plasmid by Sac II with Not I double digestion;
(4), recombinant yeast pichia pastoris is built by recombinant plasmid pPICZ alpha A-IsCT importing pichia spp;
(5), monomer clone is being obtained containing the YPDZ solid medium of ZeocinTM is cultivated;
Further, step (5) culture medium prescription:
(6), picking monomer is cloned in BMGY substratum and cultivates;
Further, step (6) culture medium prescription:
(7), by the nutrient solution 6000rpm in step (6), 10min, removes supernatant, connects proper amount of strains and adds abduction delivering in BMMY substratum;
Further, step (7) is cultivated and formula:
Culture condition: controlling initial OD value is 1, shake-flask culture, 30 DEG C, 250rpm, surveys OD600 every 24h sampling (0.25mL) and adds corresponding methyl alcohol (0.25mL), cultivates 120h;
(8), by fermented liquid 6000rpm, 10min in (7), collect supernatant, adjust pH6.5-7.0, with 0.22 μm of membrane filtration.
4. an antibacterial peptide [L
6, K
11] application of-IsCT, it is characterized in that, admix by 5000-5500 unit/kg and can prevent and treat multiple swine disease in feed continuous one month.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410031498.8A CN104262475A (en) | 2014-01-23 | 2014-01-23 | An antimicrobial peptide [L6, K11]-IsCT and its preparation method and application of antimicrobial peptide [L6, K11]-IsCT |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410031498.8A CN104262475A (en) | 2014-01-23 | 2014-01-23 | An antimicrobial peptide [L6, K11]-IsCT and its preparation method and application of antimicrobial peptide [L6, K11]-IsCT |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104262475A true CN104262475A (en) | 2015-01-07 |
Family
ID=52154083
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410031498.8A Pending CN104262475A (en) | 2014-01-23 | 2014-01-23 | An antimicrobial peptide [L6, K11]-IsCT and its preparation method and application of antimicrobial peptide [L6, K11]-IsCT |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104262475A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104782909A (en) * | 2015-03-04 | 2015-07-22 | 深圳市圣西马生物技术有限公司 | Antibacterial peptide mold removal agent for feed, preparation method thereof and animal feed additive |
-
2014
- 2014-01-23 CN CN201410031498.8A patent/CN104262475A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104782909A (en) * | 2015-03-04 | 2015-07-22 | 深圳市圣西马生物技术有限公司 | Antibacterial peptide mold removal agent for feed, preparation method thereof and animal feed additive |
| CN105519798A (en) * | 2015-03-04 | 2016-04-27 | 深圳市圣西马生物技术有限公司 | Animal feed additive |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108314722B (en) | Antibacterial peptide and application thereof | |
| CN105061603B (en) | Antibacterial peptide-lysozyme fusion protein preparation method and applications | |
| CN101649311B (en) | Preparation method of human lysozyme-antibacterial peptide Catesbeianin-1 fusion protein and application of same on preventing and curing cow mastitis | |
| CN101817883B (en) | Housefly cecropin-human lysozyme fusion protein, and preparation method and application thereof | |
| CN102199196A (en) | Gene engineering antibacterial peptide and preparation method and application thereof | |
| CN101173260B (en) | Representation of high disinfection vitality T4 lysozyme in yeast and producing method thereof | |
| CN101173005A (en) | Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same | |
| CN101173004A (en) | Insect antimicrobial peptide Thanatin and method for producing deletion mutant thereof | |
| CN103602603A (en) | Preparation method of bovine lactoferricin pichia pastoris engineering bacterium | |
| CN105238809A (en) | Expressing method of antimicrobial peptide CC31 in bacillus subtilis | |
| CN104823918A (en) | Breeding method for piglet | |
| CN103865933A (en) | Application of WAP (whey acidic protein) gene in transgenosis of fruit fly | |
| CN105255935A (en) | Expression method of antimicrobial peptide CC34 in bacillus subtilis | |
| CN107354190A (en) | The process of antibacterial peptide is prepared using bacillus licheniformis | |
| CN103205370A (en) | Hybrid antibacterial peptide pichia pastoris engineering bacteria and preparation method thereof | |
| CN105801669A (en) | Hybrid anti-biology type antibacterial peptide and preparation method and application thereof | |
| CN105505825B (en) | It is a kind of produce antibiotic streptomycete TXAF2 and its application | |
| CN104262475A (en) | An antimicrobial peptide [L6, K11]-IsCT and its preparation method and application of antimicrobial peptide [L6, K11]-IsCT | |
| CN105646718B (en) | A kind of M1 type macrophage activation peptide and IL-2 fusion protein, fusion, expression vector and its construction method | |
| CN110295211A (en) | A kind of preparation method and application of bacterium selenium-enriched protein | |
| CN104263749B (en) | A kind of expression of scorpion derived antimicrobial peptide IsCT in Pichia pastoris and its clinically application for the treatment of infectious trauma | |
| CN102241756B (en) | High expression of tenebrio molitor antibacterial peptide TmAMP3m in escherichia coli and application of TmAMP3m | |
| CN104418945A (en) | Preparation method of peptide and application of peptide in preparation of medicine and feed additive | |
| CN105732792A (en) | Yeast expressed chicken Cathelicidin antibacterial peptide as well as preparation method and application thereof | |
| CN106554401A (en) | A kind of antibacterial peptide expressed in Pichia sp. and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150107 |