CN105647970A - Prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and preparation method thereof - Google Patents
Prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and preparation method thereof Download PDFInfo
- Publication number
- CN105647970A CN105647970A CN201610095423.5A CN201610095423A CN105647970A CN 105647970 A CN105647970 A CN 105647970A CN 201610095423 A CN201610095423 A CN 201610095423A CN 105647970 A CN105647970 A CN 105647970A
- Authority
- CN
- China
- Prior art keywords
- pap
- csf
- fusion protein
- cell
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/53—Colony-stimulating factor [CSF]
- C07K14/535—Granulocyte CSF; Granulocyte-macrophage CSF
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5412—IL-6
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03002—Acid phosphatase (3.1.3.2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Abstract
The invention relates to preparation of a genetic recombinant protein, in particular to a prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and a preparation method thereof. The preparation method comprises steps of design and synthesis of primers, gene amplification and sequencing, construction of a recombinant vector pc DNA3.1-PAP-GM-CSF-IL-6, screening and identification of the recombinant vector pc DNA3.1-PAP-GM-CSF-IL-6, transfection of the recombinant vector pc DNA3.1-PAP-GM-CSF-IL-6 into an HEK293 cell line, as well as expression, separation, purification, concentration and determination of the PAP-GM-CSF-IL-6 recombinant fusion protein in the HEK293 cell line.
Description
Technical field
The present invention relates to the preparation of a kind of gene recombinant protein, particularly to the preparation method of prostatic cancer specific PAP-GM-CSF-IL-6 gene recombinant fusion protein.
Background technology
Carcinoma of prostate is in the malignant tumor that western countries male is occurred frequently, and its mortality rate is in the second of cancer mortality, is only second to pulmonary carcinoma. From the nineties in 20th century, the experimentation of carcinoma of prostate receives attention in China and carries out rapidly, but the row adenocarcinoma in advanced prostate cancer and androgen independent stage, the pathogenesis that it is relevant is known little about it, there is no effective Therapeutic Method, current research is still within the stage of fumbling, in addition it is also necessary to by the exploration that substantial amounts of experiment in vivo and vitro is deep further. In December, 2008, the immunotherapy of tumors of U.S. FDA official approval DC induction is applied to clinic, the tumor antigen of application has multiple at present, including tumor cell lysate, tumor relevant holoantigen, protein polypeptide, albumen list peptide etc., in existing DC vaccine preparation method, great majority adopt tumor tissue or cancer-associated protein as targeting substance, load efficiency is low, and targeting is relatively low, and specificity is poor.
Prostate specific acid phosphatase (prostaticacidphosphatase, PAP) is Acid Phosphatase Isozymes, prostate epithelial cell lysosome produce, and is a kind of glycoprotein being made up of two identical subunits, and its molecular weight is 100kD. When carcinoma of prostate, in serum, PAP level is significantly raised, and the state of an illness of its elevated-levels and carcinoma of prostate is parallel relation substantially. When sb.'s illness took a favorable turn, PAP level reduces, and often prompting cancer has Preventive and prognosis mala. Research also finds, applies anti-PAP antibody, it is possible to effectively detects cancerous cell (Circulatingtumorcells, CTC) free in circulating, and abdominal cavity is extensively shifted and plants caused ascites, has good curative effect. Thus, PAP as the fabulous target of tumor of prostate and antigen, can be applied to lesion detection and tumor specific cell immunization therapy.
Granulocyte-macrophage colony stimutaing factor (granulocyte-macrophagecolony-stimulatingfactor, GM-CSF) it is the cytokine of a kind of how little property, the differentiation of the APCs such as DC, maturation and activation can be promoted, also can increase the major histocompatibility complex? on DC surface, promote effective submission of tumor antigen.GM-CSF also functions to facilitation for erythrocyte and Megakaryocytic increment and differentiation, in the incubation of DC, GM-CSF is indispensable cytokine, promote the activation capacity of DC, thus strengthening the antigen deduction ability of DC vaccine, thus promoting the killing ability of antigen-specific cellular poison T lymphocyte (CytotoxicityTlymphocytes, CTL).
Interleukin-6 (Interluekin-6, IL-6), it is that one has multi-functional biological activity many skins material, is mainly derived from mononuclear phagocyte, part comes from T, bone-marrow-derived lymphocyte, fibroblast, vascular endothelial cell, and some tumor cell also can produce IL-6. IL-6 is respectively provided with important function in promoting immune response, enhancing bone marrow hematogenesis, improving autoimmune and body defenses ability etc. Its effect is mainly reflected in ThZ type immunoreation, and the propagation of various kinds of cell is all had facilitation, as stimulated hybridoma, plasmocytoma and myeloma growth; Stimulate T cell growth; Promote the EBV B cell converted growth; Promote hematopoietic stem cell growth and stimulate glomerular mesangium growth etc. It is inhibited to the growth of HL-60; The growing multiplication of melanoma, breast cancer cell etc. can also be suppressed. And can as the catalyst of some neutrophil cell, with other cytokine synergism thus promoting the maturation of bone marrow stem cell. Therefore IL-6 is in the treatment of human diseases, is usually used in the diseases such as treatment thrombocytopenia caused by radiotherapy, chemotherapy, cancer or the potent adjuvant as vaccine is applied to clinical trial.
Summary of the invention
It is an object of the invention to applying gene recombinant technique, by prostatic cancer specific PAP, GM-CSF and IL-6 restructuring coupling, prepare into highly purified PAP-GM-CSF-IL-6 fusion protein, a kind of prostatic cancer specific recombinant protein antigen that can promote DC vaccine antigen submission function is provided, thus significantly improving the clinical efficacy of cellular immunotherapy for cellular immunotherapy.
The present invention provides a kind of prostatic cancer specific PAP-GM-CSF-IL-6 gene recombinant fusion protein, and the aminoacid sequence of three kinds of albumen is known array.
The technical solution adopted in the present invention is: the preparation method providing prostatic cancer specific PAP-GM-CSF-IL-6 gene recombinant fusion protein, the order of connection of described recombiant protein is PAP-linker1-GM-CSF-linker2-IL-6, and described method step is as follows:
(1) design of primer and synthesis;
(2) gene amplification and order-checking;
(3) structure of recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6;
(4) screening of recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6, qualification;
(5) recombiant plasmid pcDNA3.1-PAP-GM-CSF-IL-6 transfected HEK 293 strain;
(6) restructuring PAP-GM-CSF-IL-6 fusion protein is expressed in HEK293 cell strain;
(7) purification of restructuring PAP-GM-CSF-IL-6 fusion protein;
(8) the PAP-GM-CSF-IL-6 fusion protein osmosis concentration of purification.
In design and the synthesis of described (1) primer, as described below:
PAP forward primer sequence is:
5 ' CTAGCTAGCCGGCTCTCCTCAACATGAG3 ' (see sequence table 1);
Downstream primer sequence is:
5 ' GCCGCTCGAGATCTGTACTGTCCTCAGT3 ' (see sequence table 2);
Its upstream and downstream primer introduces restricted enzyme Nhe I and the restriction enzyme site of Xho I respectively.
The aminoacid sequence (see sequence table 3) of Linker1;
The aminoacid sequence (see sequence table 4) of GM-CSF;
Restricted enzyme Xho I and BamH I restriction enzyme site is added before and after its GM-CSF aminoacid sequence.
The aminoacid sequence (see learning list 5) of Linker2;
IL-6 forward primer sequence is:
5 ' ATATGGATCCGGTGGCTCTGGATCTCCAGTACCCCCAGGAG3 ' (see sequence table 6);
Downstream primer sequence is:
5 ' TGGGGTACCCATTTGCCGAAGAGCCCTCA3 ' (see sequence table 7);
Its upstream and downstream primer introduces restricted enzyme BamH I and the restriction enzyme site of Kpn I respectively.
Step in described (2) gene amplification and order-checking, RNA is extracted from prostate cancer cell PC-3, then cDNA it is reversed to, with cDNA for template, pcr amplification PAP gene, cut glue and reclaim purpose fragment, this fragment is connected to carrier T, converting DH5 ��, pcr amplification identifies positive speckle, extracts the plasmid of positive speckle and checks order. GM-CSF sequence is made a living work biological engineering (Shanghai) limited company synthetic gene. Human peripheral blood mononuclear cell extracts RNA, is reversed to cDNA, with cDNA for template, pcr amplification IL-6 gene, to cut glue and reclaim purpose fragment, this fragment is connected to carrier T, convert DH5 ��, pcr amplification identifies positive speckle, extracts the plasmid of positive speckle and checks order.
In the method for the structure of described (3) recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6, the carrier T of the PAP that checks order correctly with restricted enzyme Nhe I and Xho I enzyme action, be connected with, cut glue and reclaim PAP fragment; With restricted enzyme BamH I and kpn I enzyme action check order correct, be connected with the carrier T of IL-6, cut glue and reclaim IL-6 fragment; Carrier pcDNA3.1 restricted enzyme Nhe I and kpn I, cuts glue and reclaims carrier; Then PAP fragment, GM-CSF fragment, IL-6 fragment and carrier T4 ligase are attached.
In the screening of described (4) recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6, authentication step, CaCl2Method prepares E. coli competent DH5 ��, then will connect product transformed competence colibacillus bacillus coli DH 5 alpha above, PCR method amplification screening positive recombinant vector, positive speckle is carried out plasmid extraction, and carries out enzyme action qualification.
Method in the pcDNA3.1-PAP-GM-CSF-IL-6 transfected HEK 293 strain of described (5) recombiant plasmid, by positive recombinant vector and LipofectamineTM2000(Invitrogen) add in HEK293 cell, 37 DEG C, 5%CO2Incubator is cultivated.
Express in HEK293 cell strain at described (6) restructuring PAP-GM-CSF-IL-6 fusion protein, recombinant vector is proceeded to cultivation 48h in HEK293 cell, collect cell and add Protein Extraction Reagent, hatch 20 minutes on ice, cell is allowed fully to crack, in 4 DEG C, 17000g is centrifuged 10min, and transfer supernatant is to new pipe.
At the purification process of described (7) restructuring PAP-GM-CSF-IL-6 fusion protein, by the cell whole protein ni-sepharose purification of collection. NiSepharoseTM6FastFlow upper prop, washes post 5 times with Washbuffer, with Elutionbuffer(50mMPBSPH8.0,0.3MNaCl, 150mM imidazoles) eluting destination protein.
In described purification (8) PAP-GM-CSF-IL-6 fusion protein osmosis concentration step, fusion protein solution under eluting, purification is loaded the bag filter handled well, put into dialysis buffer liquid (50mMPBSPH8.0, in 0.15MNaCl) 4 DEG C overnight, to remove the imidazoles contained in purifying protein.Next day, the albumen after dialysis being crossed evaporating column and concentrates, 4 DEG C, 4000g is centrifuged 10min, measures the concentration of the fusion protein after concentration.
PAP-GM-CSF-IL-6 recombiant protein of the present invention, has carried out westernblot identification experiment, the accuracy of qualification result, and method is as follows:
Take recombiant protein 20 �� l respectively, add isopyknic 2 �� sds gel sample loading buffer, boil 10min, take 20 �� l and carry out SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and separate protein sample. First 80V constant voltage electrophoresis 30min, it is into a line that purpose makes protein sample press in concentration glue, treats that protein sample is run out of concentration glue and entered in separation gel, improves voltage to 130V, and after glue is run out of completely in bromophenol blue forward position, electrophoresis completes. Pvdf membrane is activated in methanol 20s, is quickly transferred in transfering buffering liquid (containing Tris3.03g in 1L transfering buffering liquid, glycine 14.4g, methanol 200ml), upper and lower filter paper and SDS-PAGE glue are immersed in transfering buffering liquid. Half-dried transfer method transferring film: sequentially put filter paper, pvdf membrane, glue and another filter paper, 22V transferring film 30-60min on half-dried translator. Film is put in the defatted milk powder solution of 1 �� TBST buffer 5%, horizontal shaker is closed more than 2 hours. Defatted milk powder solution dilution HIS antibody (dilution ratio 1:5000) of 5%, makes film and primary antibodie in room temperature in conjunction with 2hr, or 4 DEG C combine overnight. 1 �� TBST buffer is washed 3 times, each 10min. The defatted milk powder solution preparation corresponding two anti-(dilution ratio 1:1500) of 5%, room temperature is in conjunction with 1-2hr. 1 �� TBST buffer is washed 4-5 time, each 10min. After the A liquid of luminous substrate (SuperSignalWestFemto) and B liquid equal-volume are mixed, it is added on pvdf membrane in right amount (film 100 �� l), uses AlphaFluorChemQ Western blot imaging and quantified system analysis to take pictures imaging.
Qualification result:
1, the amplification of PAP and IL-6 gene:
With the cDNA of prostate cancer cell PC-3 for template, carry out pcr amplification with the upstream and downstream primer of PAP, the PCR primer of amplification its be sized to about 1200bp; The cDNA proposed in human peripheral blood mononuclear cell is template, carries out amplifying PCR primer with IL-6 upstream and downstream primer and is sized to about 550bp. PCR primer agarose gel electrophoresis result is as it is shown in figure 1, product clip size is consistent with expected results.
2, thalline PCR:
Connecting product transformed competence colibacillus bacillus coli DH 5 alpha, carrying out pcr amplification with the upstream and downstream primer of IL-6, thus identifying positive bacteria. 1-4 is positive findings as can see from Figure 2.
3, double digestion is identified:
Extracting the plasmid of positive bacterium colony, then carry out enzyme action qualification, with restricted enzyme Nhe I and Xho I enzyme action PAP, it is sized to about 1200bp; With restricted enzyme Xho I and BamH I enzyme action GM-CSF, it is sized to about 423bp; With restricted enzyme BamH I and Kpn I enzyme action IL-6, it is sized to about 550bp; Electrophoresis result is as it is shown on figure 3, clip size is consistent with expected results.
4, the abduction delivering of restructuring PAP-GM-CSF-IL-6 fusion protein:
By the pcDNA3.1-PAP-GM-CSF-IL-6 recombiant plasmid having been built up and LipofectamineTM2000(Invitrogen) add in HEK293 cell, 37 DEG C, 5%CO2Incubator cultivates 48h, by SDS-PAGE as shown in Figure 4, it is seen that PAP-GM-CSF-IL-6 expressing fusion protein.
5, the restructuring purification of PAP-GM-CSF-IL-6 fusion protein, concentration and qualification:
For obtaining the PAP-GM-CSF-IL-6 fusion protein of purification, pcDNA3.1-PAP-GM-CSF-IL-6/HEK293 cell conditioned medium is adopted NiSepharose by usTM6FastFlow is purified. Identify through SDS-PAGE, as it is shown in figure 5, obtain purer PAP-GM-CSF-IL-6 fusion protein after purified. Concentrated for the PAP-GM-CSF-IL-6 fusion protein of purification post is concentrated, further fusion protein is identified eventually through westernblot, as shown in Figure 6.
Accompanying drawing explanation
Fig. 1 pcr amplification genes of interest fragment, swimming lane 1 is IL-6 fragment; Swimming lane 2 is PAP fragment;
Fig. 2 swimming lane 1-4 is IL-6 thalline PCR result;
Fig. 3 double digestion qualification result, swimming lane 1 is Nhe I and Xho I enzyme enzyme action; Swimming lane 2 is Xho I and BamH I enzyme enzyme action; Swimming lane 3 is BamH I and Kpn I enzyme enzyme action;
SDS-PAGE qualification result after Fig. 4 PAP-GM-CSF-IL-6 fusion protein purification
Protein expression after PAP-GM-CSF-IL-6 purification after the purification of Lane1:150mM imidazoles eluting;
Protein expression after PAP-GM-CSF-IL-6 purification after the purification of Lane2:100mM imidazoles eluting.
Fig. 5 Westernblot identifies PAP-GM-CSF-IL-6 fusion protein result
Lane1-2: blank; Lane3-5:PAP-GM-CSF-IL-6 coincidence protein purification is expressed.
Fig. 6 imitates target ratio during for 5:1,10:1,20:1, and the killing-efficiency of the CTL of PAP-GM-CSF-IL-6 fusion protein load DC induction kills apparently higher than the cell lysate load DC CTL induced and TNF-�� stimulates the CTL of DC induction to kill (P < 0.01).
Detailed description of the invention
Embodiment 1
Plasmid pcDNA3.1 used in the present invention is purchased from Biovector; HEK293 cell strain is purchased from Chinese Academy of Sciences's cell bank; Plasmid extraction kit and glue reclaim test kit all purchased from Tian Gen biochemical technology company limited; NiSepharoseTM6FastFlow is purchased from QIAGEN.
The structure of 1.1pcDNA3.1-PAP-GM-CSF-IL-6 fusion protein expression plasmid
1.1.1 the design of primer and synthesis:
Restriction enzyme site according to pcDNA3.1 plasmid, and PAP and the IL-6 gene order that NCBI provides, separately design the upstream and downstream primer of PAP and IL-6 gene. PAP forward primer sequence is: 5 ' CTAGCTAGCCGGCTCTCCTCAACATGAG3 '; Downstream primer sequence is: 5 ' GCCGCTCGAGATCTGTACTGTCCTCAGT3 '; Its upstream and downstream primer introduces restricted enzyme Nhe I and the restriction enzyme site of Xho I respectively. IL-6 forward primer sequence is: 5 ' ATATGGATCCGGTGGCTCTGGATCTCCAGTACCCCCAGGAG3 '; Downstream primer sequence is: 5 ' TGGGGTACCCATTTGCCGAAGAGCCCTCA3 '; Its upstream and downstream primer introduces restricted enzyme BamH I and the restriction enzyme site of Kpn I respectively. Whole primers and GM-CSF gene complete sequence are by the raw work synthesis in Shanghai.
1.1.2 gene amplification and order-checking:
From Prostatic cancer cell lines PC-3M(purchased from the triumphant base in Nanjing) extract RNA, be then reversed to cDNA, with cDNA for template, pcr amplification PAP gene, cuts glue and reclaims purpose fragment, this fragment is connected to carrier T, converting DH5 ��, pcr amplification identifies positive speckle, extracts the plasmid of positive speckle and checks order. Human peripheral blood mononuclear cell extracts RNA, is reversed to cDNA, with cDNA for template, pcr amplification IL-6 gene, to cut glue and reclaim purpose fragment, this fragment is connected to carrier T, convert DH5 ��, pcr amplification identifies positive speckle, extracts the plasmid of positive speckle and checks order.All order-checking is completed by the raw work in Shanghai.
1.1.3 the structure of recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6:
Through comparison (NCBI) after having checked order, choose the carrier T that order-checking is correct, be connected with genes of interest fragment; With restricted enzyme Nhe I and Xho I enzyme action check order correct, be connected with the carrier T of PAP, cut glue and reclaim PAP fragment; Extract the GM-CSF plasmid of synthesis, reclaim GM-CSF fragment with restricted enzyme Xho I and BamH I enzyme action; With restricted enzyme BamH I and Kpn I enzyme action check order correct, be connected with the carrier T of IL-6, cut glue and reclaim IL-6 fragment; With restricted enzyme Nhe I and Kpn I enzyme action carrier pcDNA3.1, cut glue and reclaim carrier; Then the PAP fragment reclaimed, GM-CSF fragment, IL-6 fragment and carrier T4 ligase are attached.
1.1.4 the screening of recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6, qualification:
CaCl2Method prepares E. coli competent DH5 ��, then will connect product transformed competence colibacillus bacillus coli DH 5 alpha above, pcr amplification screening positive recombinant vector, positive speckle is carried out plasmid extraction, and carries out enzyme action qualification.
1.2 recombiant plasmid pcDNA3.1-PAP-GM-CSF-IL-6 transfected HEK 293 strains:
By the pcDNA3.1-PAP-GM-CSF-IL-6 recombiant plasmid having been built up and LipofectamineTM2000(Invitrogen) add in HEK293 cell, 37 DEG C, 5%CO2Incubator cultivates 48h, passes through SDS-PAGE, it is seen that PAP-GM-CSF-IL-6 expressing fusion protein.
The 1.3 restructuring purification of PAP-GM-CSF-IL-6 fusion protein, concentration and qualification:
1.3.1 the preparation of cell protein supernatant:
1.3.1.1 cell culture fluid is carefully removed, by cell harvesting to centrifuge tube;
1.3.1.2 carry out pre-cooling by actual for Protein Extraction, add protease inhibitor cocktail according to 1:99 ratio, make protease inhibitor cocktail become 1 �� working solution in extraction agent.
1.3.1.3 add appropriate mammalian proteins extraction agent, hatch on ice 20 minutes, allow cell fully crack.
1.3.1.4 by cell in 4 DEG C, centrifugal 10 minutes of 17,000 �� g, transfer supernatant is to new pipe, for analyzing further.
1.3.2NiSepharoseTM6FastFlow purification PAP-GM-CSF-IL-6 fusion protein:
1.3.2.1 according to Ni-NTAAgarose(QIGEN) description requirement, the supernatant protein obtained after cell lysis adds in post material.
1.3.2.2 Washbuffer(50mMPBSPH8.0,0.3MNaCl, 40mM imidazoles is used) the resuspended beads in conjunction with fusion protein, washes post 3 times with Washbuffer.
1.3.2.3 with Elutionbuffer(50mMPBSPH8.0,0.3MNaCl, 150mM imidazoles) eluting destination protein.
1.3.2.4 the whole protein before purification and the purifying protein that obtains after eluting are carried out SDS-PAGE electrophoresis.
1.3.3 the PAP-GM-CSF-IL-6 fusion protein osmosis concentration of purification:
1.3.3.1 fusion protein solution under eluting, purification is loaded the bag filter handled well, put in dialysis buffer liquid (50mMPBSPH8.0,0.15MNaCl) 4 DEG C overnight, to remove the imidazoles contained in purifying protein.
1.3.3.2 next day, the albumen after dialysis is crossed evaporating column and concentrates, 4 DEG C, the centrifugal 10min of 4000rpm.
1.3.3.3 use BCA determination of protein concentration test kit (requiring to specifications), measure the fusion protein concentration after concentration.
Embodiment 2
The present invention provides a kind of PAP-GM-CSF-IL-6 gene recombinant protein to prepare DC vaccine, possesses the antigen property of PAP, it is provided simultaneously with the immunologic function of GM-CSF, IL-6, can be applicable to the preparation of therapeutic type DC vaccine, and the preparation of prostatic cancer specific CTL effector lymphocyte, thus, it is the selection of tumor specific antigen in cellular immunotherapy.Apply therapeutic type DC vaccine prepared by this gene recombinant protein, there is high efficiency T cell activation effect, clinical efficacy can be effectively improved. Step method is as follows:
(1) acquisition of peripheral blood list shape nucleus: extract healthy human peripheral blood 100ml, obtains single shape nucleus through gradient density centrifugal;
(2) cultivating 2 hours through serum-free medium, gathering in the crops the cell amplification cultivation suspended is T cell, and it is DC cell that adherent cell activation is cultivated, and cultivates respectively;
(3) preparation of DC vaccine, the IL-4 of GM-CSF and the 500IU/ml adding 1000IU/ml in serum-free medium cultivates DC cell, amplification cultivation 5 days; Within 5th day, it is separately added into PC-3M cell lysate, TNF-�� group and PAP-GM-CSF-IL-6 recombiant protein, after cultivating 2 days, gathers in the crops three kinds of ripe DC.
(4) preparation of specific CTL, serum-free medium adds the IL-2 amplification cultivation T cell of 250IU/ml, it is cultured to the 7th day, 2-4 days are co-cultured respectively, it is thus achieved that three species specificity CTL effector lymphocyte lysate-CTL, TNF-��-CTL, PAP-GM-CSF-IL-6-CTL with three kinds of ripe DC of step (3).
(5) invitro cell killing experiment: application CCK-8 reagent, takes PC-3M Prostatic cancer cell lines as target cell, is divided into 3 groups to carry out cell killing experiment. Cell lysate group, TNF-�� group, PAP-GM-CSF-IL-6 recombiant protein group, observe killing-efficiency.
(6) result:
Invitro experimental result: effect target ratio is during for 5:1, the CTL of CTL, PAP-GM-CSF-IL-6 load DC induction of lysate load DC induction, TNF-�� stimulate the CTL of DC induction, to the killing-efficiency of PC-3M target cell respectively 16.33%, 16.98%, 7.79%(P < 0.05); Effect target ratio during for 10:1, the CTL of CTL, PAP-GM-CSF-IL-6 load DC induction of lysate load DC induction, TNF-�� stimulate the CTL of DC induction, to the killing-efficiency of PC-3M target cell respectively 20.33%, 28.37%, 23.43%(P < 0.05); Effect target ratio during for 20:1, the CTL of CTL, PAP-GM-CSF-IL-6 load DC induction of lysate load DC induction, TNF-�� stimulate DC induction CTL, to the killing-efficiency of PC-3M target cell respectively 33.09%, 67.8%, 36.9%(P < 0.05 Fig. 6. The CTL of PAP-GM-IL-6 protein load DC induction, killing-efficiency is significantly higher than the CTL of lysate load DC induction and the CTL(P < 0.05 of TNF-�� stimulation DC induction).
Sequence table
����������������������������������������������������������
<110>Hebei Li Tongkang bio tech ltd
<120>prostatic cancer specific PAP-GM-CSF-IL-6 gene recombinant fusion protein and preparation method thereof
<160>7
<210>1
<211>28
<212>DNA
<213>artificial sequence
<400>1
ctagctagccggctctcctcaacatgag28
<210>2
<211>28
<212>DNA
<213>artificial sequence
<400>2
gccgctcgagatctgtactgtcctcagt28
<210>3
<211>2
<212>DNA
<213>artificial sequence
<400>3
GlySer2
<210>4
<211>127
<212>DNA
<213>artificial sequence
<400>4
AlaProAlaArgSerProSerProSerThrGlnProTrpGluHisValAsnAlaIleGln
15101520
GluAlaArgArgLeuLeuAsnLeuSerArgAspThrAlaAlaGluMetAsnGlu
21253035
ThrValGluValIleSerGluMetPheAspLeuGlnGluProThrCysLeuGlnThr
40455055
ArgLeuGluLeuTyrLysGlnGlyLeuArgGlySerLeuThrLysLeuLysGlyPro
60657075
LeuThrMetMetAlaSerHisTyrLysGlnHisCysProProThrProGluThrSer
80859095
CysAlaThrGlnIleIleThrPheGluSerPheLysGluAsnLeuLysAspPheLeu
96100105110
LeuValIleProPheAspCysTrpGluProValGlnGlu
115120125
<210>5
<211>15
<212>DNA
<213>artificial sequence
<400>5
GlyGlySerGlySerGlyGlySerGlySerGlyGlySerGlySer
151015
<210>6
<211>41
<212>DNA
<213>artificial sequence
<400>6
atatggatccggtggctctggatctccagtacccccaggag41
<210>7
<211>29
<212>DNA
<213>artificial sequence
<400>7
tggggtacccatttgccgaagagccctca29
Claims (10)
1. the preparation method of prostatic cancer specific PAP-GM-CSF-IL-6 gene recombinant fusion protein, described method comprises the following steps:
(1) design of primer and synthesis;
(2) gene amplification, order-checking and synthesis;
(3) structure of recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6;
(4) screening of recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6, qualification;
(5) recombiant plasmid pcDNA3.1-PAP-GM-CSF-IL-6 transfected HEK 293 strain;
(6) restructuring PAP-GM-CSF-IL-6 fusion protein is expressed in HEK293 cell strain;
(7) purification of restructuring PAP-GM-CSF-IL-6 fusion protein;
(8) restructuring PAP-GM-CSF-IL-6 fusion protein osmosis concentration.
2. method according to claim 1, it is characterised in that the design of described (1) primer and synthesis:
PAP forward primer sequence is: 5 ' CTAGCTAGCCGGCTCTCCTCAACATGAG3 '; Downstream primer sequence is: 5 ' GCCGCTCGAGATCTGTACTGTCCTCAGT3 '; Its upstream and downstream primer introduces restricted enzyme Nhe I and the restriction enzyme site of Xho I respectively; IL-6 forward primer sequence is: 5 ' ATATGGATCCGGTGGCTCTGGATCTCCAGTACCCCCAGGAG3 '; Downstream primer sequence is: 5 ' TGGGGTACCCATTTGCCGAAGAGCCCTCA3 '; Its upstream and downstream primer introduces restricted enzyme BamH I and the restriction enzyme site of Kpn I respectively.
3. method according to claim 1, it is characterised in that described (2) gene amplification and order-checking:
From prostate cancer cell PC-3, extract RNA, be then reversed to cDNA, with cDNA for template, pcr amplification PAP gene, human peripheral blood mononuclear cell proposes RNA, reverse transcription is cDNA, goes out IL-6 gene with cDNA for template amplification.
4. method according to claim 1, it is characterised in that the structure of described (3) restructuring load pcDNA3.1-PAP-GM-CSF-IL-6 body: the carrier T of the PAP that checks order correctly with restricted enzyme Nhe I and Xho I enzyme action, be connected with, cuts glue and reclaims PAP fragment; With restricted enzyme BamH I and kpn I enzyme action check order correct, be connected with the carrier T of IL-6, cut glue and reclaim IL-6 fragment; Carrier pcDNA3.1 restricted enzyme Nhe I and kpn I, cuts glue and reclaims carrier; Then PAP fragment, GM-CSF fragment, IL-6 fragment and carrier T4 ligase are attached.
5. method according to claim 1, it is characterised in that the screening of described (4) recombinant vector pcDNA3.1-PAP-GM-CSF-IL-6, qualification: CaCl2Method prepares E. coli competent DH5 ��, then will connect product transformed competence colibacillus bacillus coli DH 5 alpha above, pcr amplification screening positive recombinant vector, positive speckle is carried out plasmid extraction, and carries out enzyme action qualification.
6. method according to claim 1, it is characterised in that described (5) recombiant plasmid pcDNA3.1-PAP-GM-CSF-IL-6 transfected HEK 293 strain: by positive recombinant vector and LipofectamineTM2000(Invitrogen) by specification requirement, adds in HEK293 cell, 37 DEG C, 5%CO2Incubator cultivates 24-48h.
7. method according to claim 1, it is characterized in that, described (6) restructuring PAP-GM-CSF-IL-6 fusion protein is expressed in HEK293 cell strain: is proceeded to by recombinant vector in HEK293 cell and cultivates, collect cell and add Protein Extraction Reagent, re-suspended cell is hatched 20 minutes on ice, allows cell fully crack, in 4 DEG C, 17000g is centrifuged 10min, and transfer supernatant is to new pipe.
8. method according to claim 1, it is characterized in that, the purification of described (7) restructuring PAP-GM-CSF-IL-6 fusion protein: the cell whole protein ni-sepharose purification that will collect, according to Ni-NTAAgarose(QIAGEN) description requirement, whole protein after lysis is added in post material, with Washbuffer(50mMPBSPH8.0,0.3MNaCl, 40mM imidazoles) add in protein-bonded beads, wash post 5 times, with Elutionbuffer(50mMPBSPH8.0,0.3MNaCl, 150mM imidazoles) eluting destination protein;Albumen before purification and the purifying protein after eluting are carried out SDS-PAGE electrophoresis.
9. method according to claim 1, it is characterized in that, described (8) restructuring PAP-GM-CSF-IL-6 fusion protein osmosis concentration: fusion protein solution under eluting, purification is loaded the bag filter handled well, put into dialysis buffer liquid (50mMPBSPH8.0, in 0.15MNaCl) 4 DEG C overnight, to remove the imidazoles contained in purifying protein; Next day, the albumen after dialysis is crossed evaporating column and concentrates, 4 DEG C, the centrifugal 10min of 4000rpm, use BCA determination of protein concentration test kit (requiring to specifications), measure the fusion protein concentration after concentration.
10. the fusion protein described in claim 1 is being prepared vaccine for the purpose of tumor specific cell immunization therapy, is being killed application in cell preparation, biological medicament etc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610095423.5A CN105647970A (en) | 2016-02-22 | 2016-02-22 | Prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610095423.5A CN105647970A (en) | 2016-02-22 | 2016-02-22 | Prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105647970A true CN105647970A (en) | 2016-06-08 |
Family
ID=56489576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610095423.5A Pending CN105647970A (en) | 2016-02-22 | 2016-02-22 | Prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105647970A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108948181A (en) * | 2018-07-05 | 2018-12-07 | 睿诺医疗科技（上海）有限公司 | A kind of preparation method of phospholipase A2 receptor protein |
| CN110079539A (en) * | 2018-01-25 | 2019-08-02 | 上海惠盾生物技术有限公司 | Prostatic acid phosphatase/granulocyte-macrophage colony-stimulating factor preparation method |
| WO2020259151A1 (en) * | 2019-06-24 | 2020-12-30 | 广州安捷生物医学技术有限公司 | Preparation method and application of ctl cell |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997024438A1 (en) * | 1995-12-28 | 1997-07-10 | Dendreon Corporation | Immunostimulatory composition and method |
| CN103638517A (en) * | 2013-12-04 | 2014-03-19 | 深圳市合一康生物科技有限公司 | Special-purpose kit for preparing human dendritic cell vaccines |
| CN104870477A (en) * | 2012-10-23 | 2015-08-26 | 爱默蕾大学 | GM-CSF and IL-4 conjugates, compositions, and methods related thereto |
-
2016
- 2016-02-22 CN CN201610095423.5A patent/CN105647970A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997024438A1 (en) * | 1995-12-28 | 1997-07-10 | Dendreon Corporation | Immunostimulatory composition and method |
| US5976546A (en) * | 1995-12-28 | 1999-11-02 | Dendreon Corporation | Immunostimulatory compositions |
| CN104870477A (en) * | 2012-10-23 | 2015-08-26 | 爱默蕾大学 | GM-CSF and IL-4 conjugates, compositions, and methods related thereto |
| CN103638517A (en) * | 2013-12-04 | 2014-03-19 | 深圳市合一康生物科技有限公司 | Special-purpose kit for preparing human dendritic cell vaccines |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110079539A (en) * | 2018-01-25 | 2019-08-02 | 上海惠盾生物技术有限公司 | Prostatic acid phosphatase/granulocyte-macrophage colony-stimulating factor preparation method |
| CN110079539B (en) * | 2018-01-25 | 2022-07-01 | 上海惠盾因泰生物科技有限公司 | Preparation method of prostatic acid phosphatase/granulocyte-macrophage colony stimulating factor |
| CN108948181A (en) * | 2018-07-05 | 2018-12-07 | 睿诺医疗科技（上海）有限公司 | A kind of preparation method of phospholipase A2 receptor protein |
| WO2020259151A1 (en) * | 2019-06-24 | 2020-12-30 | 广州安捷生物医学技术有限公司 | Preparation method and application of ctl cell |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112626090B (en) | Nucleotide sequence for coding novel coronavirus antigen and application thereof | |
| CN104774270B (en) | A kind of gland cancer specificity EpCAM GM CSF gene recombinant fusion proteins and preparation method thereof | |
| CN107847577A (en) | The cancer vaccine of mRNA comprising coding M-like protein matter | |
| CN111606999B (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signaling pathway and blocking immune checkpoint and application thereof | |
| CN104910278B (en) | A kind of slow virus with high-efficiency transfection ability and biological activity for being used to prepare CART cells | |
| CN104004712A (en) | Preparation method of antigen-specific cytotoxicity T lymphocytes | |
| CN109517820A (en) | A kind of gRNA and HPK1 gene editing method targeting HPK1 | |
| CN104262459B (en) | Acute monocytic leukemia-associated antigen MLAA-34 epitope polypeptide, and vaccine and pharmaceutical application of acute monocytic leukemia-associated antigen MLAA-34 epitope polypeptide | |
| CN106867968A (en) | The SMCC-7721 cell lines and construction method of YBX1 stabilization expression | |
| CN105647970A (en) | Prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and preparation method thereof | |
| EA012520B1 (en) | Process for producing cytotoxic lymphocytes | |
| CN103936862A (en) | Co-expression of fusion porcine interleukin 4/6 and interleukin 2 genes and application of fusion porcine interleukin 4/6,2 gene in preparation of biological agents | |
| CN100334110C (en) | Sperm protein monoclonal antibody and its preparing method and use | |
| CN101289666A (en) | Method for preparing recombination porcine alpha-type interferon | |
| CN110358735A (en) | A kind of preparation method and application of CTL cell | |
| CN103724413B (en) | Trichina paramyosin B cell antigen epi-position 8A1 and application thereof | |
| CN111607571B (en) | Replicative oncolytic adenovirus for specifically activating immune co-stimulation pathway and preparation method and application thereof | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN101255189A (en) | Animal vaccine immunopotentiator and production method thereof | |
| CN110358737A (en) | A method of Chimeric antigen receptor T lymphocyte is prepared using excretion body | |
| CN109593725A (en) | A kind of recombination mescenchymal stem cell and its application | |
| CN102899293A (en) | Mesenchymal stem cells genetically modified with angiopoietin 1 gene and construction method and application thereof | |
| CN113388586B (en) | Oncolytic virus NDV-NRP1 and construction method and application thereof | |
| CN102660579B (en) | HBx and human IL-12 double-gene recombinant vector and liver caner-resistant vaccine | |
| CN105420174A (en) | Establishment of genetically engineered bacterium expressing recombined VEGF fusion protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Cai Jianhui Inventor after: Li Ronghua Inventor after: Liu Jixiang Inventor after: Zhang Zhenping Inventor after: Du Pingping Inventor before: Cai Jianhui Inventor before: Cui Hongjuan Inventor before: Liu Jixiang Inventor before: Zhang Zhenping Inventor before: Du Pingping |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20170327 Address after: 050000 Changjiang Road, high tech Zone, Hebei, Shijiazhuang, China, 238 Applicant after: Hebei Tong Ling Rong Biotechnology Co. Ltd. Address before: The Yangtze River Road high tech Zone 050000 Hebei province Shijiazhuang Hongchang Science Park No. 238, No. 1 Building 2 layer Applicant before: Li Tongkang bio tech ltd, Hebei |
|
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160608 |