CN103865933A - Application of WAP (whey acidic protein) gene in transgenosis of fruit fly - Google Patents

Application of WAP (whey acidic protein) gene in transgenosis of fruit fly Download PDF

Info

Publication number
CN103865933A
CN103865933A CN201410075171.0A CN201410075171A CN103865933A CN 103865933 A CN103865933 A CN 103865933A CN 201410075171 A CN201410075171 A CN 201410075171A CN 103865933 A CN103865933 A CN 103865933A
Authority
CN
China
Prior art keywords
wap
fly
gene
transgenic fly
transgenic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410075171.0A
Other languages
Chinese (zh)
Other versions
CN103865933B (en
Inventor
李殿香
王金星
赵小凡
王蕾
齐梅
刘力
王军
王显伟
黄健
黄加栋
李强
刘晖
王国荣
赵艳霞
李宁
矫强
胡杨
车彤彤
周雷
叶春江
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Chentai Pharmaceutical Co., Ltd.
Original Assignee
University of Jinan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Jinan filed Critical University of Jinan
Priority to CN201410075171.0A priority Critical patent/CN103865933B/en
Publication of CN103865933A publication Critical patent/CN103865933A/en
Application granted granted Critical
Publication of CN103865933B publication Critical patent/CN103865933B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Fodder In General (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to an application of a WAP (whey acidic protein) gene in transgenosis of a fruit fly. According to the application, the WAP gene in Fenneropenaeus chinensis is constructed in the fruit fly and is expressed in the fruit flies. The transgenic fruit fly prepared by utilizing the application has an antibacterial effect.

Description

The application of a kind of WAP gene in fruit bat transgenosis
Technical field
The present invention relates to the application of a kind of WAP gene in fruit bat transgenosis.
Background technology
Along with microbiotic is widely used even abuse, antibiotic remains and bacterial drug resistance problem more and more receive global concern, and research and development novel antibacterial medicine substitutes traditional microbiotic brainstorm subject that also becomes international.
Antibacterial peptide is the micromolecule polypeptide with strong anti-microbial effect producing in organism, in the time of the pathogenic bacteria invasions such as opposing bacterium, virus, fungi, there is very important defense reaction, be considered to be difficult to cause the novel anti-infection medicine of microorganism resistance, have a good application prospect in treatment, preventing cancer and the aspect such as antiviral, anti-infective, become the focus (Splith and Neuntorf, 2011) of new antimicrobial agent research and development.Antibacterial peptide product is the Substitutes For Antibiotic in world lead level, can be for field (Fernebro, 2011 such as medicine company, foodstuffs industry, livestock industry, culture fishery, daily-use chemical industry industry; Mar ó ti et al., 2011).Therefore, research and development antimicrobial peptide medicaments is significant to the development facilitating economic and social.
In recent years, global protein, polypeptide drug market development are rapid, and annual growth reaches 19%(Liang Yuan army and Liu Keliang, 2007).The U.S. once the first world report antibacterial peptide---cecropin has been researched and developed the medicine into feed anticorrosion agent and wound washing composition, be called as " omnipotent peptide ".Japan has using lectin declares as the patent for the treatment of cancer preparation.China's Scientific Research Workers has also carried out much useful work in the research and development of anti-mattress peptide medicine.At the beginning of 1999, the unit consolidation applications such as Agricultural University Of South China high-tech achievement hatching project " test manufacture of Antibacterial Peptide-sterilizing and anti-virus new drug ", the Antibacterial Peptide of research and development is to Gram-negative and positive bacteria, drug tolerant bacteria all has germicidal action, can suppress copying of hepatitis B virus DNA, can selective killing tumour cell, can be further purified and make new drug for monomer, the oral pharmaceutical (yellow nature, 1999) that infect as treatment patience bacterium.2010, Kunming Institute of Zoology, Chinese Academy of Sciences and Suzhou brilliance industry (group) company limited developed jointly antimicrobial peptide medicaments (" Chinese Medicine biotechnology ", 2010).The scientific research institutions such as Life Science and Technology College, Xinjiang Univ. utilize genetic engineering means to obtain high reactivity Sinkiang domestic silkworm antibiotic peptide, there is the effect that suppresses multiple malignant bacteria and dental decayed tooth bacterium, also the growth of relevant tumour cell is had to obvious restraining effect, can research and develop as sterilization, antibacterial, anti-dental caries, antineoplastic antimicrobial peptide medicaments (http://www.tianshannet.com, 2010)." antibacterial peptide research and development, construction project " project is newly gone up in 8 hundred million of the investments in 2010 of the East Sea, Zhejiang Bioceuticals Inc.; main products is the antibacterials " antibacterial peptide Thanatin and mutant thereof " of substitute antibiotics of new generation; 1 ton, the former powder of antibacterial peptide is produced in plan per year, can save every year according to a preliminary estimate the life of 2,000,000 critically ill patients (using the microbiotic nonresponders such as penicillin, Streptomycin sulphate, terramycin, duomycin).Therefore, antimicrobial peptide medicaments is difficult to estimate in the social effect aspect rescue life, guarantee human health and economic worth.
Although antibacterial peptide shows huge new drug development potentiality, but most antibacterial peptides also exist a lot of problems as drug manufacture, such as without protease inhibiting activity easily by protease hydrolysis, organism intensive amount too low directly from biological tissue recombinant protein indissoluble, output and the activity of separation and purification difficulty, prokaryotic expression not high.At present, the antimicrobial peptide medicaments of succeeding in developing is also considerably less.
The patent No. is that 20051004458888 patent discloses and in Chinese prawn, cloned antibacterial peptide gene (being abbreviated as WAP) (Jia YP containing single whey acidic protein structure domain, 2008), and the WAP antibacterial peptide recombinant protein that utilized prokaryotic expression, it exists with insoluble inclusion body form, through sex change, renaturation, obtain pure WAP antibacterial peptide recombinant protein, this WAP antibacterial peptide of vitro detection has the difunctional of broad spectrum antibiotic activity and protease inhibiting activity, shows that WAP antibacterial peptide has good medicament research and development prospect.
Research and development stable performance, active by force, not only bifunctional WAP antibacterial peptide newtype drug antibacterial but also that have a protease inhibiting activity exactly point of penetration of the present invention.
Summary of the invention
The invention provides the application of a kind of WAP gene in fruit bat transgenosis, it utilizes transgenic technology, and the wap gene of Chinese prawn is proceeded to drosophila gene group, has obtained high expression level, genetic stability, has had the WAP transgenic fly strain of antibacterial; Express the transgenic fly of WAP the feed poultry such as chicken, fish and fish and water biology, there is the medicinal effect of significantly disease-resistant and weightening finish.
Concrete technical scheme of the present invention is as follows:
(1) structure of transgenic fly: according to ORF two terminal sequences of WAP gene, design a pair of upstream and downstream primer Wap-f and Wap-r, and introduce respectively at 5 ' end of upstream and downstream primer kpni with xbai restriction enzyme site, primer sequence is as follows:
Wap-f：5’---GG GGTACC ATGGTGAACATCAAGGAAGTTC ---3’ （SEQ ID NO：1）
Wap-r：5’---GCTCT AGATCA TTTTCCGTAGGGAGATCCCA---3’ （SEQ ID NO：2）
Taking Hemocytes In Chinese Shrimp Penaeus Chinensis cDNA as template, PCR angles and gets WAP fragment, utilizes kpni and xbatwo restriction enzyme sites of I, are connected with pUAST plasmid is directed, build carrier for expression of eukaryon wap/pUAST, the WAP fragment sequence (SEQ ID NO:1) (SEQ ID NO:2) through inserting in PCR checking and this plasmid of sequence verification correctly after, by wap/pUAST and Δ 2-3helper plasmid together microinjection enters the wild-type drosophila melanogaster W of the supercilious look 1118embryo in, Δ 2-3on helper plasmid under the assistance of transposon P element, WAP gene by random integration in the genome of drosophila embryos pole cell, pole cell develops into sexual gland in the future, injects the G0 of successful fetal development for becoming fly can produce the genetically modified gamete of band wap, when G0 becomes fly and W 1118when drosophila hybrid, in hybrid generation (G1), there will be wap transgenosis successfully to see red fruit bat, because, on wap/pUAST, there is mini-white marker gene, make drosophila compound eye present redness, examination according to this, just obtains the transgenic fly strain of seeing red; Utilize PCR, from transgenic fly strain genome, be checked through WAP gene fragment, prove that WAP transgenic fly successfully constructs;
Described wap gene is the antibacterial peptide gene that Chinese prawn contains single whey acidic protein structure domain, its nucleotide sequence following (SEQ ID NO:3):
ATGGTGAACA TCAAGGAAGT TCTGATCGTG 30
TCCGTGTTGG TGGCCGCGGT GGCTGTTTCT 60
CCCGCCGATG CTGTTCCAAC GAGACACGCT 90
AGGCCCCGTC CTCAGCCCAG GCCGAGGCCA 120
GGGACGTGTC CGGACACGAG CGACATCGTC 150
TCCATCTGCG TCGTGACGGA ACGCAACTGC 180
TTCTCGGACG GCGAGTGCGG AGCCGGCCAG 210
AAGTGCTGTC CGATTGGCTG CGGGAGAGAG 240
TGCCTGGCTG TGGGATCTCC CTACGGAAAA TGA 273
Its aminoacid sequence following (SEQ ID NO:4):
MVNIKEVLIV SVLVAAVAVS PADAVPTRHA 30
RPRPQPRPRP GTCPDTSDIV SICVVTERNC 60
FSDGECGAGQ KCCPIGCGRE CLAVGSPYGK 90
Described kpnthe nucleotides sequence of I is classified as gGTACC;
Described xbathe nucleotides sequence of I is classified as aGATCA.
(2) assignment of genes gene mapping of wap in transgenic fly: from transgenic fly strain, select the male fly of WAP transgenosis of blood-shot eye illness, respectively with equilibrium system (w-/w-; Sco/Cyo; Sb/Tb), through two-wheeled hybridization, according to the separation phenomenon of filial generation fruit bat phenotype, located wap in I karyomit(e), II karyomit(e) or II number and III number chromosomal 5 WAP transgenic fly strains.
(3) expression of WAP in transgenic fly body: the WAP transgenic fly of having good positioning and Gal4 fruit bat are hybridized, obtain expressing the transgenic fly of wap gene.
The expression of WAP in transgenic fly body is subject to the regulation and control of Gal4-UAS double element system, because different Gal4 strains provides the Gal4 expressing at different tissues, and wap gene in WAP transgenic fly is positioned at the downstream (UAS-wap) of UAS, when the Gal4 incross different as WAP transgenic strain and actin-Gal4, He-Gal4, ppl-Gal4, elav-Gal4, filial generation has had Gal4/UAS-wap double element system, Gal4 can be combined with UAS, orders about the wap gene in UAS downstream and expresses in the whole body of filial generation, hemocyte, fatty body or neural system; And WAP transgenic strain, different Gal4 strain and wild-type W 1118the filial generation of fruit bat, does not possess Gal4/UAS-wap double element system, almost there is no the expression of wap gene.QPCR detected result has also confirmed this point: the filial generation that possesses Gal4/UAS-wap double element system, the expression amount of its wap gene is higher than more than 100 times of contrast not expressing wap gene, and the expression level of wap gene in the filial generation of different transgenic strains has high, normal, basic difference.
The transgenic fly that the present invention is prepared into can be prepared into transgenic fly medicine, and it has significant anti-microbial effect.
The WAP transgenic fly that the present invention builds, by regulation and control and the hybrid experiment of Gal4/UAS-wap double element system, realize the high expression level of WAP antibacterial peptide in fruit bat particular organization, not only overcome the indissoluble of prokaryotic expression WAP recombinant protein, lack the shortcomings such as posttranslational modification and activity decreased, and avoid the trouble of prokaryotic expression WAP albumen aftertreatment, only by hybridization, just WAP can be introduced in the particular organization of transgenic fly as the endo-medicine of fixed point administration, bacteria resistance function and the viability of expressing the fruit bat of WAP are improved, simultaneously, WAP expression amount in transgenic fly is high, Direct-fed poultry and fish have disease-resistant gaining effect, also has the function of external application sterilization to causing scorching fish, three, by the amount reproduction of fruit bat, easily gather in the crops WAP antimicrobial peptide medicaments product, be beneficial to suitability for industrialized production.
WAP transgenic fly disclosed by the invention is a kind of WAP antimicrobial peptide medicaments product of being convenient to for oral administration and external application, there is WAP antimicrobial peptide medicaments simple and convenient, the easy storage of production, environmental protection, be convenient to repetition, cost is low, is suitable for poultry and culture fishery.
Brief description of the drawings
Accompanying drawing 1 is that the carrier for expression of eukaryon wap/pUAST of structure is through the result of PCR checking.Use WAP special primer: Wap-f and Wap-r to carry out PCR detection to 5 wap/pUAST plasmids, obtained and with Hemocytes In Chinese Shrimp Penaeus Chinensis cDNA be template pcr amplification positive findings WAP fragment of a size.
Accompanying drawing 2 is that the carrier for expression of eukaryon wap/pUAST of structure is through the result of sequence verification.Compare with wap gene order, find that the wap fragment sequence inserting in wap/pUAST is entirely true.
Accompanying drawing 3 is PCR detected results of WAP transgenic fly.Extract WAP transgenic fly and W 1118the genomic dna of wild-type drosophila melanogaster, use respectively WAP special primer: Wap-f and Wap-r to carry out PCR detection to these genomic dnas, from WAP transgenic fly genome, amplify and be the equirotal fragment of template amplification WAP with wap/pUAST positive plasmid, and from W 1118in the genome of wild-type drosophila melanogaster, do not amplify wap target fragment.Prove that Chinese prawn wap gene is successfully inserted in the genome of WAP transgenic fly.
Accompanying drawing 4 is wap assignment of genes gene mapping schemas in transgenic fly.First, from carry transgenic fly tx5, t6, t10, t32, the t78 strain of wap, respectively choose the male fly of a blood-shot eye illness, respectively with w-/w-; Sco/Cyo; The hybridization of Sb/Tb equilibrium system virgin fly, the phenotype of observation F1 generation.If there is the sexual segregation of blood-shot eye illness, can locate wap gene on I karyomit(e), if asexuality separates, in male and female individuality, all there is blood-shot eye illness to occur, infer that wap may be inserted on II or III karyomit(e).Then, be inserted in the chromosomal F1 generation fruit bat of I from having got rid of wap, select the male fly of blood-shot eye illness with the sub-genetic stability of balance, as stick up wing, short stubble, blood-shot eye illness (Cyo; Sb, red) or stick up wing, short pupa, bristle and cluster, see red (Cyo; Tb, red) male fly, then with equilibrium system (w-/w-; Sco/Cyo; Sb/Tb) virgin fly carries out second and takes turns hybridization, observes F2 and represents type.If appearance is seen red, few hair sticks up wing (+/+; Sco/Cyo) phenotype, infers that wap goal gene is inserted on III karyomit(e); If occur blood-shot eye illness, short stubble, short pupa, bristle cluster (+/+; Sb/Tb) phenotype, deducibility wap goal gene is inserted on II karyomit(e).
Accompanying drawing 5 is that QPCR detects the expression of results of WAP in transgenic fly.Get the male fly of 5 transgenic fly strain: t6, t78, tx5, t10, t323, make experimental group with the hybridization of Actin-Gal4 virgin fly respectively, be labeled as t6 x rj63, t78 x rj63, tx5 x rj63, t10 x rj63, t32 x rj63, Parent respectively with W 1118drosophila hybrid compares group, and male parent contrasting marking is t6, t78, tx5, t10, t32, and maternal contrast is not marked.The total RNA reverse transcription cDNA that extracts experimental group, male parent and maternal control group hybridization first filial generation sample is template, and with house-keeping gene, actin does internal reference, carries out QPCR detection with Wap-f and Wap-r primer.Found that, on rna level, maternal control group offspring expresses without WAP, male parent control group offspring has few WAP to express, and experimental group offspring all has WAP high expression level, and WAP expression amount is up to more than 100 times of male parent control group offspring, in the filial generation of 5 transgenic strains, what WAP expression amount was the highest is from t6, is secondly t78, is next t10, t32 and tx5 successively.
Accompanying drawing 6 is detected results of WAP transgenic fly antibacterial in high-concentration bacterial environment.X-coordinate is the emergence period of 1-12 days, and ordinate zou is mortality ratio.In emergence period, express the transgenic fly of WAP and do not express WAP Parent contrast fruit bat mortality ratio all increase be in time corresponding raising, and the mortality ratio of control group fruit bat is higher more than 2 times than the mortality ratio of experimental group.Illustrate: on the one hand, along with the increase of incubation time, in substratum, the concentration of bacterium constantly increases, and has accelerated the death of fruit bat, has improved the mortality ratio of fruit bat; On the other hand, compare photograph, the expression of WAP has improved the antibacterial ability of transgenic fly, has reduced their mortality ratio (seeing three curves in figure), also shows, in the environment of high bacteria concentration, WAP transgenic fly compares according to having higher immunizing power.
Accompanying drawing 7 is detected results of the lower WAP transgenic fly antibacterial of bacterium thorn.Choose each 300 of the offspring hero fly C ♂ of the male fly A ♂ of offspring of WAP transgenosis Male Drosophila and He-Gal4 virgin fly hybrid experiment group and the male fly B ♂ of offspring of female fly A ♀, male parent control group and female fly B ♀, maternal control group and female fly C ♀, with dip intestinal bacteria ( escherichia coli), staphylococcus aureus ( staphylococcus aureus) (bacteria concentration is 1.13 × 10 to mixed bacterium solution 9cFU/mL) 1mL asepsis injector syringe needle stimulates, every fruit bat 1 pin, and the fruit bat and the normal inirritative fruit bat that do same stimulation to dip LB contrast, and statistics stimulates fruit bat survival numeral system in latter 6 days to make curve.
Embodiment
The present invention is further illustrated below.
(1) structure of WAP transgenic fly: ORF two terminal sequences according to Chinese prawn containing the antibacterial peptide gene WAP of single whey acidic protein structure domain, design a pair of upstream and downstream primer Wap-f and Wap-r, and introduce respectively at 5 ' end of upstream and downstream primer kpni(GGTACC) with xbai(AGATCA) restriction enzyme site, primer sequence is as follows:
Wap-f: 5’---GG GGTACCATGGTGAACATCAAGGAAGTTC ---3’（SEQ ID NO：1）
Wap-r: 5’---GCTCT AGATCAT TTTCCGTAGGGAGATCCCA---3’（SEQ ID NO：2）
Taking Hemocytes In Chinese Shrimp Penaeus Chinensis cDNA as template, PCR angles and gets WAP fragment, utilizes kpni and xbatwo restriction enzyme sites of I, are connected with pUAST plasmid is directed, build carrier for expression of eukaryon wap/pUAST, correctly (seeing accompanying drawing 1,2) of the WAP fragment sequence inserting in PCR checking and this plasmid of sequence verification, by wap/pUAST and Δ 2-3helper plasmid is injected into the wild-type drosophila melanogaster W of the supercilious look together 1118486 embryos in, Δ 2-3on helper plasmid, under the assistance of transposon P element, wap gene is by random integration in the genome of drosophila embryos, and the successful embryo of transgenosis will develop into the one-tenth fly of blood-shot eye illness, through examination, has obtained the transgenic fly strain (in table 1) of 10 blood-shot eye illness.Utilize PCR, from transgenic fly strain genome, be checked through WAP gene fragment (seeing accompanying drawing 3), prove that WAP transgenic fly successfully constructs.
Table 1 transgenic fly statistics
Embryonal vaccination Hatching larva Sprout wings into fly Be hybridized to fly Transgenic fly Hatching rate Eclosion rate Transformation efficiency
486 309 249 249 10 63.6% 80.6% 2.0%
Table 1 is to build WAP transgenic fly statistics.With wap/pUAST recombinant plasmid with Δ 2-3helper plasmid mixed solution, injection wild-type drosophila melanogaster W 1118486 of embryos, injected embryo has hatched 309 larvas, hatching rate is 63.6%, these larvas sprout wings and G0 for becoming 249 of flies, eclosion rate is 80.6%.G0 is female with 4 for becoming fly to press 2 heros; 2 female and 2 heros; 1 hero is female with 2; The ratio of 1 female and 1 hero, with different in nature wild-type W 1118fruit bat hybridizes, and obtains 127 cross combinations.In 127 cross combinations, the G1 hybrid generation that had 100 combination results, wherein the G1 of 5 combinations has found the WAP transgenic fly of blood-shot eye illness in generation, these 5 combinations respectively have the G0 fruit bat of 2 fertilizations, the transgenic fly strain forming is equivalent to 10, compared with embryonal vaccination number, and transgenosis ratio approximately 2.0%, by the order of cross combination numbering, name these 5 have a WAP transgenic fly be combined as tx5, t6, t10, t32, t78.
(2) assignment of genes gene mapping of WAP transgenic fly: from the G1 generation of tx5, t6, t10, t32, t78, select the male fly of WAP transgenosis of single blood-shot eye illness, respectively with equilibrium system (w-/w-; Sco/Cyo; Sb/Tb) through two-wheeled hybridization, according to the separation phenomenon of filial generation fruit bat phenotype, learn and in G1 generation of t32 and t78, have the wap assignment of genes gene mapping in the G1 generation of I number chromosomal transgenic fly strain, t6, have the wap assignment of genes gene mapping in the G1 generation of II number chromosomal transgenic fly strain, tx5 and t10, to have respectively the wap assignment of genes gene mapping in II number, III number chromosomal two transgenic fly strains.Positioning flow is shown in accompanying drawing 4.
(3) expression of WAP gene in transgenic fly body: the expression of wap gene in transgenic fly body is subject to the regulation and control of Gal4-UAS double element system, because different Gal4 strains provides the Gal4 expressing at different tissues, and wap gene in WAP transgenic fly is positioned at the downstream (UAS-wap) of UAS, as WAP transgenic strain and actin-Gal4, He-Gal4, ppl-Gal4, when elav-Gal4 incross, filial generation has had Gal4-UAS double element system, Gal4 can be combined with UAS, drive the wap gene (UAS-wap) in UAS downstream at the whole body of fruit bat, hemocyte, fatty body or neural system are expressed, QPCR detects discovery, the expression amount of wap is higher than more than 100 times of contrast, and at WAP transgenic fly and wild-type W 1118fruit bat or Gal4 fruit bat and wild-type W 1118in the filial generation contrast of fruit bat, because Gal4-UAS double element system is incomplete, cannot start the expression of wap, the expression amount of wap almost can't detect, and the expression level of wap in the filial generation of different WAP transgenic strains and Gal4 has high, normal, basic different.See accompanying drawing 5.
(4) WAP transgenic fly antibacterial detects: WAP transgenosis Male Drosophila and Gal4 virgin fly are hybridized as experimental group to WAP transgenic fly and W 1118fruit bat, Gal4 fruit bat and W 1118the cross combination of fruit bat is Parent control group.
The first, experimental group and control group cultivate simultaneously containing intestinal bacteria ( escherichia coli), staphylococcus aureus ( staphylococcus aureus), micrococcus luteus ( micrococcus luteus) (bacteria concentration is 1.2 × 10 to three kinds of mixed bacterium 7cFU/mL), on substratum, the offspring who adds up them becomes the variation of fly mortality ratio in emergence number of days.Result shows, the mortality ratio that control group filial generation becomes fly, up to 2 times of experimental group, illustrate in the environment of high bacteria concentration, and WAP transgenic fly compares photograph and has higher antimicrbial power (seeing accompanying drawing 6)
The second, choose experimental group and control group hybridization first filial generation male and female and become each 300 of fly, respectively with dip intestinal bacteria ( escherichia coli), streptococcus aureus ( staphylococcus aureus) (bacteria concentration is 1.13 × 10 to mixed bacterium solution 9cFU/mL) 1mL asepsis injector syringe needle stimulates, and every fly 1 pin contrasts with the fruit bat and the normal inirritative fruit bat that dip LB stimulation, and statistics stimulates the survival number of fruit bat in latter 6 days.Result shows: the normal inirritative fruit bat survival number stimulating with LB changes little, compares photograph, and bacterium is stung the fruit bat that makes to survive and obviously reduces, and the survival number of bacterium thorn experimental group fruit bat is more than doubly (being shown in accompanying drawing 7) of control group 2-7.Bacterium thorn is after 7 days, and substantially all in the dust, the survival of experimental group fruit bat can reach 21 days to control group fruit bat, length and three times of control groups.Detect the content of molds in the experimental group fruit bat body of surviving by colony counting method: what bacterium was stung is every fruit bat 115-130 bacterium, every fruit bat that LB stimulates has 0-3, normal nothing.Illustrating that bacterium stabs has introduced a large amount of bacteriums in fruit bat body, the fruit bat of expressing WAP can have better antibacterial ability than the control group fruit bat of not expressing WAP, causes that their mortality ratio is low and the survival time is long.
(5) medicinal function of WAP transgenic fly detects: WAP transgenic fly is added in feed by different amounts, raise housefly, loach, chicken, raise certain number of days, investigation feeding animals body weight increase situation and sickness rate, mortality ratio, to determine its effect.
Select housefly third-instar larvae and become each 100 of fly, respectively with dip intestinal bacteria ( escherichia coli), streptococcus aureus ( staphylococcus aureus) (bacteria concentration is 1.13 × 10 to mixed bacterium solution 9cFU/mL) 1mL asepsis injector syringe needle stimulates, every fly 1 pin, they are divided into two groups: one group of feed conventional feed and water are for contrast, and another group is experimental group, has mixed the WAP antibacterial peptide crude product (2000mg/kg) extracting from WAP transgenic fly in its feed and water.WAP antibacterial peptide crude product preparation: will express the fruit bat of WAP, pulverize with the ammonium acetate buffer of 0.5mol/L, and by 1:5(W/V) than being immersed in 4-5 hour in this damping fluid, boil 10 minutes, 10000 leave the heart 10 minutes, collect supernatant, make powder ,-20 DEG C of preservations with Freeze Drying Equipment.The survey mortality ratio after 3 days of feeding.Compare control group, experimental group microbiological contamination Musca domestica larva has reduced by 17% and 21% with the mortality ratio that becomes fly, has become fly prolonged survival period 12 days.Larvae pupation rate improves 2 times.In table 2.
Select 300 of the loach of heavy 11 ± 1g, use 1mL asepsis injector, give the subcutaneous intramuscular injection 100 μ L of loach intestinal bacteria ( escherichia coli), staphylococcus aureus ( staphylococcus aureus), subtilis ( bacillus subtilis) (bacteria concentration is 1.13 × 10 to solution 9cFU/mL), 300 loach that have obvious inflammation are divided into three groups: one group of conventional fish meal of feeding is for contrast 1, one group of fish meal that mixes penbritin (100mg/kg) of feeding is contrast 2, it is experimental group that another group is fed the fish meal that mixes WAP fruit bat (3000mg/kg), raises 20 days.Compare according to 1, the mortality ratio of experimental group loach declines 22%, compares according to 2 inflammation cure time early 2 days.In addition, with the normal loach of conventional fish meal fed be control group, and the normal loach of mixing WAP fruit bat (3000mg/kg) fish meal of feeding is experimental group, compare photograph, experimental group loach rate of body weight gain improves 27%, and mortality ratio declines 7%, and vitality strengthens (in table 3).
Table 3 WAP transgenic fly detects table to the medicinal function of loach
Figure 2014100751710100002DEST_PATH_IMAGE002
Select 300 chick (103 ± 1g), 3 groups of average marks, every group provides different feeds: basal feed is that control group 1, basal feed+penbritin (50mg/kg) are that control group 2, basal feed+WAP fruit bat (2000mg/kg) are experimental group, raises 20 days under similarity condition, weighs.Result is, the rate of body weight gain of experimental group, surviving rate compared with control group 1, high 39.8% and 5%, control group 2 is similar with the ability that experimental group improves survivability of chicks, but gaining ability is not obvious.In table 4.
Table 4 WAP transgenic fly detects table to the medicinal function of chick
Figure 2014100751710100002DEST_PATH_IMAGE003
The present invention is by RT-PCR technology, clone Chinese prawn wap gene, utilize transgenic technology, build WAP transgenic fly, pass through drosophila hybrid, 5 clear and definite WAP transgenic fly strains of the wap assignment of genes gene mapping are obtained, be subject to the driving of Gal4, wap gene high expression, the transgenic fly of high expression level WAP has strong inhibit feature to the bacterium of inside and outside, can improve the survival ability of himself, can also serve as medical feed additive, raise poultry and aquatic organism be had to the function of antibacterial, anti-inflammatory, weightening finish.Illustrate that WAP has the feature of novel antimicrobial peptide medicine.
Obviously, WAP transgenic fly can be introduced WAP in fruit bat body as the endo-medicine of fixed point administration by hybridization, improve bacteria resistance function and the viability of fruit bat self, simultaneously, by the amount reproduction of fruit bat, easily gather in the crops a large amount of WAP antimicrobial peptide medicaments products, as fodder additives external application, can suppress the bacterium of environment, also there is the medicinal function that improves biological antibiotic, anti-inflammatory, weightening finish.
Therefore, the WAP transgenic fly that the present invention builds, can be by the regulation and control of Gal4-UAS double element system and drosophila hybrid experiment, realize the high expression level of WAP antibacterial peptide in fruit bat particular organization, WAP recombinant protein indissoluble, shortage posttranslational modification and the active low shortcoming of prokaryotic expression have been overcome, avoid again the trouble of the WAP albumen aftertreatment of prokaryotic expression, as antimicrobial peptide medicaments product, there is simple and convenient, easy storage, the environmental protection of production, be convenient to repetition, be applicable to fruit bat, poultry and aquatic organism aquaculture and use.
<110> University Of Ji'nan
The application of <120> WAP gene in fruit bat transgenosis
<160>2
<210>1
<211>30
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(30)
<223> primer
<400>1
GGGGTACCATGGTGA ACATCAAGGAAGTTC 30
<210>2
<211>31
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(31)
<223> primer
<400>2
GCTCTAGATCATTTT CCGTAGGGAGATCCCA 31
<210> 3
<211> 273
<212> DNA
The biological name in this sequence source of <213>----Chinese prawn ( fenneropenaeuschinensis)
<220>
The antibacterial peptide of <221> single whey acidic protein structure domain
<400> 3
ATGGTGAACA TCAAGGAAGT TCTGATCGTG 30
TCCGTGTTGG TGGCCGCGGT GGCTGTTTCT 60
CCCGCCGATG CTGTTCCAAC GAGACACGCT 90
AGGCCCCGTC CTCAGCCCAG GCCGAGGCCA 120
GGGACGTGTC CGGACACGAG CGACATCGTC 150
TCCATCTGCG TCGTGACGGA ACGCAACTGC 180
TTCTCGGACG GCGAGTGCGG AGCCGGCCAG 210
AAGTGCTGTC CGATTGGCTG CGGGAGAGAG 240
TGCCTGGCTG TGGGATCTCC CTACGGAAAA TGA 273
<210> 4
<211> 90
<212> amino acid
The biological name in this sequence source of <213>----Chinese prawn ( fenneropenaeuschinensis)
<220>
The antibacterial peptide of <221> single whey acidic protein structure domain
<400> 4
MVNIKEVLIV SVLVAAVAVS PADAVPTRHA 30
RPRPQPRPRP GTCPDTSDIV SICVVTERNC 60
FSDGECGAGQ KCCPIGCGRE CLAVGSPYGK 90

Claims (3)

1. the WAP gene application in fruit bat transgenosis.
2. application according to claim 1, is characterized in that, comprises the following steps:
1) structure of transgenic fly: according to ORF two terminal sequences of WAP gene, design a pair of upstream and downstream primer Wap-f and Wap-r, and introduce respectively at 5 ' end of upstream and downstream primer kpni with xbai restriction enzyme site, primer sequence is as follows:
Wap-f：5’---GG GGTACC ATGGTGAACATCAAGGAAGTTC ---3’
Wap-r：5’---GCTCT AGATCA TTTTCCGTAGGGAGATCCCA---3’
Taking Hemocytes In Chinese Shrimp Penaeus Chinensis cDNA as template, PCR angles and gets WAP fragment, utilizes kpni and xbatwo restriction enzyme sites of I, are connected with pUAST plasmid is directed, build carrier for expression of eukaryon wap/pUAST, the WAP fragment sequence through inserting in PCR checking and this plasmid of sequence verification correctly after, by wap/pUAST and Δ 2-3helper plasmid together microinjection enters the wild-type drosophila melanogaster W of the supercilious look 1118embryo in, Δ 2-3on helper plasmid under the assistance of transposon P element, WAP gene by random integration in the genome of drosophila embryos pole cell, pole cell develops into sexual gland in the future, injects the G0 of successful fetal development for becoming fly can produce the genetically modified gamete of band wap, when G0 becomes fly and W 1118when drosophila hybrid, in hybrid generation, there will be wap transgenosis successfully to see red fruit bat, because, on wap/pUAST, there is mini-white marker gene, make drosophila compound eye present redness, examination according to this, just obtains the transgenic fly strain of seeing red; Utilize PCR, from transgenic fly strain genome, be checked through WAP gene fragment, prove that WAP transgenic fly successfully constructs;
(2) assignment of genes gene mapping of wap in transgenic fly: from transgenic fly strain, select the male fly of WAP transgenosis of blood-shot eye illness, respectively with equilibrium system w-/w-; Sco/Cyo; Sb/Tb is through two-wheeled hybridization, according to the separation phenomenon of filial generation fruit bat phenotype, located the location transgenic fly of wap on I karyomit(e), II karyomit(e), II number and III karyomit(e);
(3) expression of WAP in transgenic fly body: the WAP transgenic fly of having good positioning and Gal4 fruit bat are hybridized, obtained the transgenic fly of wap genetic expression;
Described WAP gene is the antibacterial peptide gene that Chinese prawn contains single whey acidic protein structure domain; Its nucleotide sequence is as shown in SEQ ID NO:3; Its aminoacid sequence is as shown in SEQ ID NO:4;
Described kpnthe nucleotides sequence of I is classified GGTACC as;
Described xbathe nucleotides sequence of I is classified AGATCA as.
3. the application of the transgenic fly of wap genetic expression claimed in claim 2 in preparation antibacterials.
CN201410075171.0A 2013-11-30 2014-03-04 The application of a kind of WAP gene in Drosophila transgenic Active CN103865933B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410075171.0A CN103865933B (en) 2013-11-30 2014-03-04 The application of a kind of WAP gene in Drosophila transgenic

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN201310612373.X 2013-11-30
CN201310612373 2013-11-30
CN201310612373X 2013-11-30
CN201410075171.0A CN103865933B (en) 2013-11-30 2014-03-04 The application of a kind of WAP gene in Drosophila transgenic

Publications (2)

Publication Number Publication Date
CN103865933A true CN103865933A (en) 2014-06-18
CN103865933B CN103865933B (en) 2016-03-23

Family

ID=50904942

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410075171.0A Active CN103865933B (en) 2013-11-30 2014-03-04 The application of a kind of WAP gene in Drosophila transgenic

Country Status (1)

Country Link
CN (1) CN103865933B (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104304185A (en) * 2014-09-18 2015-01-28 中国医科大学 Construction and screening of drosophila biological model
CN107287217A (en) * 2017-06-30 2017-10-24 浙江大学 Application of the genes of CvBV29 1 in reduction drosophila immunity and preparation immunocompromised type transgenic drosophila model
CN108184770A (en) * 2018-01-19 2018-06-22 华北理工大学 A kind of Drosophila melanogaster RasV12;Snail tumours migrate the method for building up of model
CN108849765A (en) * 2018-07-27 2018-11-23 江苏省农业科学院 A kind of microinjection of planthopper ovum and artificial incubation method
CN110724708A (en) * 2019-10-16 2020-01-24 浙江大学 Application of CvBV7-1 gene in reducing humoral immune response of drosophila melanogaster
CN111233993A (en) * 2020-03-13 2020-06-05 广西壮族自治区水产科学研究院 Prawn coupling antibacterial peptide and gene, acquisition method of prawn coupling antibacterial peptide, expression vector, recombinant bacterium and application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1810971A (en) * 2005-09-13 2006-08-02 山东大学 Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application
CN101333254A (en) * 2007-06-29 2008-12-31 上海市上海中学 Method for preparing drosophila melanogaster antimicrobial peptide
CN102766635A (en) * 2012-05-25 2012-11-07 上海大学 Construction method of human dcf1 gene transgenic drosophila melanogaster model

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1810971A (en) * 2005-09-13 2006-08-02 山东大学 Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application
CN101333254A (en) * 2007-06-29 2008-12-31 上海市上海中学 Method for preparing drosophila melanogaster antimicrobial peptide
CN102766635A (en) * 2012-05-25 2012-11-07 上海大学 Construction method of human dcf1 gene transgenic drosophila melanogaster model

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
R. CARBALLAR-LEJARAZU ET AL.: "Recombinant scorpine: a multifunctional antimicrobial peptide with activity against different pathogens", 《CELL. MOL. LIFE SCI.》 *
徐天宏 等: "SNF1A转基因果蝇的构建", 《复旦学报》 *
郭向华: "抗菌肽及其转基因动物的研究进展", 《临床和实验医学杂志》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104304185A (en) * 2014-09-18 2015-01-28 中国医科大学 Construction and screening of drosophila biological model
CN107287217A (en) * 2017-06-30 2017-10-24 浙江大学 Application of the genes of CvBV29 1 in reduction drosophila immunity and preparation immunocompromised type transgenic drosophila model
CN108184770A (en) * 2018-01-19 2018-06-22 华北理工大学 A kind of Drosophila melanogaster RasV12;Snail tumours migrate the method for building up of model
CN108184770B (en) * 2018-01-19 2020-11-03 华北理工大学 Drosophila melanogaster RasV12Method for establishing Snail tumor migration model
CN108849765A (en) * 2018-07-27 2018-11-23 江苏省农业科学院 A kind of microinjection of planthopper ovum and artificial incubation method
CN110724708A (en) * 2019-10-16 2020-01-24 浙江大学 Application of CvBV7-1 gene in reducing humoral immune response of drosophila melanogaster
CN111233993A (en) * 2020-03-13 2020-06-05 广西壮族自治区水产科学研究院 Prawn coupling antibacterial peptide and gene, acquisition method of prawn coupling antibacterial peptide, expression vector, recombinant bacterium and application

Also Published As

Publication number Publication date
CN103865933B (en) 2016-03-23

Similar Documents

Publication Publication Date Title
CN103865933B (en) The application of a kind of WAP gene in Drosophila transgenic
CN100366726C (en) Culture solution and preservation solution for coccidian oocyst
US11939576B2 (en) Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules
Zhang et al. Impact of Vibrio parahaemolyticus and white spot syndrome virus (WSSV) co-infection on survival of penaeid shrimp Litopenaeus vannamei
CN104322931B (en) A kind of special feed additive for breeding laying duck
CN102139103B (en) Preparation and application methods of photobacterium damsela vaccines of cynoglossus semilaevis
CN102295694B (en) Antimicrobial polypeptide, and preparation method and application thereof
Santhyia et al. Molecular variations in Vibrio alginolyticus and V. harveyi in shrimp-farming systems upon stress
Olusola et al. The potential of different extraction methods of soursop (Annona muricata Linn) leaves as antimicrobial agents for aquatic animals
CN101376675B (en) Antimicrobial peptide
Scheel et al. Nutrition of plant-sucking Hemiptera
Ali et al. Pathogenicity of Aeromonas hydrophila in silver carp Hypophthalmichthys molitrix and its control trial
CN104996337A (en) Aquatic product culture disease prevention method
CN105121625A (en) Immunogenic composition against aeromonas hydrophila
Cebotari et al. The use of biologically active substances for strengthening of resistance to diseases of honeybee colonies Apis mellifera.
Hettiarachchi et al. Isolation of the bacterium, Vibrio harveyi from cultured shrimp, Penaeus monodon and production of vaccines against the bacterium
CN115119781B (en) Biological prevention and treatment method for ciliate disease
CN101007049A (en) Application of nitric oxide donor and Chinese herbal preparation on nonspecific immune function of prawns
CN110713955A (en) Lactic acid bacteria and application thereof in aquaculture
WO2017079936A1 (en) System expressing heterologous gene and use thereof
CN109997794B (en) Application of sulfadiazine in reproduction behavior of Wolbachia infected short-tube trichogramma
TWI744983B (en) Use of dsrna against dopa decarboxylase
CN106987543A (en) A kind of serratia marcescens BSFL 6 in insect stratiomyiid enteron aisle source and its application
Basavaraja Efficacy of macrogard (an immunostimulant) on growth and survival in shrimpsand carps
CN104140940B (en) A kind of ablation method of tarda and its application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20190103

Address after: 272000 The second one or two-storey business building in the north of the business building of section D along the river of Taibai Mall in Rencheng District, Jining City, Shandong Province

Patentee after: Shandong Chentai Pharmaceutical Co., Ltd.

Address before: 250022 No. 106 Jiwei Road, Shizhong District, Jinan City, Shandong Province

Patentee before: University of Jinan