CN107058369A - Recombined human DPT maturation peptide fragment and its production method - Google Patents

Abstract

The invention discloses a kind of recombined human DPT (dermatopontin, DPT) mature peptide and its production method, the production method is as follows：Obtain the ripe peptide fragment genes of people DPT；Build carrier for expression of eukaryon and be transformed into pichia yeast X 33；The yeast transformant of resistance screening high-level secretory expression；Induced expression supernatant obtains rhDPT through ni-sepharose purification.Recombinant protein rhDPT made from this method carries HIS and C MYC labels, it is easy to protein purification and detection, and rhDPT can effectively suppress the growth of fat cell in testing in vitro in addition, with good bioactivity.

Description

Recombined human DPT maturation peptide fragment and its production method

Technical field

It is more particularly to a kind of the present invention relates to recombinant DNA technology producer gene engineered protein technical field of pharmaceuticals is applied The efficient ripe peptide fragment (rhDPT) of recombined human DPT and its production method.

Background technology

DPT (dermatopontin, the DPT) assignment of genes gene mapping is in human chromosome 1q12-1q23, and it is by 183 The secretary protein that amino acid residue is constituted, relative molecular mass is 22kDa.Rich in TYR residue and 1/2 by sulphur in DPT Acidifying, the sulphation of TYR may be relevant with the combination of the DPT influences formed to collagenous fibres and itself and cell surface receptor. DPT is widely distributed in the tissue of mammal, in the skin of pig and rodent, bone, the heart, lung, kidney, cartilage, bone With the presence of DPT, the DPT in human body is distributed mainly in the fibroblast of the tissues such as muscle, heart, pancreas, lung.Newest grinds Study carefully discovery DPT to be also distributed in the extracellular matrix of the tissues such as the skin, cornea, prostate of mammal.

DPT physiological function is mainly related to cell adherence, and Lewandowska et al. uses Balb/c 3T3 cells and tire ox Skin fibroblasts research with people finds that DPT has the activity for promoting this 3 kinds of cell adherences.In vitro study finds that DPT can promote Enter the formation of collagenous fibres, and the collagenous fibres newly formed is more stablized.DPT expression is mainly adjusted by TGF β and IL-4 Section, TGF β can make DPT mRNA and protein level and meanwhile raise and IL-4 effect then in contrast.After DPT is combined with TGF β It can strengthen TGF β activity, including suppress the hyperplasia of endothelial cell and epithelial cell, adjust the differentiation of various kinds of cell, promote collagen The effect of the extracellular matrix protein such as albumen and proteoglycans expression.DPT unconventionality expression and myocardial infarction, uterine smooth muscle The diseases such as knurl, prostate cancer are closely related.Current research report finds that DPT can maintain the amplification of candidate stem cell in vitro, this The DPT of outer dermal cell secretion can promote the healing of wound by way of the migration for promoting keratinocyte.

In a word, DPT is a kind of important secretory protein being widely present in cellular matrix, passes through decorin, TGF The effect such as β, NTx albumen is with functions such as cell adherence, promotion collagenous fibres formation, a variety of related to extracellular matrix Physiology and pathologic process in play a role, but effect machines of the DPT in the physiology and pathologic process related to extracellular matrix System is still needed to be studied.At present, also without DPT, the related of great expression purifying is reported in vitro.

The content of the invention

Based on this, it is an object of the invention to provide a kind of ripe peptide fragment of efficient stable production recombined human DPT Method, high-level secretory expression rhDPT can be stablized according to this method, and it is that, through glycosylation modified rhDPT glycoprotein, also have There is good biological activity.

The concrete technical scheme for solving above-mentioned technical problem is as follows：

A kind of production method of the ripe peptide fragment of recombined human DPT, comprises the following steps：

(1) plasmid rhDPT/pMD-20T is prepared：People DPT gene of the base sequence as shown in SEQ ID NO.1 is obtained, will The people DPT genes are connected to pMD-20T carriers, obtain plasmid rhDPT/pMD-20T；

(2) recombinant vector pPICZ α A/DPT are built：By pPICZ α A initial carriers and the plasmid rhDPT/pMD-20T points Double digestion is not carried out with EcoR I and Not I, repurity is reclaimed, by the pPICZ α A vector genes fragments of recovery and rhDPT gene pieces Section is connected with the DNA ligases of solution I, obtains recombinant vector pPICZ α A/DPT；

(3) conversion recombinant vector is into eucaryon yeast host：By the recombinant vector pPICZ α A/DPT single endonuclease digestions of Sac I Linearisation, then be transferred in pichia yeast X-33 host, then obtain positive colony by the YPDZ plate screenings containing zeocin；

(4) screening of high-level secretory expression yeast transformant：The positive colony is forwarded to the YPDZ containing zeocin In flat board, resistance yeast transformant is obtained using the screening of zeocin concentration gradients, then uses BMGY medium cultures, methanol is lured Lead, obtain high-level secretory expression yeast transformant；

(5) purify：RhDPT is purified with nickel affinity chromatography post, recombinant protein rhDPT is obtained.

In wherein some embodiments, the specific side of the screening of step (4) the high-level secretory expression yeast transformant Method is：The positive colony is forwarded in the YPDZ flat boards containing zeocin, obtains high anti-using the screening of zeocin concentration gradients Property yeast transformant, then use BMGY medium cultures, cell be collected by centrifugation, cell is resuspended with BMMY culture mediums, obtain cell liquid, and The final concentration of 0.95-1.05% of methanol in the cell liquid is adjusted, 70-74h is induced, obtains high-level secretory expression yeast conversion Son.

In wherein some embodiments, the specific method of the zeocin concentration gradients screening described in step (4) is：Will be described Positive colony is forwarded in the YPDZ flat boards containing 490-510 μ g/ml zeocin, screens resistance for 500 μ g/ml zeocin Yeast transformant, then the yeast transformant is washed down with fresh YPD fluid nutrient mediums, be applied to after dilution containing In 1490-1510 μ g/ml zeocin YPDZ flat boards, then will be raw in the YPDZ flat boards containing 1490-1510 μ g/mL Zeocin Long yeast transformant is applied to after dilution in the YPDZ flat boards containing 2990-3010 μ g/mL Zeocin, and screening is resisted Property be 3000 μ g/ml zeocin resistance yeast transformant.

In wherein some embodiments, the time of the induction described in step (4) is 72h.

In wherein some embodiments, the temperature of the induction described in step (4) is 28 DEG C -32 DEG C.

In wherein some embodiments, the rotating speed of the induction described in step (4) is 180-220rpm.

In wherein some embodiments, the specific method of the purifying described in step (5) is：By the high-level secretory expression Yeast transformant is enlarged culture, and culture supernatant is first dialysed with buffer A, recycles nickel affinity chromatography post in AKTA- Purify, produce in HPLC system；The buffer A is the buffer solution containing 0.2MNaCl, 50mM imidazoles, 20mM Tris, its pH For 8.0.

In wherein some embodiments, when being purified using nickel affinity chromatography post in AKTA-HPLC systems, buffer solution is first used A is rinsed, and recycles buffer B linear elution, is collected the eluent that mAu is more than 100, is produced；The buffer B is to contain 0.2M The buffer solution of NaCl, 0.5M imidazoles, 20mM Tris, its pH is 8.0.

In wherein some embodiments, zeocin concentration is 95-105 μ g/ml in the YPDZ flat boards described in step (3).

Present invention also offers a kind of ripe peptide fragment of recombined human DPT.

Concrete technical scheme is as follows：

The ripe peptide fragment of recombined human DPT prepared according to aforementioned production method.

The ripe peptide fragment of the recombined human DPT of the present invention and its production method have advantages below and beneficial effect：

(1) the method for the invention is drawn through the substantial amounts of experiment of inventor and research：With as shown in SEQ ID NO.1 People DPT genes are foreign gene, are expressed first using the pichia yeast X-33 a large amount of stability and high efficiencies for being successfully realized rhDPT, tool Body is：DPT genes are put into initial carrier pPICZ α A, and using pichia yeast X-33 as Host Strains, realize a large amount of of rhDPT High efficiency stable expression；This method can either prevent Host Strains to the degraded of expression product, mitigate host cell metabolism load and Expression product may additionally facilitate secretory protein and fold in any suitable manner, recover its native conformation to the toxic action of host.

(2) HIS and C-MYC labels are carried using expression product made from production method of the present invention, it is easy to purifying and Expression product is detected, and it has good bioactivity.

Brief description of the drawings

Fig. 1 is carrier for expression of eukaryon pPICZ α A/rhDPT structure schematic diagram；

Fig. 2 purifies chromatogram for rhDPT nickel affinity chromatography post；

Fig. 3 is the rhDPT protein SDS-PAGE electrophoresis result figures of purifying, and wherein DS and DL are rhDPT；

Fig. 4 is the mass spectrometry results of rhDPT bands；Wherein a is rhDPT DS band mass spectrometry results；B is rhDPT DL band mass spectrometry results；

Fig. 5 is the influence result schematic diagram that rhDPT breeds to 3T3-L1 cells.

Embodiment

The pichia yeast X-33 bacterial strains that the present invention is selected, conformability expression plasmid pPICZ α A carriers are purchased from the U.S. Invitrogen companies.

Artificial synthesized application on human skin pontin protein cDNA of the present invention, purchased from Nanjing Jin Sirui companies；Its 5 ' end is introduced EcoR1 restriction enzyme sites, 3 ' ends introduce Not1 restriction enzyme sites, and sequence is as shown in SEQ ID NO.1；

SEQ ID NO.1：

ATGGACCTCAGTCTTCTCTGGGTACTTCTGCCCCTAGTCACCATGGCCTGGGGCCAGTATGGCGATTATGGATACCC ATACCAGCAGTATCATGACTACAGCGATGATGGGTGGGTGAATTTGAACCGGCAAGGCTTCAGCTACCAGTGTCCCC AGGGGCAGGTGATAGTGGCCGTGAGGAGCATCTTCAGCAAGAAGGAAGGTTCTGACAGACAATGGAACTACGCCTGC ATGCCCACACCACAGAGCCTCGGGGAACCCACGGAGTGCTGGTGGGAGGAGATCAACAGGGCTGGCAT GGAATGGTACCAGACGTGCTCCAACAATGGGCTGGTGGCAGGATTCCAGAGCCGCTACTTCGAGTCAGTGCTGGATC GGGAGTGGCAGTTTTACTGTTGTCGCTACAGCAAGAGGTGCCCATATTCCTGCTGGCTAACAATAGAATATCCAGGT CACTATGGTGAGGAAATGGACATGATTTCCTACAATTATGATTACTATATCCGAGGAGCAACAACCACTTTCTCTGC AGTGGAAAGGGATCGCCAGTGGAAGTTCATAATGTGCCGGATGACTGAATACGACTGTGAATTTGCAAATGTTTAG

Used medium formula of the present invention is as follows：

1) yeast growth medium (BMGY)：

10g yeast extracts are completely dissolved, 20g peptones are settled to 700ml.121 DEG C of steam high-voltage sterilizing 15- 20min, is cooled to room temperature, adds 100ml 1M potassium phosphate solutions, 100ml YNB, 2ml500*Biotin, 100ml 10*GY；

2) yeast inducing culture (BMMY)：

10g yeast extracts are completely dissolved, 20g peptones are settled to 700ml.121 DEG C of steam high-voltage sterilizing 15- 20min, is cooled to room temperature, adds 100ml 1M potassium phosphate solutions, 100ml YNB, 2ml500*Biotin, 100ml 10*M；

3) YPD fluid nutrient mediums：

It is completely dissolved 10g yeast extracts, 20g peptones, 10g glucose sugar, constant volume to 1000ml, 121 DEG C of vapor injections Sterilize 15-20min.(YPD solid mediums：15g agar is added into YPD fluid nutrient mediums).

Below with reference to specific embodiment, the present invention will be further described.

Embodiment 1

A kind of efficient rhDPT expression and purification method of the present embodiment, is mainly included the following steps that：

1st, rhDPT full genomes are cloned：

A pair of DPT characteristic amplimers are designed, whole person is amplified using artificial synthesized DPT cDNA as template specificity DPT mature peptide genetic fragment (rhDPT genes), 5 ' ends of the rhDPT genes introduce EcoR1 restriction enzyme sites, 3 ' ends Not1 restriction enzyme sites (introducing the base sequence of rhDPT genes of restriction enzyme site as shown in SEQ ID NO.1) are introduced so as to follow-up Expression vector is inserted to the rhDPT genetic fragments；PCR conditions are：95 DEG C of pre-degenerations, 5min, a thermal cycle；95 DEG C of thermal denaturations 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 thermal cycles；72 DEG C of renaturation 10min.Agarose electrophoresis reclaims amplification rhDPT Genetic fragment, is connected to pMD-20T carriers (being purchased from Guangzhou TAKARA companies) by rhDPT genetic fragments, obtains plasmid rhDPT/ PMD-20T, digestion and nucleic acid sequencing identification, determine sequence consistent with the DPT sequences that genebank is announced.

The DPT characteristics amplimer is：

DPT for：5 '-GAATTCCAGTATGGCGATTATGGATAC-3 ',

DPT for：5’-GCGGCCGC AACATTTGCAAATTCACAG-3’.

2nd, pichia yeast secreted expression carrier pPICZ α A/rhDPT are built：

1) the EcoR I and double digestion recombinant plasmid pMD-20T/rhDPT of Not I is used, target gene fragment rhDPT, reaction is obtained System is following (restriction endonuclease and buffer solution used are purchased from Thermo companies)：

2) the EcoR I and double digestion recombinant plasmid pPICZ alpha A of Not I is used, vector gene fragment pPICZ α A, reaction system is obtained As follows (restriction endonuclease and buffer solution used are purchased from Thermo companies)：

3) target gene fragment and vector gene fragment 1), 2) obtained by step is carried out with DNA gel QIAquick Gel Extraction Kit Purifying is reclaimed, and the kit is purchased from Magen companies, and concrete operations are carried out by kit specification.

4) the target gene fragment rhDPT and vector gene fragment pPICZ α A the being recovered to ligases of solution I (purchases From Dalian TAKARA companies, it is the premix ligase of TAKARA companies, is like product with T4 ligases) reaction is attached, Target gene rhDPT is inserted into the reading frame of the excretion vector pPICZ α A containing secretion signal α-factor, builds schematic diagram See Fig. 1 (as illustrated, the recombinant protein of expression contains 6*His labels and C-MYC labels), reaction system is as follows：

The μ l of carrier pPICZ α A genetic fragments 0.5

The μ l of rhDPT target gene fragment 4.5

solutionⅠ 5μl

Obtain recombinant vector pPICZ α A/rhDPT.

3rd, recombinant vector pPICZ α A/rhDPT to pichia yeast X-33 are converted：

Dissolved after the 10 μ g pPICZ α A/rhDPT recombinant vectors Sac I verified through EcoR I and the double digestions of Not I are linearized In 50 μ l milliQ water, according to invitrigen companies operation manual LiCl conversion methods by recombinant vector pPICZ α A/rhDPT It is transformed into host pichia yeast bacterium X-33.After conversion the positive is carried out with the YPDZ flat boards containing 100 μ g/ml zeocin antibiotic Colony screening.

4th, the screening of high-level secretory expression yeast transformant：

Positive colony is forwarded to the YPDZ flat boards containing 500 μ g/mL Zeocin, the ferment of Zeocin resistances has been screened Female transformant；Yeast transformant in YPDZ flat boards containing 500 μ g/mL Zeocin is utilized into fresh YPD fluid nutrient mediums The bacterium colony of YPDZ flat boards is washed down, after dilution, is applied in the YPDZ flat boards containing 1500 μ g/mL Zeocin, then will contain The yeast transformant grown in 1500 μ g/mL Zeocin YPDZ flat boards is applied to after dilution containing 3000 μ g/mL In Zeocin YPDZ flat boards, the resistance yeast transformant that highest resistance is 3000 μ g/mL Zeocin is finally obtained, with BMGY medium cultures are to OD value>10.0, cell is collected by centrifugation, cell is resuspended with BMMY culture mediums and makes its methanol concentration For 1.0%, 30 DEG C, under the conditions of 200rpm after induction 72h, analyzed through SDS-PAGE, obtained high-level secretory expression rhDPT's Yeast transformant.Under the conditions of shaking flask, the rhDPT of DPT yeast transformants expression is more than 45mg/L.

5th, expansion expression of the rhDPT under the conditions of shaking flask

High-level secretory expression yeast transformant is in 1L BMGY medium cultures to OD value>10, it is collected by centrifugation thin Born of the same parents, are resuspended cell with 200mL BMMY culture mediums and make its methanol concentration be 1.0%, sample once within every 24 hours and add methanol Once to final concentration of 1%, after induction 72 hours, under the conditions of determining the sample total protein content of each period, shaking flask, DPT The rhDPT of yeast transformant expression is more than 45mg/L.

6th, rhDPT nickel affinity post purifying

Induce supernatant in 4 DEG C of centrifugations, the supernatant after centrifugation is collected, with containing 0.2MNaCl, 50mM imidazoles, 20mM After Tris (pH 8.0) buffer solution is dialysed, purified using nickel affinity chromatographic column in ATKA-HPLC systems, first with containing 0.2M NaCl, 50mM imidazoles, 20mM Tris (pH8.0) buffer solution are rinsed, and are recycled and are contained 0.2MNaCl, 500mM Imidazoles, 20mM Tris (pH8.0) buffer solution carry out linear elution and collect eluting peak rhDPT protein samples, collect mAu (millis Absorbance) it is more than 100 eluent (chromatogram such as Fig. 2).The protein sample being collected into is analyzed through SDS-PAGE, as a result table It is bright, the albumen being purified to be 2 master tapes be respectively about 22kDa and 25kDa albumen (such as Fig. 3).Illustrate that the albumen of expression is carried The label of correct His × 6 and C-MYC labels, can effectively be purified using nickel affinity chromatographic column and obtain the recombinant protein.

7th, peptiolipid line atlas analysis and comparison：

Nickel affinity column chromatography to albumen analyzed through SDS-PAGE after, find 2 sizes be respectively 22K and 25K Albumen, two master tapes are cut from glue and carry out peptide fingerprinting analysis of spectrum, are as a result shown, two albumen are all DPT (such as Fig. 4).

8th, rhDPT analysis of biological activity：

RhDPT active determination in vitro：

3T3-L1 cells are seeded to 96 orifice plates, the DPT of purchase is added respectively when cell fusion is to 70% and uses The rhDPT for the various concentrations that the method expression and purification of stating is arrived, the 1st day to the 4th day after addition DPT is measured with mtt assay respectively lives Cell quantity.As a result finding the rhDPT (1ug/ml) of low concentration just has the effect of good suppression 3T3-L1 propagation, 1ug/ml The hDPT that the rhDPT of concentration is bought than 5ug/ml is more notable in terms of 3T3-L1 cultivation effects are suppressed (as shown in Figure 5：It is horizontal to sit The time is designated as, ordinate is cell proportion (living cells quantity of measurement point and the ratio of Day0 living cells quantities)).The result table It is bright, method expression and purification of the invention to rhDPT can suppress 3T3-L1 in-vitro multiplication, lived with good external biological Property.

Each technical characteristic of embodiment described above can be combined arbitrarily, to make description succinct, not to above-mentioned reality Apply all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited In contradiction, the scope of this specification record is all considered to be.

Embodiment described above only expresses the several embodiments of the present invention, and it describes more specific and detailed, but simultaneously Can not therefore it be construed as limiting the scope of the patent.It should be pointed out that coming for one of ordinary skill in the art Say, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection of the present invention Scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.

SEQUENCE LISTING

<110>Chinese Academy of Sciences Guangzhou Institute of Biomedicine and Health

<120>Recombined human DPT maturation peptide fragment and its production method

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 606

<212> DNA

<213>Artificial sequence

<400> 1

atggacctca gtcttctctg ggtacttctg cccctagtca ccatggcctg gggccagtat 60

ggcgattatg gatacccata ccagcagtat catgactaca gcgatgatgg gtgggtgaat 120

ttgaaccggc aaggcttcag ctaccagtgt ccccaggggc aggtgatagt ggccgtgagg 180

agcatcttca gcaagaagga aggttctgac agacaatgga actacgcctg catgcccaca 240

ccacagagcc tcggggaacc cacggagtgc tggtgggagg agatcaacag ggctggcatg 300

gaatggtacc agacgtgctc caacaatggg ctggtggcag gattccagag ccgctacttc 360

gagtcagtgc tggatcggga gtggcagttt tactgttgtc gctacagcaa gaggtgccca 420

tattcctgct ggctaacaat agaatatcca ggtcactatg gtgaggaaat ggacatgatt 480

tcctacaatt atgattacta tatccgagga gcaacaacca ctttctctgc agtggaaagg 540

gatcgccagt ggaagttcat aatgtgccgg atgactgaat acgactgtga atttgcaaat 600

gtttag 606

<210> 2

<211> 27

<212> DNA

<213>Artificial sequence

<400> 2

gaattccagt atggcgatta tggatac 27

<210> 3

<211> 30

<212> DNA

<213>Artificial sequence

<400> 3

gcggccgcag aagtgttgat gaacatttgg 30

Claims (10)

1. the production method of the ripe peptide fragment of a kind of recombined human DPT, it is characterised in that comprise the following steps：

(1) plasmid rhDPT/pMD-20T is prepared：People DPT gene of the base sequence as shown in SEQ ID NO.1 is obtained, will be described People's DPT genes are connected to pMD-20T carriers, obtain plasmid rhDPT/pMD-20T；

(2) recombinant vector pPICZ α A/DPT are built：PPICZ α A initial carriers and the plasmid rhDPT/pMD-20T are used respectively EcoR I and Not I carries out double digestion, and repurity is reclaimed, by the pPICZ α A vector genes fragments of recovery and rhDPT genetic fragments Connected with the DNA ligases of solution I, obtain recombinant vector pPICZ α A/DPT；

(3) conversion recombinant vector is into eucaryon yeast host：By the recombinant vector pPICZ α A/DPT single endonuclease digestion lines of Sac I Property, then be transferred in pichia yeast X-33 host, then obtain positive colony by the YPDZ plate screenings containing zeocin；

(4) screening of high-level secretory expression yeast transformant：The positive colony is forwarded to the YPDZ flat boards containing zeocin In, resistance yeast transformant is obtained using the screening of zeocin concentration gradients, then BMGY medium cultures are used, methanol induction is obtained High-level secretory expression yeast transformant；

(5) purify：RhDPT is purified with nickel affinity chromatography post, recombinant protein rhDPT is obtained.

2. the production method of the ripe peptide fragment of recombined human DPT according to claim 1, it is characterised in that step (4) specific method of the screening of the high-level secretory expression yeast transformant is：The positive colony is forwarded to and contained In zeocin YPDZ flat boards, resistance yeast transformant is obtained using the screening of zeocin concentration gradients, then use BMGY culture mediums Culture, is collected by centrifugation cell, and cell is resuspended with BMMY culture mediums, cell liquid is obtained, and adjust methanol final concentration in the cell liquid For 0.95-1.05%, 70-74h is induced, high-level secretory expression yeast transformant is obtained.

3. the production method of the ripe peptide fragment of recombined human DPT according to claim 2, it is characterised in that step (4) described in zeocin concentration gradients screening specific method be：The positive colony is forwarded to containing 490-510 μ g/ml In zeocin YPDZ flat boards, the yeast transformant that resistance is 500 μ g/ml zeocin is screened, then by the yeast transformant Washed down with fresh YPD fluid nutrient mediums, the YPDZ flat boards containing 1490-1510 μ g/ml zeocin are applied to after dilution In, then the yeast transformant grown in the YPDZ flat boards containing 1490-1510 μ g/mL Zeocin is applied to after dilution contained In the YPDZ flat boards for having 2990-3010 μ g/mL Zeocin, screening obtains the resistance ferment that resistance is 3000 μ g/ml zeocin Female transformant.

4. the production method of the ripe peptide fragment of recombined human DPT according to claim 2, it is characterised in that step (4) time of the induction described in is 72h.

5. the production method of the ripe peptide fragment of recombined human DPT according to claim 2, it is characterised in that step (4) temperature of the induction described in is 28 DEG C -32 DEG C.

6. the production method of the ripe peptide fragment of recombined human DPT according to claim 2, it is characterised in that step (4) rotating speed of the induction described in is 180-220rpm.

7. the production method of the ripe peptide fragment of recombined human DPT according to claim any one of 1-6, its feature exists In the specific method of the purifying described in step (5) is：The high-level secretory expression yeast transformant is enlarged culture, Culture supernatant is first dialysed with buffer A, recycles nickel affinity chromatography post to be purified in AKTA-HPLC systems, produces；It is described Buffer A is the buffer solution containing 0.2MNaCl, 50mM imidazoles, 20mM Tris, and its pH is 8.0.

8. the production method of the ripe peptide fragment of recombined human DPT according to claim 7, it is characterised in that utilize nickel When affinity column is purified in AKTA-HPLC systems, first rinsed with buffer A, recycle buffer B linear elution, collected MAu is more than 100 eluent, produces；The buffer B is the buffer solution containing 0.2MNaCl, 0.5M imidazoles, 20mM Tris, Its pH is 8.0.

9. the production method of the ripe peptide fragment of recombined human DPT according to claim any one of 1-6, its feature exists In zeocin concentration is 95-105 μ g/ml in the YPDZ flat boards described in step (3).

10. recombined human DPT maturation peptide fragment made from a kind of production method as described in claim any one of 1-9.