CN104212808A - Recombinant human interleukin 15 long peptide fragment and production method thereof - Google Patents

Abstract

The invention discloses a recombinant human interleukin (IL) 15 long peptide fragment and a production method thereof. The production method comprises the following steps: obtaining a human IL-15 long peptide fragment gene; establishing an eukaryotic expression vector and transforming the vector into Pichia pastoris X-33; performing resistance screening on high-level secretory-expressed yeast transformants; performing induced expression, purifying the supernate through a nickel column and an ion exchange column to obtain rhIL-15L. The production method is characterized in that the amino acid residue Ala of the site Kex2P1' of the vector pPICZAlphaA is mutated into Pro and the Pichia pastoris X-33 is taken as host bacteria, and therefore, mass high-efficiency stable expression of the rhIL-15L is realized; the recombinant protein rhIL-15L produced by the method is marked with HIS and C-MYC tags and prone to protein purification and detection; besides, the recombinant protein rhIL-15L is a glycoprotein which is modified through glycosylation to a certain extent, and therefore, the recombinant protein rhIL-15L has excellent bioactivity and is capable of effectively maintaining the proliferation and the bioactivity of human NK (Natural killer) cells in vitro and of a mouse in vivo.

Description

The long peptide section of recombinant human interleukin 15 and production method thereof

Technical field

The present invention relates to application recombinant DNA technology producer gene engineered protein technical field of pharmaceuticals, particularly relate to a kind of efficient long peptide section (rhIL-15L) of recombinant human interleukin 15 and production method thereof.

Background technology

Interleukin 15 (also known as IL-15), was found early than 1994 as a kind of SCIF.With interleukin-22, IL-4, IL-7, IL-9, granulocyte colony-stimulating factor, granulocyte-macrophage colony stimutaing factor is similar belongs to 4a helical cytokine family.Interleukin 15 constitutive expression is in the broad variety cell comprising monocyte, scavenger cell, dendritic cell, inoblast, neurocyte etc.People source IL-15 gene is made up of 9 exons and 8 introns, and 5 to 8 exon code lengths are 162 amino acid whose ripe interleukin 15s, the heterotrimer that the acceptor of interleukin 15 is made up of a, β, γ c, and its amino acid primary structure is see Fig. 1 a.As a kind of pleiotrophic cytokine, it plays an important role in innate immunity and the acquired immune response, and the major function of IL-15 is the activation and proliferation of regulatory T-cell and NK cell, and secondly IL-15 also participates in the growth of NK cell with ripe.

Inflammation and the generation of tumour are closely connected and have become a kind of and know together, and can promote the lymphocytic propagation of NK cell, bone-marrow-derived lymphocyte and T due to IL-15 and can maintain these immune cell functions, therefore IL-15 exists certain curative effect for treating some malignant tumours.In the clinical study of a lot of tumour mouse models, investigator finds that IL-15 has antineoplastic action, and a up-to-date result of study shows, IL-15 can extend the life-span of metabolic CT26 colorectal carcinoma mouse.In non-blood tumour, IL-15 participates in the formation of solid tumor hardly directly, but IL-15 can the formation of Tumor suppression indirectly by immunosurveillance to a certain extent.Research finds the level of IL-15 in 40 different entities knurl patients serums and there was no significant difference and all in normal level.In fact, IL-15 can by the growth of certain provide protection Tumor suppression.As everyone knows, cancer morbidity rises thereupon with age, finds that the IL-15 in serum is with advancing age on a declining curve in the research of a mouse.IL-15 can strengthen and increase with the age immunosurveillance ability declined gradually, and can be body in this way provides a kind of protection mechanism to prevent the generation of tumour.

In the clinical study of tumour with the model that catches, find that IL-15 is a kind of effective vaccine adjuvant.Steel and his colleague develop a kind of DC vaccine of magnetic target therapy neu+ mammary cancer, and this DC vaccine can constitutive expression IL-15.The animal of immune IL-15 expression type DC cell and Neu obviously extended than the animal's mammary gland cancer recurrence time of independent immune Neu simultaneously.IL-15Ra/IL-15 coexpression modified version DC vaccine effect is more more obvious than above-mentioned effect.This research shows that IL-15 can overcome the immunne response that CD4 helper defect strengthens anti-tumour antibody simultaneously.Research shows that IL-15 passes through to suppress the apoptosis of TRAIL mediation can overcome CD4 helper defect and allows CD8+ immunne response.IL-15 now just stimulates the immunological adjuvant of immunologic cellular activity in body to assess as a kind of by researchist, present stage, existing clinical effectiveness showed to add in substratum the NK that IL-15 turns out, CD8+T cell, CD8+ memory T cell and dendritic cell are transferred to artifact activity in animal body and significantly improve.

Along with deepening continuously to IL-15 mechanism of action and clinical application research, IL-15 also increases greatly as medicine and its demand of immunological adjuvant.At present, market mainly utilizes prokaryotic expression system (mainly intestinal bacteria) express it, also do not utilize pichia yeast successful expression at present and be purified to the report of IL-15.Colibacillary expression product exists with inclusion bodies usually, and just need can be obtained the IL-15 of activity form by series of complex operations such as sex change renaturation, this method significantly limit the productive rate of activated protein; In addition, prokaryotic hosts is expressed especially at expression in escherichia coli, produces toxin because of the existence of LPS, often needs to carry out analysis to the toxicity expressing purified product and measures; Finally, obtain highly purified albumen often needs through more purification manipulation, and the productive rate of albumen declines in the process, and biological activity also can decrease.Although insect cell expression system and mammalian cell expression system also can express people's recombinant interleukin 15, its production cost is high and productive rate is very low.Therefore, rhIL-15 price is in the market abnormal expensive.

Summary of the invention

Based on this, the object of the present invention is to provide the method for the long peptide section of a kind of efficient stable Restruction human interleukin 15, according to the method Absorbable organic halogens high-level secretory expression rhIL-15L, and it is the rhIL-15L glycoprotein modified through different glycosylation, also has good biologic activity.

The concrete technical scheme solved the problems of the technologies described above is as follows:

An expression and purification method for the long peptide section of recombinant human interleukin 15, comprises the steps:

(1) obtain the human IL-15 L gene of base sequence as described in SEQ ID NO.1, be connected to pMD-20T carrier, obtain plasmid rhIL-15L/pMD-20T, be defined as correct expressed sequence through order-checking;

(2) build and screen carrier for expression of eukaryon: pPICZ α A initial carrier and plasmid rhIL-15L/pMD-20T being carried out respectively EcoR I and the recovery of Not I double digestion purifying, and connect with T4DNA ligase enzyme, obtain recombinant expression vector pPICZ α A/Ala/rhIL-15L, Kex2P ' the 1 site Ala of described recombinant expression vector pPICZ α A/Ala/rhIL-15L is sported Pro, obtains recombinant expression vector pPICZ α A/Pro/rhIL-15L;

(3) recombinant vectors is transformed in eucaryon yeast host: by recombinant vectors pPICZ α A/Pro/rhIL-15L Sac I single endonuclease digestion linearizing, then proceed in pichia yeast X-33 host; Positive colony is obtained through zeocin screening;

(4) screening of high-level secretory expression yeast transformant: positive colony is forwarded in the YPDZ flat board containing zeocin, utilize zeocin concentration gradient to screen and obtain resistance transformant, use BMGY culture medium culturing again, methanol induction, obtain high-level secretory expression yeast transformant;

(5) purifying: with nickel affinity chromatography post and DEAE post, purifying is carried out to rhIL-15L, obtain recombinant protein rhIL-15L.

Wherein in some embodiments, the concrete grammar of the screening of the described high-level secretory expression yeast transformant of step (4) is: be forwarded to by positive colony in the YPDZ flat board containing zeocin, utilize zeocin concentration gradient to screen and obtain resistance transformant, use BMGY culture medium culturing again, centrifugal collecting cell, BMMY substratum re-suspended cell, obtain enchylema, and regulating the concentration of methyl alcohol in enchylema to be 0.95-1.05%, induction 70-74h, obtains high-level secretory expression yeast transformant.

Wherein in some embodiments, the concrete grammar of the zeocin concentration gradient screening described in step (4) is: be forwarded to by positive colony in the YPDZ flat board containing 500 μ g/ml zeocin, screen the transformant of 500 μ g/ml concentration zeocin resistances, again the fresh YPD liquid nutrient medium of described transformant is washed down, the YPDZ being applied to 1500 μ g/ml zeocin after dilution is dull and stereotyped, by that analogy until screen the resistance transformant of 3000 μ g/ml zeocin concentration.

Wherein in some embodiments, the time of the induction described in step (4) is 72h.

Wherein in some embodiments, the concrete grammar of the purifying described in step (5) is: high-level secretory expression yeast transformant is carried out enlarged culturing, supernatant liquor is dialysed through buffer A, recycling nickel affinity chromatography post purifying in AKTA-HPLC system, after using buffer A rinsing again, buffer B gradient elution is utilized to collect the elutriant of mAu>100, damping fluid C is utilized by described elutriant to dialyse, recycling DEAE post purifying in AKTA system, 0-1M NaCl, 20mM Tris pH8.0 linear elution, collect the elutriant of mAu>50, , described buffer A is: 0.2M, 50mM imidazoles, 20mM Tris-HCl PH8.0, and described buffer B is: 0.2M, 0.5M imidazoles, 20mM Tris-HCl PH8.0, and described damping fluid C is: 20mM Tris, PH8.0.

Wherein in some embodiments, step (1) for: obtain the human IL-15 L gene of base sequence as described in SEQ ID NO.1, with described gene for template, by specific primers amplify hIL-15L gene fragment, reclaim PCR primer and be connected to pMD-20T carrier, obtain plasmid rhIL-15L/pMD-20T, be defined as correct expressed sequence through order-checking.

Wherein in some embodiments, the special primer described in step (1) is:

IL-15Lfor：5’-GAATTCGGCATTCATGTCTTCATTTTGG-3’，

IL-15Lfor：5’-GCGGCCGC AGAAGTGTTG ATGAACATTTGG-3’。

Wherein in some embodiments, in the YPDZ flat board described in step (3), the concentration of zeocin is 100 μ g/ml.

An object of the present invention is to provide a kind of long peptide section of recombinant human interleukin 15 adopting aforementioned production method obtained.

The long peptide section of a kind of recombinant human interleukin 15 of the present invention and production method has the following advantages and beneficial effect:

(1) the method for the invention is through a large amount of experiment of contriver and research, draw: with the human IL-15 L gene such as shown in SEQ ID NO.1 for foreign gene, and by transforming Kex2P1 ' site on pPICZ α A carrier, the a large amount of stability and high efficiencies utilizing pichia yeast X-33 successfully to achieve rhIL-15L are first expressed, be specially: Kex2P1 ' site amino acid residues Ala on initial carrier pPICZ α A is sported Pro, and with pichia yeast X-33 for Host Strains, achieve a large amount of high efficiency stable expressions of rhIL-15L; The method can either prevent Host Strains to the degraded of expression product, alleviate host cell metabolism load and expression product to the toxic action of host, also can promote that secretory protein folds by suitable mode, recover its native conformation.

(2) expression product adopting production method of the present invention obtained is with HIS and C-MYC label, be easy to purifying and detect expression product, and show through mass spectroscopy, the rhIL-15L obtained is through to a certain degree glycosylation modified glycoprotein, it has good biological activity, effectively can maintain propagation and the biological activity of people source NK cell in external and Mice Body.

Accompanying drawing explanation

Fig. 1 a is hIL-15 amino acid structure schematic diagram;

Fig. 1 b is that carrier for expression of eukaryon pPICZ α A/Pro/rhIL-15 builds schematic diagram;

Fig. 2 is IL-15 expression vector the selection result western blot schematic diagram; Wherein, 1 is pPICZaA-IL-15S-Tag, and 2 is pPICZaA-Pro-IL-15S-Tag, and 3 be pPICZaA-IL-15L-Tag, 4-be pPICZaA-Pro-IL-15L-Tag, 1# be pPICZ α A, 2# be DPT0h, 3# is DPT72h.

Fig. 3 is that pichia yeast transformant PCR verifies electrophoretic analysis schematic diagram, and wherein, 1,2,3 is pPICZ α A/rhIL-15 pichia yeast transformant, and 1# is the empty bacterial strain of X-33;

Fig. 4 is that under screening in high-level yeast expression and shaking flask condition, the SDS-PAGE of the different induction time of rhIL-15L analyzes schematic diagram;

Fig. 5 is that the western blot of the different induction time of rhIL-15L under high-level yeast transformant shaking flask condition analyzes schematic diagram;

Fig. 6 a is that the protein SDS-PAGE of the nickel affinity chromatography column purification of rhIL-15L analyzes schematic diagram, and wherein, 1# is methanol induction 72h sample, and 2# is that stream wears liquid, and A is the rhIL-15L be purified to;

Fig. 6 b is that the protein SDS-PAGE of the DEAEFF column purification of rhIL-15L analyzes schematic diagram, and 1# is ni-sepharose purification sample, and 2# is ion column purifying sample;

Fig. 7 is that the IL-15L de-glycosylation result SDS-PAGE that nickel affinity chromatography purifying obtains analyzes schematic diagram;

Fig. 8 a is rhIL-15L mass spectroscopy band schematic diagram;

Fig. 8 b is the rhIL-15L de-glycosylation Band1 mass spectrometry results schematic diagram shown in Fig. 8 a;

Fig. 8 c is the rhIL-15L de-glycosylation Band2 mass spectrometry results schematic diagram shown in Fig. 8 a;

Fig. 9 a is that rhIL-15L is to the effect diagram promoting NK cells of human beings Motility and propagation;

Fig. 9 b is that rhIL-15L is to promoting the effect diagram that NK cells of human beings is survived and bred in mouse peripheral blood;

Fig. 9 c is that rhIL-15L is to promoting the effect diagram that NK cells of human beings is survived and bred in mouse spleen;

Fig. 9 d is that rhIL-15L is to promoting the effect diagram that NK cells of human beings is survived and bred in mouse bone marrow cells.

Embodiment

The present invention selects pichia yeast X-33 bacterial strain, and conformability expression plasmid pPICZ α A carrier is by purchased from American Invitrogen company.

The long peptide section cDNA (being defined as rhIL-15L) of synthetic human interleukin 15 of the present invention, purchased from Nanjing Jin Sirui company; During described rhIL-15L synthesis, introduce EcoR1 restriction enzyme site 3 ' at rIL-15L5 ' end and hold introducing Not1 restriction enzyme site, sequence is as shown in SEQIDNO.1;

SEQ ID NO.1：

GAATTCGGCATTCATGTCTTCATTTTGGGCTGTTTCAGTGCAGGGCTTCCTAAAACAGAAGCCAACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGATCTTATTCAATCTATGCATATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATGAAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCATGATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTAACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTGCAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTCT GCGGCCGC

Used medium formula of the present invention is as follows:

1) yeast growth medium (BMGY):

Dissolve 10g yeast extract completely, 20g peptone, is settled to 700ml.121 DEG C of steam high-voltage sterilizing 15-20min, are cooled to room temperature, add 100ml1M potassium phosphate solution, 100ml YNB, 2ml500*Biotin, 100ml10*GY;

2) yeast inducing culture (BMMY):

Dissolve 10g yeast extract completely, 20g peptone, is settled to 700ml.121 DEG C of steam high-voltage sterilizing 15-20min, are cooled to room temperature, add 100ml1M potassium phosphate solution, 100ml YNB, 2ml500*Biotin, 100ml10*M;

3) YPD liquid nutrient medium:

Dissolve 10g yeast extract completely, 20g peptone, 10g glucose sugar, constant volume to 1000ml, 121 DEG C of steam high-voltage sterilizing 15-20min.(YPD solid medium: add 15g agar in YPD liquid nutrient medium).

Below with reference to specific embodiment, the present invention will be further described.

Embodiment 1

The expression and purification method of a kind of efficient rhIL-15L of the present embodiment, mainly comprises the following steps:

1, rhIL-15L full genome is cloned:

Design pair of primers, to recombinate IL-15L gene fragment for template specificity amplifies whole person with the IL-15L cDNA of synthetic, described IL-15L5 ' end is introduced EcoR1 restriction enzyme site 3 ' and is held and introduce Not1 restriction enzyme site (introducing the base sequence of the IL-15L of restriction enzyme site as shown in SEQ ID NO.1) so that follow-up IL-15 fragment inserting expressioning carrier; PCR condition is: 95 DEG C of denaturations, 5min, a thermal cycling; 95 DEG C of thermally denature 30s, 55 DEG C of annealing 30s, 72 DEG C extend 45s, 30 thermal cyclings; 72 DEG C of renaturation 10min.Agarose electrophoresis reclaims amplified fragments and is connected to pMD-20T carrier (purchased from Guangzhou TAKARA company), obtains plasmid rhIL-15L/pMD-20T, and enzyme is cut and nucleic acid sequencing qualification, measures sequence consistent with the IL-15L sequence that genebank announces.IL-15L amino acid primary structure is as Fig. 1 a.

Described IL-15L characteristic amplimer:

IL-15Lfor：5’-GAATTCGGCATTCATGTCTTCATTTTGG-3’(SEQ ID NO.2)；

IL-15Lfor：5’-GCGGCCGCAGAAGTGTTGATGAACATTTGG-3’(SEQ ID NO.3)。

2, pichia yeast secreted expression carrier pPICZ α A/Pro/rhIL-15L is built:

1) with EcoR I and Not I double digestion recombinant plasmid pMD-20T/rhIL-15L, object fragment rhIL-15L is obtained, reaction system following (restriction endonuclease used and damping fluid are all purchased from Thermo company):

2) with EcoR I and Not I double digestion recombinant plasmid pPICZ alpha A/Ala, carrier segments is obtained, reaction system following (restriction endonuclease used and damping fluid are all purchased from Thermo company):

3) by 1) 2) the object fragment of step gained and carrier segments, DNA gel reclaims test kit and reclaims, and this test kit is purchased from Magen company, and concrete operations are undertaken by test kit specification sheets.Build schematic diagram and see Fig. 1 b (recombinant protein of expressing as seen in Fig. contains 6*His label and C-MYC label).

4) the object fragment be recovered to and carrier solution I ligase enzyme (purchased from Dalian TAKARA company) carry out ligation, goal gene prepares to be inserted in the excretion vector reading frame containing secretion signal α-factor, and reaction system is as follows:

Plasmid pPICZ α A/Ala fragment 0.5 μ l

IL-15L object fragment 4.5 μ l

solution Ⅰ 5μl

Obtain recombinant vectors pPICZ α A/Ala/rhIL-15L.

5) carry out sudden change to recombinant vectors pPICZ α A/Ala/rhIL-15LKex2P ' 1 site Ala and obtain recombinant vectors pPICZ α A/Pro/rhIL-15L, IL-15L expression vector the selection result western blot as shown in Figure 2.

3, recombinant plasmid is transformed to pichia yeast X-33:

10 μ g are dissolved in 50 μ l milliQ water after pPICZ α A/Pro/rhIL-15L plasmid Sac I linearizing that EcoR I and Not I double digestion verify, according to invitrigen company operational manual LiCl conversion method, recombinant vectors are transformed in host's pichia yeast bacterium X-33.Positive colony screening is carried out with containing the antibiotic YPDZ flat board of 100 μ g/ml zeocin after transforming, PCR is utilized to verify (respectively with 5 ' AOX1primer and rhIL-15L cDNA3 ' amplimer for primer, PCR electrophoresis result as shown in Figure 3) to transformant.

4, the screening of high-level secretory expression yeast transformant:

The YPD that positive colony is forwarded to containing 500 μ g/mL Zeocin is dull and stereotyped, has screened the transformant of Zeocin resistance, YPD liquid nutrient medium is utilized to be washed down by the bacterium colony of YPD flat board the transformant of the YPD flat board of 500 μ g/mL Zeocin, after dilution, the YPD being applied to 1500 μ g/mL Zeocin is dull and stereotyped, the YPD again transformant of the YPD plated growth of 1500 μ g/mL Zeocin being applied to after dilution 3000 μ g/mL Zeocin is dull and stereotyped, finally obtain the most resistance be the transformant of 3000 μ g/mL Zeocin with BMGY culture medium culturing to optical density value >10.0, centrifugal collecting cell, its methanol concentration is made to be 1.0% with BMMY substratum re-suspended cell, 30 DEG C, induce under 200rpm condition after 120 hours, analyze through SDS-PAGE, obtain high-level secretory expression rhIL-15L yeast transformant (result as shown in Figure 4).Under shaking flask condition, the rhIL-15L that this transformant is expressed is more than 30mg/L.

5, the expansion of rhIL-15L under shaking flask condition is expressed

High-level secretory expression yeast transformant is in 1L BMGY culture medium culturing to optical density value >10, centrifugal collecting cell, its methanol concentration is made to be 1.0% with 200mL BMMY substratum re-suspended cell, every 24 hours sampling once and add methyl alcohol once to final concentration be 1%, after inducing 120 hours, measure the sample total protein content of each time period, gained Sample supernatants is analyzed through SDS-PAGE and western blot (primary antibodie is anti-His label monoclonal antibody).Under expansion shaking flask inductive condition, the rhIL-15L that this transformant is expressed is more than 50mg/L; Under shaking flask condition, induce 72 hours, the expression amount of rhIL-15L reaches maximum, then the time extending induction understands its expression level and do not significantly improve, and from 96h, rhIL-15L total protein accumulation volume starts to decline (as Fig. 5) on the contrary.

6, the nickel affinity column purification of rhIL-15L

Induction supernatant liquor is centrifugal in 4 DEG C, collect centrifugal after supernatant liquor, 0.2M NaCl, 50mM imidazoles, after 20mM Tris pH8.0 dialyses, utilize nickel affinity chromatography column purifying in ATKA-HPLC system, 0.2M NaCl, 50mM imidazoles, after the rinsing of 20mM Tris pH8.0 damping fluid, utilize 0.2M NaCl, 500mM imidazoles, the sample that 20mM Tris pH8.0 damping fluid linear elution is collected, obtained protein sample is utilized 20mM Tris, the damping fluid dialysed overnight of PH8.0, utilize DEAE post purifying in AKTA system, 0-1M NaCl, 20mM Tris pH8.0 linear elution, (mAu is protein uv-absorbing light unit to the elutriant of collection mAu>50, be used to indicate in AKTA system in elution fraction and whether have albumen to wash out), protein sample is through SDS-PAGE, result shows, the albumen be purified to is that three master tapes are respectively about 18K, the albumen of 22K and 55K is (as Fig. 6 a, Fig. 6 b).Illustrate that the albumen of expressing is with correct His × 6 label and C-MYC label, can utilize the effective purifying of nickel affinity purifying to obtain this recombinant protein.

7, peptiolipid line atlas analysis and comparison:

The albumen that nickel affinity is purified to is after SDS-PAGE analyzes, find that three sizes are respectively the albumen of 18K, 22K and 55K, nickel affinity purification to albumen SDS-PAGE after deglycosylating enzyme PNaseF (NEB company) process analyze discovery 55K place molecular weight of albumen and obviously decline (as Fig. 7), from glue cut two master tapes (as Fig. 8 a), carry out peptide fingerprinting spectrum analysis, result shows, two albumen are all IL-15L (as Fig. 8 b, 8c), and glycosylation modified through in various degree of the expression product of IL-15L in yeast is described.

8, the analysis of biological activity of rhIL-15L:

RhIL-15L active determination in vitro:

From human umbilical cord blood mononuclear cell, NK cell is isolated, by NK cell with 1x10 by the method for MACS magnetic bead sorting ⁶/ hole kind is in 24 orifice plates, if two groups, one group adds PBS, one group of rhIL-15L adding 50ng/ml, at the 4th day and the 8th day collecting cell, detects NK cell proportion with streaming antibody CD56-APC and CD3-FITC.Result shows, the 4th day (D4), and the NK cell proportion not adding rhIL-15L is 43.7%, and the NK cell proportion adding rhIL-15L is 67.6%; 8th day (D8), the NK cell proportion not adding rhIL-15L is 16.8%, the NK cell proportion adding rhIL-15L was 71.5% (as illustrated in fig. 9), this result shows, the rhIL-15L that present method is purified to can promote Motility and the propagation of NK cells of human beings, has good Bioactivity.

RhIL-15L activity in vivo measures:

Be separated from human cord blood by Ficoll density gradient centrifugation (800g, 20min) and obtain mononuclearcell, then from mononuclearcell, isolate NK cell by MACS magnetic bead sorting.After NK cell PBS washes, get in immunodeficient mouse body by vena ophthalmica injection immediately, every 3 × 10 ⁶individual cell.The mouse of injection NK cell is divided into two groups, and inject rhIL-15L by vena ophthalmica for one group, every mouse beats once every day, and each 200 μ g rhIL-15L, make a call to four days continuously; Another group beats PBS in contrast.5th day, gather the peripheral blood of mouse, spleen and medullary cell, after splitting erythrocyte, after washing twice with streaming antibody hCD45-PE and CD56-APC dyeing 1h, PBS, by the ratio of flow cytomery NK cells of human beings.Result shows, beat in the peripheral blood of PBS control group mice, spleen and marrow and all fail NK cells of human beings to be detected, and beat in the peripheral blood of rhIL-15L mouse, spleen and marrow and all there is NK cells of human beings, CD45+CD56+, ratio is respectively 1.81%, 0.907% and 0.015% (Fig. 9 b-9d).This result shows, the rhIL-15L that present method is purified to can promote to survive and propagation in the body of NK cells of human beings, has good in vivo bioactivity.

Comparative example 1

The expression and purification method of a kind of recombinant human interleukin 15 of this comparative example, it mainly comprises the following steps:

(1) human cloning IL-15 long peptide section and small peptide fragment gene: from the long peptide section cDNA (being defined as rIL-15L) of Nanjing Jin Sirui company synthetic human interleukin 15, synthesis is introduced EcoR1 restriction enzyme site 3 ' end at rIL-15L5 ' end simultaneously and is introduced Not1 restriction enzyme site so that follow-up IL-15 fragment inserting expressioning carrier, again with this cDNA for template, complete hIL-15L gene fragment is gone out with specific primers amplify, reclaim PCR primer and be connected to pMD-20T carrier, the rhIL-15L/pMD-20T plasmid obtained is defined as correction sequence through order-checking; On rIL-15L basis, remove leading peptide, build human interleukin 15 mature peptide (being defined as human interleukin 15 small peptide section and rIL-15S) cloning vector rhIL-15S/pMD-20T, the long peptide section of interleukin 15 and small peptide section amino acid structure are shown in Fig. 1 a simultaneously;

(2) build and screen carrier for expression of eukaryon: first pPICZ α A initial carrier (P1 ' site amino acids be Ala) and plasmid rhIL-15L/pMD-20T being carried out the recycling of EcoR1 and Not1 double digestion purifying respectively, then the expression vector pPICZ α A/Ala reclaimed is connected with object fragment rhIL-15L T4DNA ligase enzyme, obtains rhIL-15L recombinant expression vector pPICZ α A/Ala/rhIL-15L (construction strategy is shown in Fig. 1 b).In like manner build rhIL-15S recombinant expression vector pPICZ α A/Ala/rhIL-15S.Recombinant expression vector pPICZ α A/Ala/rhIL-15 and pPICZ α A/Ala/rhIL-15S finds rhIL-15L and rhIL-15S secreting, expressing hardly after transforming pichia yeast expression strain X-33 screening positive clone methanol induction secreting, expressing, can greatly determine due to yeast endo-protease Kex2P1 ' site amino acid residues and affect the final total amount of foreign protein synthesis and secretion, and the optimum P1 ' site of protein secretion yield with different recombinant protein different and difference to some extent, screening the optimum P1 ' amino-acid residue of secrete heterologous proteins expression level by screening operation in early stage is Pro, therefore on original expression vector pPICZ α A/Ala/rhIL-15L and pPICZ α A/Ala/rhIL-15S basis, we construct the expression vector pPICZ α A/Pro/rhIL-15L and pPICZ α A/Pro/rhIL-15S that P ' 1 site is optimum amino acid Pro.After pPICZ α A/Pro/rhIL-15L and pPICZ α A/Pro/rhIL-15S expression vector transform X-33, by analyzing methanol induction result, we find to only have rhIL-15L to have expression, even if rhIL-15S did not still express (see Fig. 2 western blot result) in after carrier P ' 1 site is optimized.Therefore, a kind of pichia yeast expression vector pPICZ α A/Pro/rhIL-15L for the long peptide section of efficient secretory expression rhIL-15 is obtained by screening the present invention.

The above embodiment only have expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims (7)

1. a production method for the long peptide section of recombinant human interleukin 15, is characterized in that, comprise the steps:

(1) obtain the human IL-15 L gene of base sequence as shown in SEQ ID NO.1, be connected to pMD-20T carrier, obtain plasmid rhIL-15L/pMD-20T;

(2) build and screen carrier for expression of eukaryon: pPICZ α A initial carrier and plasmid rhIL-15L/pMD-20T being carried out respectively EcoR I and the recovery of Not I double digestion purifying, and connect with T4DNA ligase enzyme, obtain recombinant expression vector pPICZ α A/Ala/rhIL-15L, Kex2P ' 1 site Ala on described recombinant expression vector pPICZ α A/Ala/rhIL-15L is sported Pro, obtains recombinant expression vector pPICZ α A/Pro/rhIL-15L;

(3) recombinant vectors is transformed in eucaryon yeast host: by recombinant vectors pPICZ α A/Pro/rhIL-15L Sac I single endonuclease digestion linearizing, then proceed in pichia yeast X-33 host; Positive colony is obtained through the YPDZ plate screening containing zeocin;

(4) screening of high-level secretory expression yeast transformant: positive colony is forwarded in the YPDZ flat board containing zeocin, utilize zeocin concentration gradient to screen and obtain resistance transformant, use BMGY culture medium culturing again, methanol induction, obtain high-level secretory expression yeast transformant;

(5) purifying: with nickel affinity chromatography post and DEAE post, purifying is carried out to rhIL-15L, obtain recombinant protein rhIL-15L.

2. the production method of the long peptide section of recombinant human interleukin 15 according to claim 1, it is characterized in that, the concrete grammar of the screening of the described high-level secretory expression yeast transformant of step (4) is: be forwarded to by positive colony in the YPDZ flat board containing zeocin, utilize zeocin concentration gradient to screen and obtain resistance transformant, use BMGY culture medium culturing again, centrifugal collecting cell, BMMY substratum re-suspended cell, obtain enchylema, and regulate methyl alcohol final concentration in enchylema to be 0.95-1.05%, induction 70-74h, obtains high-level secretory expression yeast transformant.

3. the production method of the long peptide section of recombinant human interleukin 15 according to claim 2, it is characterized in that, the concrete grammar of the zeocin concentration gradient screening described in step (4) is: be forwarded to by positive colony in the YPDZ flat board containing 500 μ g/ml zeocin, screen the transformant of 500 μ g/ml concentration zeocin resistances, again the fresh YPD liquid nutrient medium of described transformant is washed down, the YPDZ being applied to 1500 μ g/ml zeocin after dilution is dull and stereotyped, the YPD again transformant of the YPD plated growth of 1500 μ g/mL Zeocin being applied to after dilution 3000 μ g/mL Zeocin is dull and stereotyped, screen the resistance transformant of 3000 μ g/ml zeocin concentration.

4. the production method of the long peptide section of recombinant human interleukin 15 according to claim 2, is characterized in that, the time of the induction described in step (4) is 72h.

5. the production method of the long peptide section of the recombinant human interleukin 15 according to any one of claim 1-4, it is characterized in that, the concrete grammar of the purifying described in step (5) is: high-level secretory expression yeast transformant is carried out enlarged culturing, supernatant liquor is dialysed through buffer A, recycling nickel affinity chromatography post purifying in AKTA-HPLC system, after use buffer A rinsing, recycling buffer B gradient elution collects the elutriant that mAu is greater than 100, damping fluid C is utilized by described elutriant to dialyse, recycling DEAE post purifying in AKTA system, 0-1M NaCl, 20mM Tris pH8.0 linear elution, collect the elutriant of mAu>50, , described buffer A is: 0.2M NaCl, 50mM imidazoles, 20mM Tris-HCl pH8.0, and described buffer B is: 0.2M NaCl, 0.5M imidazoles, 20mM Tris-HCl pH8.0, and described damping fluid C is: 20mM Tris pH8.0.

6. the production method of the long peptide section of the recombinant human interleukin 15 according to any one of claim 1-4, is characterized in that, in the YPDZ flat board described in step (3), the concentration of zeocin is 100 μ g/ml.

7. the long peptide section of recombinant human interleukin 15 that the production method as described in any one of claim 1-6 is obtained.