CN101173005A - Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same - Google Patents
Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same Download PDFInfo
- Publication number
- CN101173005A CN101173005A CNA2007101652036A CN200710165203A CN101173005A CN 101173005 A CN101173005 A CN 101173005A CN A2007101652036 A CNA2007101652036 A CN A2007101652036A CN 200710165203 A CN200710165203 A CN 200710165203A CN 101173005 A CN101173005 A CN 101173005A
- Authority
- CN
- China
- Prior art keywords
- lys
- arg
- pro
- ile
- cys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a group of insect Thanatin ramifications with antibacterial action and the salt which is applicable for medicinal use, as well as a preparation method and the use thereof. Approved by the results of a sterilization experiment, a hemolysis experiment and an irritable partial stimulation experiment, the insect Thanatin ramification has bigger antibacterial activity than Thanatin to colon bacillus, Candida albicans, Klebsiella pneumoniae, and staphylococcus aureus. The hemolysis reaction is not incurred when the concentration is 2.5mg/ml without acute toxicity stimulation reaction.
Description
Technical field
The present invention relates to antibacterial peptide derivatives, relating in particular to one group has the insect antimicrobial peptide Thanatin derivative of anti-microbial effect and is applicable to medicinal salt, and its preparation method and purposes.
Background technology
Antibiotic discovery has great importance on the physianthropy history, and countless life has been saved in its use, and people's predicted life was increased more than 10 years.But along with people are extensive use of antibiotic, bacterium also adapts to gradually and it has been produced resistance.Though the antibiosis that uses clinically have more than hundreds of at present, all belongs to chemical small molecules, newly Yan Zhi microbiotic generally also is its structural modification thing, is difficult to solve the drug-fast problem of bacterial antibiotic.Along with the appearance of resistant organism problem, the antibiotic research and development of novel antimicrobial agent have become the problem of extensive concern in the world.
Many biologies of occurring in nature all can produce the small-molecular peptides with anti-microbial activity of protecting body as insect, amphibian animal, plant and mammal.The cytolemma of these antibiotic Toplink and organism is had an effect, thereby reaches the effect of killing bacteria, fungi and virus.Insect antimicrobial peptide all has the positive charge of different quantities, its mechanism of action is, it with positive charge can combine with the negative charge of the phospholipid bilayer of bacterial cell membrane, thereby influence the ionic channel on the film, increase permeability, make bacterium death, simultaneously, antibacterial peptide can also and film on combined with lipopolysaccharide, alleviate the clinical symptom that causes by infectation of bacteria.
Insect antimicrobial peptide Thanatin is a kind of antibacterial peptide that better anti-microbial activity is arranged that extracts from insect.
U.S. Pat P 6770798 discloses and how to utilize genetic engineering technique to express Thanatin (21 amino acid) in plant; strengthen the method for plant to the pathogenic micro-organism resistivity; its 10 amino acid whose core sequences of patent protection; with and 5 aminoacid sequences of 10 amino acid in upstream and downstream, its amino acid total length core sequence is as follows:
Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-
-Gln-Arg-Met
Gly in the formula is a glycine, and Ser is a Serine, and Lys is a Methionin, and Pro is a proline(Pro), and Val is a Xie Ansuan, and Tyr is a tyrosine, and Cys is a halfcystine, and Asn is a l-asparagine, and Arg is an arginine, and Thr is a Threonine, and Gln is a glutamine, and Met is a methionine(Met).
At present, the antibacterial peptide of having reported in the world has hundreds of, its antibacterial range is very wide, gram-positive microorganism, Gram-negative bacteria, fungi and virus all there is restraining effect, owing to antibacterial peptide is to utilize the organism autoimmune mechanism to reach anti-microbial effect, with antibiotic effect a great difference is arranged,, thought that in the world a class has the novel antibacterial medicine of broad prospect of application so it still has germicidal action to present resistant organism clinically.But directly utilize natural antibacterial peptide seldom as the trial of antibacterials.Major cause has: the anti-microbial activity of a lot of natural antibacterial peptides is not high; The cost height of chemosynthesis natural antibacterial peptide, and yield is low; A lot of antibacterial peptides have very strong haemolysis side effect.As the mellitin that extracts from meltittin venom, it has very strong anti-microbial activity, but also has the haemolysis side effect simultaneously, and mellitin is very restricted as the application of antibacterials.
Summary of the invention
The objective of the invention is by gene engineering method, synthesized one group of insect antimicrobial peptide Thanatin derivative with higher anti-microbial activity, low haemolysis side effect with lower production cost.Simultaneously, these antibacterial peptides are applied to prepare in the medicine for the treatment of gram-positive microorganism, Gram-negative bacteria and fungi infestation.
The present invention relates to one group has the insect antimicrobial peptide Thanatin derivative of following structure and is applicable to medicinal salt:
①Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Thr-Gly-Lys-Cys-Gln-Arg-Met；
②Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Ser-Gly-Lys-Cys-Gln-Arg-Met；
③Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Thr-Ala-Lys-Cys-Gln-Arg-Met；
④Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Ser-Gly-Lys-Cys-Gln-Arg-Met；
⑤Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Thr-Ala-Lys-Cys-Gln-Arg-Met；
⑥Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Ser-Ala-Lys-Cys-Gln-Arg-Met。
The difference of insect antimicrobial peptide Thanatin derivative of the present invention and U.S. Pat P 6770798 disclosed Thanatin is as follows:
1. Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Thr-Gly-Lys-Cys-Gln-Arg-Met sports Gln with Thanatin the 12nd amino acids Asn;
2. Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Ser-Gly-Lys-Cys-Gln-Arg-Met sports Ser with Thanatin the 15th amino acids Thr;
3. Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Thr-Ala-Lys-Cys-Gln-Arg-Met sports Ala with Thanatin the 16th amino acids Gly;
4. Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Ser-Gly-Lys-Cys-Gln-Arg-Met sports Gln with Thanatin the 12nd amino acids Asn, and the 15th amino acids Thr sports Ser;
5. Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Thr-Ala-Lys-Cys-Gln-Arg-Met sports Gln with Thanatin the 12nd amino acids Asn, and the 16th amino acids Gly sports Ala;
6. Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Ser-Ala-Lys-Cys-Gln-Arg-Met sports Ser with Thanatin the 15th amino acids Thr, and the 16th amino acids Gly sports Ala.
The invention still further relates to the preparation method of one group of insect antimicrobial peptide Thanatin derivative, this preparation method is a gene engineering method, and its step comprises:
Press the aminoacid sequence synthetic gene fragment of insect antimicrobial peptide derivative, gene fragment connects, plasmid construction, and the clone, fermentation, separation and purification and lyophilize get product.
Specifically, the preparation method of described insect antimicrobial peptide Thanatin derivative may further comprise the steps:
With the synthetic 6 kinds of Thanatin derivative genes that have the zymoplasm cleavage site of PCR method, import pET32a (+) carrier, obtain to contain the expression vector of coding Thanatin derivative dna sequence dna;
With expression plasmid transformed into escherichia coli BL21 (DE3) competent cell, obtain transformant, with 37 ℃ of abduction deliverings of 8 mM lactose 6 hours, the fusion protein expression that obtains accounts for 48% (Tq) of bacterial protein respectively, 50% (Ts), 42% (Ta), 31% (Tqs), 27% (Tqa) and 56% (Tsa);
Amplify with the 10L fermentor tank, seed liquor is inoculated in 5: 100 ratio, 37 ℃, fixedly air flow 4L/min cultivates feed supplement after 6 hours, 0.1mmol/L IPTG induce after 5 hours and put jar, fusion protein expression accounts for 36% (Tq) of bacterial protein, 32% (Ts), 40% (Ta) respectively, 42% (Tqs), 21% (Tqa) and 37% (Tsa);
The gained fusion rotein separates through zymoplasm cutting, anion-exchange column, obtains crude product, and is refining through the high performance liquid phase preparing instrument again, obtains the pure product of Thanatin derivative, and its purity reaches more than 95%.
The invention still further relates to insect antimicrobial peptide derivative Thanatin and be applicable to the purposes of medicinal salt, with the insect antimicrobial peptide derivative of said structure and be applicable to that medicinal salt is used alone or in combination, as the medicine of treatment gram-positive microorganism, Gram-negative bacteria and fungi infestation.
The invention still further relates to insect antimicrobial peptide derivative Thanatin and be applicable to the purposes of medicinal salt, with the insect antimicrobial peptide derivative of said structure and be applicable to that medicinal salt is used alone or in combination, as the auxiliary material of other medicines, or as the additive of food, makeup and feed.
Useful benefit
The present invention has following useful benefit:
1. they have the anti-microbial activity identical or stronger with natural insect antimicrobial peptide.
2. one group of insect antimicrobial peptide derivative is provided, has enlarged the kind of insect antimicrobial peptide derivative, obtained one group of insect antimicrobial peptide derivative with higher anti-microbial activity.
3. have the insect antimicrobial peptide derivative of higher anti-microbial activity with the genetic engineering technique preparation, be suitable for large-scale industrial production.
4. adopt the genetic engineering technique preparation, environmentally friendly, do not have any objectionable impurities and produce.
5. production cost is lower.Every milligram of peptide of chemosynthesis (21 amino acid) needs 560 yuans, only needs 2 yuans and produce every milligram of peptide with present method, cost even lower during mass preparation.
6. in insect antimicrobial peptide Thanatin derivative expression vector establishment, introduced zymoplasm cleavage site (LVPRGS) in the upstream of goal gene, after with the zymoplasm cutting, generate LVPR and GS, and GS is 2 amino acids of Thanatin derivative just, solve toolenzyme cutting back amino acid residue problem cleverly, simplified the purifying process in downstream greatly.
7. sterilization experiment, hemolytic experiment and acute local excitation experiment show, Tq is to intestinal bacteria lung, Candida albicans, Ts and Ta are to intestinal bacteria, Klebsiella pneumonia, Klebsiella pneumonia (ESBL), Candida albicans, Tqa is to streptococcus aureus and Candida albicans, Tqs, Tqa, Tsa to the oidiomycetic anti-microbial activity of white greater than Thanatin; Hemolytic reaction does not all take place in the concentration of 6 kinds of insect antimicrobial peptide Thanatin derivatives when 2.5mg/ml, Product Safety is higher; Has lower acute toxicity irritant reaction.
Embodiment
Below in conjunction with embodiment, specify the present invention.
The used restriction endonuclease of the present invention, ligase enzyme and other molecular biology reagent are available from Novagen company.Electrophoresis, competent cell preparation, conversion equimolecular biological method, ((Sambrook J.) waits work to Sa nurse Brooker to adopt the method for " molecular cloning experiment guide " to carry out, Huang Peitang etc. translate, molecular cloning experiment guide (the 3rd edition), Beijing, Science Press, 2002,8).Plasmid extracts, and adopts Shanghai to give birth to worker's test kit K192, carries out according to operation instruction.
Embodiment 1
The structure of expression vector and the acquisition of transformant
According to ordinary method difference synthetic primer (table 1), different pairings are used through PCR method synthetic Tq, Ts, Ta, Tqs, 6 genes of Tqa, Tsa according to primer, and agarose electrophoresis is separated, and glue reclaims, and obtains the purpose fragment.The purpose fragment is carried out double digestion according to specification sheets respectively with BamH I and XhoI, the low melting-point agarose method reclaims respective segments (" molecular cloning "), pET32a (+) respective segments that by specification is cut and reclaimed with same enzyme with the T4 dna ligase is connected, and obtains to contain the expression vector of coding insect antimicrobial peptide derivative dna sequence dna; With expression vector transformed into escherichia coli DH5 α competent cell, transformant is also identified in screening, and ordinary method is extracted plasmid, serves the order-checking of extra large Invitrogen company, and sequencing result is consistent with expected sequence.
Constructed plasmid called after pET32/Tq, apET32a/Ts, pET32a/Ta, pET32a/Tqs, pET32a/Tqa, pET32a/Tsa.
Table 1 primer sequence
| Primer number | Dna sequence dna | Goal gene |
| SEQ ID NO.1 | 5’-GC GGATCCCTGGTGCCGCGCGGCAGCAAGAAGC | Tq |
| CTGTCCCGATAATCTACTGTCAACGT-3’ | ||
| SEQ ID NO.2 | 5’-CG CTCGAGTTACATACGCTGGCACTTACCTGACC | |
| TACGTTGACAGTAGATTATC-3’ | ||
| SEQ ID NO.3 | 5’-GC GGATCCCTGGTGCCGCGCGGCAGCAAGAAGC | Ts |
| CTGTCCCGATAATCTACTGTAACCGT-3’ | ||
| SEQ ID NO.4 | 5’-CG CTCGAGTTACATACGCTGGCACTTACCGCTCC | |
| TACGGTTACAGTAGATTATC-3’ | ||
| SEQ ID NO.3 | 5’-GC GGATCCCTGGTGCCGCGCGGCAGCAAGAAGC | Ta |
| CTGTCCCGATAATCTACTGTAACCGT-3’ | ||
| SEQ ID NO.5 | 5’-CG CTCGAGTTACATACGCTGGCACTTCCGTGACC | |
| TACGGTTACAGTAGATTATC-3’ | ||
| SEQ ID NO.1 | 5’-GC GGATCCCTGGTGCCGCGCGGCAGCAAGAAGC | Tqs |
| CTGTCCCGATAATCTACTGTCAACGT-3’ | ||
| SEQ ID NO.4 | 5’-CG CTCGAGTTACATACGCTGGCACTTACCGCTCC | |
| TAC GGTTACAGTAGATTATC-3’ | ||
| SEQ ID NO.1 | 5’-GC GGATCCCTGGTGCCGCGCGGCAGCAAGAAGC | Tqa |
| CTGTCCCGATAATCTACTGTCAACGT-3’ | ||
| SEQ ID NO.5 | 5’-CG CTCGAGTTACATACGCTGGCACTTCCGTGACC | |
| TAC GGTTACAGTAGATTATC-3’ | ||
| SEQ ID NO.1 | 5’-GC GGATCCCTGGTGCCGCGCGGCAGCAAGAAGC | Tsa |
| CTGTCCCGATAATCTACTGTAACCGT-3’ |
| SEQ ID NO.6 | 5’-CG CTCGAGTTACATACGCTGGCACTTCCGGCTCC | |
| TACGGTTACAGTAGATTATC-3’ |
Abduction delivering detects and identifies
The positive plasmid of 6 Thanatin derivatives of coding is transformed BL21 (DE3) competent cell respectively, obtain transformant, be inoculated among the LB meat soup 20ml that contains Amp (50 μ g/ml) and cultivate, when bacterium liquid OD value reaches 0.6, add lactose to final concentration 8mM, 37 ℃ of abduction deliverings 6 hours.Centrifugal 10 minutes of 5000rpm gets precipitation.Precipitation is dissolved in the damping fluid of 50mM Tris-HCl and 10mM NaCl (pH8.0) composition ultrasonication 20min.With the centrifugal 20min of solution 12000rpm after ultrasonic, keeping upward respectively, cleer and peaceful precipitation is used for electrophoresis detection.Obvious band (molecular weight is about 2.4KDa) is arranged near the 24KDa molecular weight, be fusion rotein, mainly concentrate in the solution supernatant.The Expression of Fusion Protein amount accounts for 48% (Tq) of bacterial protein respectively, 50% (Ts), 42% (Ta), 31% (Tqs), 27% (Tqa) and 56% (Tsa).
The fermentor tank pilot scale is amplified
According to following condition, engineering bacteria is carried out the pilot scale amplification test:
Fermentation system: 10L LB substratum (Amp100 μ g/mL).
The fermentation scheme: (Amp100 μ g/mL) preservation bacterial classification mono-clonal is forwarded to seed liquor on the LB flat board, and 37 ℃, the 200r/min shaking table is cultivated 7h, and seed liquor is forwarded to fermentor tank in 5: 100 ratio; 37 ℃, fixedly air flow 4L/min cultivates about 6 hours to logarithmic phase, and feed supplement 1LLB adds inductor (IPTG 0.1mmol/L) back simultaneously and continues to cultivate, and puts jar after 5 hours.
SDS-PAGE shows that fusion protein expression accounts for 36% (Tq) of bacterial protein, 32% (Ts), 40% (Ta), 42% (Tqs), 21% (Tqa) and 37% (Tsa).
The enzyme of fusion rotein is cut, separation and purification
Fusion rotein is added in the zymoplasm damping fluid, cut with zymoplasm by 1mg/1U, the enzyme tangent condition is 25 ℃, 16h.After enzyme cuts, separate, obtain Thanatin derivative crude product with DEAE-sephadex A25 anion-exchange column, refining through high performance liquid phase preparing instrument (HPLC, C18 post) again after the lyophilize, obtain pure product, its purity reaches more than 95%.With Regular Insulin is contrast, and product according to Tricine-SDS-PAGE electrophoresis method electrophoresis, is detected its molecular weight and is about 2.4KDa.
Embodiment 2
The mensuration of anti-microbial activity
With the sterile saline compound concentration is 6mg/ml polypeptide sample solution.Test is inoculated in nutrient broth respectively with bacterial classification, in 37 ℃ of cultivations 24 hours, faces with preceding and does 1: 105 times of dilution with stroke-physiological saline solution, gets 12 microbial culture pipes and numbering, adds nutrient broth 1.8ml in the 1st pipe, all adds 1.0ml meat soup in all the other 11 pipes.Add the 0.2ml polypeptide solution in the 1st pipe, take out 1.0ml behind the mixing and join in the 2nd pipe, so repeatedly, be diluted to the 12nd pipe successively, every pipe adds bacterium liquid 0.2ml, and jolting is even gently, puts 37 ℃ and cultivates 24 hours.With the minimum peptide concentration of asepsis growth, as the minimum sample concentration (MIC) of bacteria growing inhibiting.Table 2 is the minimum inhibitory concentration of the Thanatin derivative of preparation among the embodiment 1 to several bacterium.
Table 2 insect antimicrobial peptide Thanatin and derivative minimum inhibitory concentration MIC (mg/ml) thereof
| Polypeptide | Intestinal bacteria | Klebsiella pneumonia | Klebsiella pneumonia (ESBL) | Streptococcus aureus | Bacillus subtilus | Candida albicans |
| Thanatin Tq Ts Ta Tqs Tqa Tsa | 0.0156 0.0156 0.0078 0.0078 0.0156 0.0156 0.0313 | 0.0313 0.0313 0.0156 0.0156 0.0625 0.0313 0.1250 | 0.0313 0.0156 0.0156 0.0156 0.0313 0.0625 0.0625 | 0.1250 0.1250 0.1250 0.1250 0.1250 0.0625 0.1250 | 0.0313 0.0313 0.0313 0.0313 0.0313 0.0313 0.0313 | ＞0.2500 0.0625 0.0625 0.0625 0.0625 0.0313 0.0313 |
Embodiment 3
The mensuration of polypeptide hemolytic activity
Human red cell is suspended in the phosphate buffered saline buffer (pH7.4), obtains red blood cell suspension (5%v/v).Polypeptide is dissolved in the phosphate buffered saline buffer, be made into about 5mg/ml storing solution, get 14 1.5ml centrifuge tubes, in the 1st centrifuge tube, add 1ml polypeptide storing solution, add the 0.5ml phosphate buffered saline buffer in all the other each pipes, taking out 0.5ml polypeptide storing solution from the 1st pipe adds in the 2nd pipe, mix with micro-mixed instrument, from the 2nd pipe, take out 0.5ml solution again and add in the 3rd pipe and mix, by that analogy, promptly be diluted to the 14th pipe successively with coubling dilution, discard 0.5ml, each pipe is added 5% erythrocyte suspension that 0.5ml prepares to final volume 1.0ml, shakes up gently, in 37 ℃ of thermostat containers behind the insulation 60min, in 4000rpm centrifugal 10 minutes, getting supernatant liquor colorimetric under 414nm, is blank in phosphate buffered saline buffer with red blood cell suspension, is 100% haemolysis in 1%TritonX-100 with red blood cell suspension.Percentage of hemolysis is calculated with following formula:
The definition percentage of hemolysis is that 50% o'clock peptide concentration is homolytic dose (HC
50).The result shows, the HC of Thanatin and deletion mutant thereof
50＞2.5mg/ml.
Embodiment 4
Rabbit conjunctival local excitation experiment
Get 6 of healthy rabbits, check situations such as eye conjunctiva blood vessel, corneal transparence and discharge of eye before the experiment earlier, select for use normal person for examination.To be mixed with etc. with physiological saline for the reagent thing and ooze.Each 0.1ml of antibacterial peptide (5mg/ml) that gets preparation among the embodiment 1 splashes in the conjunctiva of left eye capsule, stops 2min; Right eye splashes into amount physiological saline in contrast.Use that magnifying glass observes after the administration 1,24,48, the eye situation of 72h.The result shows that during to 72h, rabbit cornea does not have muddiness, and iris is normal, and conjunctiva does not have congestion and edema, and no secretory product occurs.Show that soup does not have the acute irritation effect to lagophthalmos.
SEQUENCE LISTING
＜110〉Shen, the son dragon
＜120〉insect antimicrobial peptide Thanatin derivative and preparation method thereof and purposes
<130>USP 6770798
<160>6
<170>PatentIn version 3.4
<210>1
<211>21
<212>PRT
＜213〉insect antimicrobial peptide Thanatin derivative 1
<400>1
Gly Ser Lys Lys Pro Val Pro Ile Ile Tyr Cys Gln Arg Arg Thr Gly
1 5 10 15
Lys Cys Gln Arg Met
20
<210>2
<211>21
<212>PRT
＜213〉insect antimicrobial peptide Thanatin derivative 2
<400>2
Gly Ser Lys Lys Pro Val Pro Ile Ile Tyr Cys Asn Arg Arg Ser Gly
1 5 10 15
Lys Cys Gln Arg Met
20
<210>3
<211>21
<212>PRT
＜213〉insect antimicrobial peptide Thanatin derivative 3
<400>3
Gly Ser Lys Lys Pro Val Pro Ile Ile Tyr Cys Asn Arg Arg Thr Ala
1 5 10 15
Lys Cys Gln Arg Met
20
<210>4
<211>21
<212>PRT
＜213〉insect antimicrobial peptide Thanatin derivative 4
<400>4
Gly Ser Lys Lys Pro Val Pro Ile Ile Tyr Cys Gln Arg Arg Ser Gly
1 5 10 15
Lys Cys Gln Arg Met
20
<210>5
<211>21
<212>PRT
＜213〉insect antimicrobial peptide Thanatin derivative 5
<400>5
Gly Ser Lys Lys Pro Val Pro Ile Ile Tyr Cys Gln Arg Arg Thr Ala
1 5 10 15
Lys Cys Gln Arg Met
20
<210>6
<211>21
<212>PRT
＜213〉insect antimicrobial peptide Thanatin derivative 6
<400>6
Gly Ser Lys Lys Pro Val Pro Ile Ile Tyr Cys Asn Arg Arg Ser Ala
1 5 10 15
Lys Cys Gln Arg Met
20
<210>7
<211>59
<212>DNA
＜213〉primer 1
<400>7
gcggatccct ggtgccgcgc ggcagcaaga agcctgtccc gataatctac tgtcaacgt 59
<210>8
<211>54
<212>DNA
＜213〉primer 2
<400>8
cgctcgagtt acatacgctg gcacttacct gacctacgtt gacagtagat tatc 54
<210>9
<211>59
<212>DNA
＜213〉primer 3
<400>9
gcggatccct ggtgccgcgc ggcagcaaga agcctgtccc gataatctac tgtaaccgt 59
<210>10
<211>54
<212>DNA
＜213〉primer 4
<400>10
cgctcgagtt acatacgctg gcacttaccg ctcctacggt tacagtagat tatc 54
<210>11
<211>54
<212>DNA
＜213〉primer 5
<400>11
cgctcgagtt acatacgctg gcacttccgt gacctacggt tacagtagat tatc 54
<210>12
<211>54
<212>DNA
＜213〉primer 6
<400>12
cgctcgagtt acatacgctg gcacttccgg ctcctacggt tacagtagat tatc 54
Claims (6)
1. one group has the insect antimicrobial peptide Thanatin derivative of following structure and is applicable to medicinal salt:
①Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Thr-Gly-Lys-Cys-Gln-Arg-Met(Tq)；
②Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Ser-Gly-Lys-Cys-Gln-Arg-Met(Ts)；
③Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Thr-Ala-Lys-Cys-Gln-Arg-Met(Ta)。
④Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Ser-Gly-Lys-Cys-Gln-Arg-Met(Tqs)；
⑤Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Gln-Arg-Arg-Thr-Ala-Lys-Cys-Gln-Arg-Met(Tqa)；
⑥Gly-Ser-Lys-Lys-Pro-Val-Pro-Ile-Ile-Tyr-Cys-Asn-Arg-Arg-Ser-Ala-Lys-Cys-Gln-Arg-Met(Tsa)。
2. insect antimicrobial peptide Thanatin derivative according to claim 1 and be applicable to medicinal salt is characterized in that: the amino acid of forming the insect antimicrobial peptide derivative of said structure is L type or D type isomer.
3. the preparation method of insect antimicrobial peptide Thanatin derivative, this preparation method is a gene engineering method, its step comprises:
Synthesizing of coding insect antimicrobial peptide derivative amino acid dna sequence dna, the connection of gene fragment, expression plasmid makes up, transforms, fermentation, separation and purification and lyophilize get product.
4. the preparation method of insect antimicrobial peptide Thanatin derivative according to claim 3 is characterized in that:
With the synthetic 6 kinds of Thanatin derivative genes that have the zymoplasm cleavage site of PCR method, import pET32a (+) carrier, obtain to contain the expression vector of coding Thanatin derivative dna sequence dna;
With expression plasmid transformed into escherichia coli BL21 (DE3) competent cell, obtain transformant, with 37 ℃ of abduction deliverings of 8mM lactose 6 hours, the fusion protein expression that obtains accounts for 48% (Tq) of bacterial protein respectively, 50% (Ts), 42% (Ta), 31% (Tqs), 27% (Tqa) and 56% (Tsa);
Amplify with the 10L fermentor tank, seed liquor is inoculated in 5: 100 ratio, 37 ℃, fixedly air flow 4L/min cultivates feed supplement after 6 hours, 0.1mmol/L IPTG induce after 5 hours and put jar, fusion protein expression accounts for 36% (Tq) of bacterial protein, 32% (Ts), 40% (Ta) respectively, 42% (Tqs), 21% (Tqa) and 37% (Tsa);
The gained fusion rotein separates through zymoplasm cutting, anion-exchange column, obtains crude product, and is refining through the high performance liquid phase preparing instrument again, obtains the pure product of Thanatin derivative, and its purity reaches more than 95%.
5. insect antimicrobial peptide Thanatin derivative and be applicable to the purposes of medicinal salt, it is characterized in that: with the insect antimicrobial peptide derivative of said structure and be applicable to that medicinal salt is used alone or in combination, as the medicine of treatment gram-positive microorganism, Gram-negative bacteria and fungi infestation.
6. insect antimicrobial peptide Thanatin derivative and be applicable to the purposes of medicinal salt, it is characterized in that: with the insect antimicrobial peptide derivative of said structure and be applicable to that medicinal salt is used alone or in combination, as the auxiliary material of other medicines, or as the additive of food, makeup and feed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101652036A CN101173005A (en) | 2007-10-30 | 2007-10-30 | Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101652036A CN101173005A (en) | 2007-10-30 | 2007-10-30 | Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101173005A true CN101173005A (en) | 2008-05-07 |
Family
ID=39421772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007101652036A Pending CN101173005A (en) | 2007-10-30 | 2007-10-30 | Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101173005A (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101624420B (en) * | 2009-06-24 | 2012-03-28 | 中国人民解放军第四军医大学 | Group of novel cyclized antibiotic peptides containing gamma-core motif and preparation method as well as application thereof |
| CN101624419B (en) * | 2009-06-24 | 2012-11-28 | 中国人民解放军第四军医大学 | Group of novel uncyclized antibiotic peptides containing gamma-core motif and preparation method as well as application thereof |
| CN102807610A (en) * | 2012-09-05 | 2012-12-05 | 东南大学 | Antibacterial peptides and application of antibacterial peptides to preparation of medicament resisting drug-resistant bacteria |
| CN102816769A (en) * | 2012-08-13 | 2012-12-12 | 华中农业大学 | Hermetia illucens L antibacterial peptide, preparation method and application thereof |
| CN104530200A (en) * | 2014-12-23 | 2015-04-22 | 东南大学 | Small peptide having tumor targeting and cell penetrating properties and application of small peptide |
| CN107827957A (en) * | 2017-11-20 | 2018-03-23 | 吴国球 | Anti- clinical multi-drug resistant bacteria small peptide |
| CN108048510A (en) * | 2018-02-02 | 2018-05-18 | 广东海纳川生物科技股份有限公司 | A kind of purifying process of thanatin antibacterial peptide |
| CN111944058A (en) * | 2020-07-28 | 2020-11-17 | 中国农业大学 | Multifunctional hybrid peptide with antibacterial, anti-inflammatory, endotoxin neutralization and immunoregulation activities, and preparation method and application thereof |
| WO2022028738A1 (en) * | 2020-08-05 | 2022-02-10 | Polyphor Ag | Antimicrobial peptidomimetics |
| WO2022028737A1 (en) * | 2020-08-05 | 2022-02-10 | Polyphor Ag | Antimicrobial peptidomimetics |
-
2007
- 2007-10-30 CN CNA2007101652036A patent/CN101173005A/en active Pending
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101624420B (en) * | 2009-06-24 | 2012-03-28 | 中国人民解放军第四军医大学 | Group of novel cyclized antibiotic peptides containing gamma-core motif and preparation method as well as application thereof |
| CN101624419B (en) * | 2009-06-24 | 2012-11-28 | 中国人民解放军第四军医大学 | Group of novel uncyclized antibiotic peptides containing gamma-core motif and preparation method as well as application thereof |
| CN102816769A (en) * | 2012-08-13 | 2012-12-12 | 华中农业大学 | Hermetia illucens L antibacterial peptide, preparation method and application thereof |
| CN102807610A (en) * | 2012-09-05 | 2012-12-05 | 东南大学 | Antibacterial peptides and application of antibacterial peptides to preparation of medicament resisting drug-resistant bacteria |
| CN104530200A (en) * | 2014-12-23 | 2015-04-22 | 东南大学 | Small peptide having tumor targeting and cell penetrating properties and application of small peptide |
| CN107827957A (en) * | 2017-11-20 | 2018-03-23 | 吴国球 | Anti- clinical multi-drug resistant bacteria small peptide |
| CN107827957B (en) * | 2017-11-20 | 2019-02-26 | 吴国球 | Anti- clinic multi-drug resistant bacteria small peptide |
| CN108048510A (en) * | 2018-02-02 | 2018-05-18 | 广东海纳川生物科技股份有限公司 | A kind of purifying process of thanatin antibacterial peptide |
| CN111944058A (en) * | 2020-07-28 | 2020-11-17 | 中国农业大学 | Multifunctional hybrid peptide with antibacterial, anti-inflammatory, endotoxin neutralization and immunoregulation activities, and preparation method and application thereof |
| CN111944058B (en) * | 2020-07-28 | 2021-12-17 | 中国农业大学 | Multifunctional hybrid peptide with antibacterial, anti-inflammatory, endotoxin neutralization and immunoregulation activities, and preparation method and application thereof |
| WO2022028738A1 (en) * | 2020-08-05 | 2022-02-10 | Polyphor Ag | Antimicrobial peptidomimetics |
| WO2022028737A1 (en) * | 2020-08-05 | 2022-02-10 | Polyphor Ag | Antimicrobial peptidomimetics |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101173005A (en) | Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same | |
| CN101173004A (en) | Insect antimicrobial peptide Thanatin and method for producing deletion mutant thereof | |
| CN111205359B (en) | Scyreproxcin as antibacterial peptide of scylla paramamosain and application thereof | |
| CN102924574A (en) | Antibacterial peptide LZ1 and application of antibacterial peptide in preparation of antibacterial medicament | |
| CN102807610A (en) | Antibacterial peptides and application of antibacterial peptides to preparation of medicament resisting drug-resistant bacteria | |
| CN101041692A (en) | Scorpion analgesic antibacterial active peptide and preparation method thereof | |
| CN111518163A (en) | Application of lipopeptide compounds in resisting novel coronavirus | |
| CN105255935A (en) | Expression method of antimicrobial peptide CC34 in bacillus subtilis | |
| CN107312760A (en) | A kind of N acyl-homoserine lactonases and its medicine | |
| Yin et al. | A specific antimicrobial protein CAP-1 from Pseudomonas sp. isolated from the jellyfish Cyanea capillata | |
| CN109295065A (en) | Larimichthys crocea antibacterial peptide Hepcidin-like and the preparation method and application thereof | |
| CN103102396B (en) | New thiostrepton analog and its preparation method and purposes | |
| CN103965340A (en) | Antibacterial peptides from hylarana guentheri and application of antibacterial peptides | |
| CN101525629B (en) | Gene engineering preparation method of bioactive peptide containing human alpha defensin 5 | |
| CN102898511A (en) | Purification method in preparation of methicillin staphylococcus aureus-resistant recombinant genetic engineering vaccine candidate antigen I12C | |
| CN110468143A (en) | The preparation method and application of antibacterial peptide NZX | |
| CN114478742B (en) | Helicobacter pylori resistant active polypeptide and application thereof | |
| CN107759664B (en) | Small molecular polypeptide AKK10 and application thereof | |
| CN110923289B (en) | Screening method of drug for treating citrus greening disease | |
| CN107266546A (en) | Antibacterial peptide HlDFS1 and its application | |
| CN103467580B (en) | Preparation method and application of artificial antimicrobial peptide MA-D4 | |
| CN101875688B (en) | Folic acid modification step of method for preparing recombinant tumor specific apoptosis factor and application of products of recombinant tumor specific apoptosis factor | |
| CN101921820B (en) | Preparation method of recombinant tumor specificity antiapoptotic factors with activity and application of products thereof | |
| CN108409833B (en) | Novel candida-killing polypeptide FCP1 and preparation method thereof | |
| CN107446026B (en) | Small peptides with clinical multi-drug-resistant bacteria resisting effect, derivatives and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080507 |