CN104177488B - One species specificity is for the aptamer of Neutrokine-α albumen and application thereof - Google Patents
One species specificity is for the aptamer of Neutrokine-α albumen and application thereof Download PDFInfo
- Publication number
- CN104177488B CN104177488B CN201410342519.8A CN201410342519A CN104177488B CN 104177488 B CN104177488 B CN 104177488B CN 201410342519 A CN201410342519 A CN 201410342519A CN 104177488 B CN104177488 B CN 104177488B
- Authority
- CN
- China
- Prior art keywords
- neutrokine
- albumen
- sle
- aptamer
- ssdna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/525—Tumour necrosis factor [TNF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Toxicology (AREA)
- Endocrinology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides the species specificity aptamer for Neutrokine α albumen, it has the activity preferably combining Neutrokine α albumen, may be used for preparation and becomes test kit thus specific screening and removal Neutrokine α albumen.
Description
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to for systemic lupus erythematosus many
Peptide.
Background technology
Systemic lupus erythematosus (sle) (SLE) is presently considered to be autoimmune disease, wherein the abnormal superfunction of bone-marrow-derived lymphocyte and
A large amount of abnormal generation of immunoglobulin γ (IgG) autoantibody plays pivotal role.This pathological process causes Ig to be coated with
The disappearance of cell and destruction, the fixing and cutting of complement protein and chemotaxin (chemotaxin), vasoactive peptide and
Destructive enzyme release in the tissue.
The concurrent atherosclerosis (AS) of systemic lupus erythematosus (sle) (SLE) is one of main cause of death of SLE.As far back as 1976
Year, it has been observed that SLE mortality curve in " bimodal " pattern, one is in activeness lupus commitment septicemia
High rate, another is the high rate of inactivity lupus late stage myocardial infarction.Although various Disease epizootic are arranged
Execute the survival rate substantially increasing Patients with SLE, but AS remains the main cause causing SLE death.
The case-control of lupus erythematosus (age, race, and sex match) research shows: in the age lupus erythematosus less than 50 years old
In patient, 31-37% patient shows the representative mark of AS pathological changes, and the crowd only having 9-15% in matched group shows
This represent mark；In the age patient more than or equal to 50 years old, the lupus patient of 70-80% shows Atherosclerosis
Change the representative mark of pathological changes, and in comparison crowd, the people of only 21-45% has this representative mark.
SLE is characterised by manifestations form.In disease process, the patient of 95% has told muscle skeleton disease altogether
Disease, 80% shows skin injury, and 85% has hematologic disease, and 60% has neurological disorders, and 60% has heart and lung diseases, 30%～50%
Having kidney disease, 40% has gastroenteropathy, and 15% has thrombosis and 15% to have ocular disease.Most patient (95%) goes back warp
By at the systemic conditions the most all existed, such as tired, uncomfortable, fever, anorexia with lose weight.Most of patients experiences
Burst and the alleviation disease phase alternately.Permanent alleviation (not having symptom when not treating) is the rarest.Before 50 years, most
It is diagnosed as patient's survival of SLE less than 5 years.Now, within 10 years, survival is more than 90%, and this is mainly based upon early diagnosis, antiinflammatory of suiting the medicine to the illness
And immunosuppressant therapy.The common cause of the death is the infection that immunosuppressant causes.
Result of study shows: include that hypertension, obesity, diabetes, smoking, hypercholesterolemia, postmenopausal state etc. exist
Interior conventional risk factors all can not explain the reason that in patients with SLE, coronary heart disease increases the weight of completely, and systemic lupus erythematosus (sle) is originally
Body (in the case of non-life-time service glucocorticoid) is still that an independent hazard factor.Although disease course and systemic red
Yabbi skin ulcer damage index is all the independent predictor promoting atherosclerosis (carotid atherosclerotic plaque), but how lupus increases dynamic
The occurrence risk of pulse atherosclerosis is not yet fully apparent from.
Conventional use antimalarial drug, anti-inflammatory agent and immunosuppressive drug in SLE treats.When symptom is difficult to control to, right
Non-steroidal anti-inflammatory agent supplements with 17-hydroxy-11-dehydrocorticosterone.Additionally, the active SLE that major organs is got involved needs to use the radical of cyclophosphamide
Sex therapy.
Up to now, the most not can be used for curing SLE and/or in long-term basis, improving the cause of disease of quality of the life of patient
Property treatment.But, the development in antibody technique recently and to having identified further of factor causing this autoimmune disease
Through opening the probability using monoclonal antibody as therapeutic choice.Especially, the favorable method for the treatment of SLE will be and cause
The specific treatment that a large amount of pathologic immune responses excessively produced of polyclone autoantibody interact or correct it.By
Pathogeny in SLE relates generally to the B cell of imbalance, and of particular concern is can the monoclonal antibody of targeting B cell.Latent
B cell surface antigen target be CD19, CD20, CD21 and CD22.Additionally, IL-10, IL-1ra, IL-12 are regulation immunity
The important cytokine of response, and especially raise during the burst of SLE patient.IL-10 and anti-double-chain DNA (dsDNA) from
The blood plasma level of body antibody often reflects the disease activity of the patient suffering from SLE.The IL-10 level raised and the disease of SLE patient
Sick activity relevant (Park etc., Clin.Exp.Rheumatol.1998 May-June；16 (3): 283-8).But, IL-10
It is that immune system is had polyphenic cytokine, and known its also participates in reducing proinflammatory response.
SLE patient has carried out using the clinical trial of monoclonal antibody.Especially, to relate to antibody profit appropriate in several tests
Former times monoclonal antibody (Rituximab), a kind of gomphosis mouse anti-CD-20 monoclonal antibody for treating non Hodgkin lymphom.
Robak and Robak (2009) notices, results of these tests demonstrate the activity that this antibody is higher in SLE patient, and
Develop the antibody (Ofatumumab, IMMU-106 and GA-101) of several new targeting CD20.Other reports monoclonal anti
The clinical trial of body activity in SLE uses anti-CD22 antibody, epratuzumab (Epratuzumab), anti-TNF alpha antibodies, English
Husband's profit former times monoclonal antibody (Infliximab), anti-IL-10 antibody, B-N10 (Llorente etc., Arthritis Rheum.2000 8
Month；43 (8): 1790-800), anti-CD40L antibodies, IDEC 131 and BG 9588, BLYS inhibitor, Baily monoclonal antibody
(Belimumab), anti-IL6 receptor antibody, the appropriate gram of female monoclonal antibody (Toclimumab) of profit and anti-C5 antibody are according to storehouse pearl monoclonal antibody
(Eculizumab) complete.
Neutrokine-α albumen (SEQ ID NO:1) is a member of tnf ligand family, itself and APRIL
(28.7%), TNF α (16.2%) and Lymphotoxin-α (LT α) (14.1%) enjoy Amino acid sequence identity (Moore, et
Al., (1999) Science 285:260-263).The formal name of Neutrokine-α is the super family of tumor necrosis factor (part)
Race member 13B (TNFSF13b).285 amino acid whose polypeptide of total length Neutrokine-α gene code, its 47th to 73
It is cross-film district between aminoacid, is II type embrane-associated protein distinctive non-hydrophobic sequence before cross-film district.With TNF family
Other members are the same, and Neutrokine-α plays a role with the form of trimer protein.When Neutrokine-α is at cell surface
After expression, cell lysis outskirt at the 134th amino acids, in order to discharge the trimer of biologic activity.
Known Neutrokine-α with from three kinds of tumor necrosis factor receptor super family not isoacceptor be combined.They are
Cross-film activator and CAM interaction body, B cell activating factor receptor, B cell maturation antigen.The expression of receptor is principally limited to B
Lymphocyte.Believe that the major part effect of Neutrokine-α is all mediated by BAFF-R, because at Neutrokine-α table
The major defect reached in the B cell component of defect or BAFF-R expression deficient mice and is failed to understand in TACI or BCMA deficient mice
Aobvious.
When detecting Neutrokine-α albumen in vitro and in vivo, Neutrokine-α is shown to promote B cell
Breed, break up and survive.It addition, Neutrokine-α also shows that some effects to T cell.By genetic engineering chemical conversion excessively
The mice expressing Neutrokine-α has the periphery B cell increasing number and the immunoglobulin concentrations increased.It addition,
Neutrokine-α transgenic mice shows autoimmune phenotype, and it is similar with see in people's systemic lupus erythematosus (sle), bag
Include generation autoantibody and glomerulonephritis related symptoms.Research later shows at autoimmune disease such as systemic red yabbi
Neutrokine-alpha levels in the serum of skin ulcer, rheumatoid arthritis and Patients with Sjogren Syndrome and/or synovial fluid is also by upper
Adjust.Therefore, being Neutrokine-alpha-2 antagonists in the view that scientific circles are universal has treatment in terms for the treatment of autoimmune disease
Effect.
Detailed Description Of The Invention
It is an object of the invention to provide can the aptamer of specific binding Neutrokine-α albumen, thus realize by
In human body, Neutrokine-α is combined, separate or function is suppressed, thus reaches systemic lupus erythematosus, rheumatoid
Arthritic effect.
The described oligonucleotide sequence that can identify Neutrokine-α albumen, including SEQ ID No.2-15, and uses it
In an oligonucleotide sequence just can complete the recognition detection to Neutrokine-α albumen；
The preparation method of described one group of oligonucleotide sequence that can identify Neutrokine-α albumen comprises the following steps:
1, synthesis is for the ssDNA oligonucleotide library (5 '-TCA GTC GCT TCG CCG TCT CCT of screening
TC----
N35----GCA CAA GAG GGA GAC CCC AGA GGG-3 '), wherein N35 is 35 random oligonucleotides；
2, SELEX screening is carried out after being mixed with Neutrokine-α albumen respectively by oligonucleotide library, it is thus achieved that aptamer
Enriched library；
3, after SELEX has screened, the aptamer enriched library obtained is carried out cloning and sequencing；
4, selecting the high copy ssDNA occurred in sequencing result, carry out affine specific checking, screening obtains and can identify
The oligonucleotide sequence of Neutrokine-α albumen.
Detailed description of the invention
Embodiment:
1, the preparation of Neutrokine-α albumen
The mode using yeast well known to those skilled in the art recombinant expressed obtains to be had and Neutrokine-α albumen
Identical bioactive Neutrokine-α albumen, this protein sequence is as shown in SEQ ID NO:1；The concentration of protein solution is
10mg/ml。
2, library and the synthesis of primer
2.1, synthesis is for the ssDNA oligonucleotide library (5 '-AATTCACTTACTTAACCAATCCGG----of screening
N35----ACACAAGAGTGAGAATTAGAGCG-3 '), wherein N35 is 35 random oligonucleotides；
Primer P1:AATTCACTTACTTAACCAATCCGG；
Primer P2:CGCTCTAATTCTCACTCTTGTGT.
2.2, the SELEX screening of aptamer, concrete grammar is as follows:
2.2.1ssDNA with the combination of Neutrokine-α albumen, separate, concrete grammar is as follows:
Take the ssDNA oligonucleotide library 4 μ L of 100 μMs, with 2 × combine buffer and be diluted to 100 μ l, 95 DEG C of degeneration
5min, adds 100 μ l Neutrokine-α albumen after ice bath 10min, shaking table combines 50min, then 6000rpm is centrifuged 7min, abandons
Supernatant, then with 1 × combine buffer and wash precipitation, abandon supernatant；Adding 1 in precipitation × combine buffer 100 μ L, 96 DEG C add
Hot 5min, then 15000rpm is centrifuged 10min, takes supernatant, and precipitation is again heated and is centrifuged, and merges supernatant, then can divide
SsDNA level library of affinity is had from obtaining with Neutrokine-α albumen；Described 2 × combine buffer be 20 × combine slow
Rush liquid distilled water and dilute the solution after 10 times, described 1 × combine buffer be 20 × combine buffer distilled water dilution 20
Solution after Bei；Described 20 × combine buffer formulation be 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM
MgCl2、pH 7.4。
2.2.2 ssDNA with Neutrokine-α albumen combination, separate, concrete grammar is as follows:
By step 2.2.1 isolated can ssDNA protein bound with Neutrokine-α, then with 100 μ l
Neutrokine-α albumen shaking table combines 30min, subsequent step with step 2.2.1, separable to and Neutrokine-α albumen
There is ssDNA level library of affinity.
2.2.3 asymmetric PCR amplification ssDNA, concrete grammar is as follows:
To step 2.2.2 separate obtain ssDNA level library carry out asymmetric PCR amplification, cumulative volume be 25 μ l not
Non-symmetric PCR amplification system is: 10 × PCR buffer: 2 μ l；P1 (10 μMs): 1 μ l；P2 (0.2 μM): 1 μ l；DNTP (each 2.5mM):
0.4μl；MgCl2(25mM): 1.2 μ l；SsDNA template (0.2 μ g/ μ l): 2 μ l；Taq archaeal dna polymerase (5u/ μ l): 0.2 μ l；
DdH2O:17.2 μ l；PCR response parameter: 94 DEG C of denaturations 4min, then carries out 94 DEG C of degeneration 30s of 40 circulations, 58 DEG C of annealing
30s, 72 DEG C extend 20s, and last 72 DEG C extend 7min；
2.2.4 the mensuration of affinity, concrete grammar is as follows:
2.2.4.1 amplification: expand ssDNA the level screened with the primer P1 asymmetric PCR with digoxigenin labeled
Library, amplification condition and parameter are identical with the asymmetric PCR amplification system of step 2.2.3 and parameter；
2.2.4.2 with protein binding: take the PCR primer 100 μ L of step 2.2.4.1 amplification gained, 95 DEG C of degeneration 5min, ice
Adding in 100 μ L albumen after bath 10min, be sufficiently mixed, at room temperature combine 30min, then 6000rpm is centrifuged, and separates albumen
With supernatant, albumen includes and the ssDNA of the band digoxigenin labeled of combination in albumen, supernatant is unconjugated
SsDNA, does a blank being not added with ssDNA simultaneously, i.e. with 2 × combine buffer and replace PCR primer, carry out aforesaid operations equally；
2.2.4.3 washing: by albumen with 1 × combine buffer 500 μ L and wash 1 time, 6000rpm is centrifugal, abandons supernatant, takes egg
In vain；
2.2.4.4 be combined with enzyme mark rabbit anti digoxin antibody: in albumen, add the excess of 100 μ L1:900TBS dilutions
Enzyme mark rabbit anti digoxin antibody, after being sufficiently mixed, reaction 10min, the ssDNA of the digoxigenin labeled being allowed in albumen are combined；
Described TBS is 0.5M Tris-NaCl solution, and compound method is: first water-soluble 8.5～9g NaCl, then adds Tris-
HCl (0.5M, pH7.6) solution 100ml, finally adds water and is settled to 1L；0.5M Tris-HCl (pH7.6,100ml) solution is prepared
Method: weigh Tris 6.06g, adds distilled water 40ml and dissolves, and drips dense HCl and adjusts pH to 7.6, is settled to 100ml.
2.2.4.5 washing: 6000rpm is centrifuged, and removes supernatant, then with 1 × combine buffer 500 μ L washing 3 times, obtain albumen；
2.2.4.6TMB (tetramethyl benzidine) colour developing: add the 400 μ resuspended albumen of L distilled water, add 200 μ L TMB
Nitrite ion, after lucifuge colour developing 10min, terminates reaction with 2mol/L H2SO4200 μ L, measures the light absorption value OD450 at 450nm,
This value i.e. reflects the affinity of the ssDNA being combined with bacterium, i.e. OD combines, and blank carries out above-mentioned steps 2.2.4.3 equally,
2.2.4.4,2.2.4.5 and 2.2.4.6, obtain blank corresponding absorbance OD blank；
Described TMB nitrite ion uses conventional compound method preparation.
2.2.4.7 the molar concentration of DNA in PCR primer is measured: take the PCR primer of step 2.2.4.1 amplification gained, with
The initial ssDNA library knowing Concentraton gradient is standard substance, with Bandscan software as image analysis software, uses ethidium bromide
DNA content in agarose gel electrophoresis method quantitative determination PCR primer, it is thus achieved that the molar concentration of corresponding DNA, and then can calculate
Go out the DNA molal quantity in 100 μ L PCR primer.
2.2.4.8 the affinity in corresponding library is calculated:
2.3 repeat screening, method particularly includes: using each product screening library as next round taking turns asymmetric PCR, weight
Multiple above-mentioned SELEX screens step 2.2, until affinity no longer rises, eventually passes 14 screenings taken turns and obtains the suitable of ssDNA
Gamete enriched library.After asymmetric PCR expands, condition, with step the most above, is cloned and checks order, obtain that copy number is the highest 18
18 aptamers are carried out affine specificity verification by individual effective ssDNA respectively, wherein have 4 specificitys not unique, therefore give up
Abandon.Therefore obtain 14 and Neutrokine-α albumen is had preferable affine specific oligonucleotide sequence (aptamer), specifically
Sequence is as follows:
The concrete data of affinity are as follows:
| Aptamer title | Affinity | Aptamer title | Affinity |
| NKXA1 | 0.49 | NKXA10 | 0.49 |
| NKXA3 | 0.51 | NKXA11 | 0.48 |
| NKXA4 | 0.46 | NKXA13 | 0.57 |
| NKXA5 | 0.49 | NKXA14 | 0.54 |
| NKXA6 | 0.52 | NKXA15 | 0.48 |
| NKXA7 | 0.54 | NKXA17 | 0.42 |
| NKXA9 | 0.51 | NKXA18 | 0.47 |
2.4, specificity and the affinity of 20 aptamers are analyzed
Fluorescently-labeled adaptor sequence is hatched with Neutrokine-α albumen, carries out flow cytometry detection, wherein
Article 14, sequence shows high fluorescent, uses GraphPad Prism5.0 software to do nonlinear regression for saturation curve bent
14 high-affinity adaptor sequence are used identical experimental implementation by line respectively, and having obtained every is the Kd value configured:
| Aptamer title | Kd value (nM) | Aptamer title | Kd value (nM) |
| NKXA1 | 20.5 | NKXA10 | 19.5 |
| NKXA3 | 21.2 | NKXA11 | 21.2 |
| NKXA4 | 24.7 | NKXA13 | 22.5 |
| NKXA5 | 25.6 | NKXA14 | 27.2 |
| NKXA6 | 26.5 | NKXA15 | 25.1 |
| NKXA7 | 23.1 | NKXA17 | 26.4 |
| NKXA9 | 28.6 | NKXA18 | 30.1 |
Wherein the Kd value of NKXA10 is minimum, illustrates can be quickly combined with target protein and Stability Analysis of Structures is not readily separated.
Use the secondary structure of 14 aptamers of DNAMAN software building and calculate their minimum free energy, its knot
Structure minimum free energy is the least, and structure is the most stable.
2.5 aptamer specificity analyses
It is respectively adopted BSA, APRIL albumen, Neutrokine-α albumen and 14 aptamers and carries out specific detection, pass through
Binding tests finds, these 14 sequences do not combine with BSA, APRIL albumen, and only protects with Neutrokine-α protein binding
Hold higher specificity.
3, the application of aptamer
By the 14 of the present invention aptamers, its 5 ' end adds the labelling with magnetic mark magnetic bead, can be prepared as examination
Agent box, pharmaceutical composition, by with contacting blood, by magnetic screening can realize for Neutrokine-α albumen in blood
Special separation, thus reach the effect of systemic lupus erythematosus, rheumatoid arthritis.
Claims (4)
1. the oligonucleotide sequence identifying Neutrokine-α albumen, it is characterised in that its sequence such as SEQ ID No.2 sequence
Shown in row.
2. the oligonucleotide sequence shown in claim 1 is for screening the application of Neutrokine-α albumen.
3. pharmaceutical composition, reagent or the test kit that the oligonucleotide sequence shown in claim 1 prepares.
4. the oligonucleotide sequence shown in claim 1 is used for treating the pharmaceutical composition of lupus erythematosus, reagent or examination in preparation
Application in agent box.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410342519.8A CN104177488B (en) | 2014-07-13 | 2014-07-13 | One species specificity is for the aptamer of Neutrokine-α albumen and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410342519.8A CN104177488B (en) | 2014-07-13 | 2014-07-13 | One species specificity is for the aptamer of Neutrokine-α albumen and application thereof |
Related Child Applications (12)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610294349.XA Division CN105713083A (en) | 2014-07-13 | 2014-07-13 | Specific aptamer NKXA17 for Neutrokine-alpha protein and application of specific aptamer NKXA17 |
| CN201610294373.3A Division CN105732802A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA11 specifically aiming at Neutrokine-alpha protein and application thereof |
| CN201610294384.1A Division CN105732803A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA6 specifically aiming at Neutrokine-alpha protein and application thereof |
| CN201610294374.8A Division CN105693846A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA10 specifically for Neutrokine-alpha protein and application of aptamer NKXA10 |
| CN201610294401.1A Division CN105693849A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA5 specifically for Neutrokine-alpha protein and application of aptamer NKXA5 |
| CN201610294383.7A Division CN105693848A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA7 specifically for Neutrokine-alpha protein and application of aptamer NKXA7 |
| CN201610294381.8A Division CN105693847A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA9 specifically for Neutrokine-alpha protein and application of aptamer NKXA9 |
| CN201610294403.0A Division CN105732804A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA4 specifically aiming at Neutrokine-alpha protein and application thereof |
| CN201610294371.4A Division CN105753967A (en) | 2014-07-13 | 2014-07-13 | Nucleic acid aptamer NKXA14 specifically aiming at Neutrokine-alpha protein and application thereof |
| CN201610294350.2A Division CN105732800A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA15 specifically aiming at Neutrokine-alpha protein and application thereof |
| CN201610294372.9A Division CN105732801A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA13 specifically aiming at Neutrokine-alpha protein and application thereof |
| CN201610294348.5A Division CN105732799A (en) | 2014-07-13 | 2014-07-13 | Aptamer NKXA18 specifically aiming at Neutrokine-alpha protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104177488A CN104177488A (en) | 2014-12-03 |
| CN104177488B true CN104177488B (en) | 2016-09-14 |
Family
ID=51958856
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410342519.8A Active CN104177488B (en) | 2014-07-13 | 2014-07-13 | One species specificity is for the aptamer of Neutrokine-α albumen and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104177488B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106680411B (en) * | 2017-03-20 | 2018-10-09 | 汉氏联合（天津）干细胞研究院有限公司 | One kind being used for the kit and its detection method of detecting system lupus erythematosus (SLE) |
| CN110684774B (en) * | 2019-11-07 | 2021-11-19 | 郑州大学 | Aptamer specifically binding to DEK protein and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100375750C (en) * | 2003-05-15 | 2008-03-19 | 中国疾病预防控制中心病毒病预防控制所 | Oligopolynucleotide of inhibiting activity of necrosin in human tumor |
| CN101512007A (en) * | 2005-10-13 | 2009-08-19 | 人体基因组科学有限公司 | Methods and compositions for use in treatment of patients with autoantibody positive diseases |
-
2014
- 2014-07-13 CN CN201410342519.8A patent/CN104177488B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104177488A (en) | 2014-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7153775B2 (en) | Prediction of clinical response to IL23 antagonists using IL23 pathway biomarkers | |
| CN111849994B (en) | Aptamer of SARS-CoV-2S protein or RBD protein and application thereof | |
| US11180565B2 (en) | Method of enriching a target nucleic acid at a TNFRSF1B gene locus in a sample from a subject with inflammatory bowel disease | |
| JP6755240B2 (en) | How to Diagnose Chronic Obstructive Pulmonary Disease (COPD) Using New Molecular Biomarkers | |
| JP6755241B2 (en) | How to Diagnose Chronic Obstructive Pulmonary Disease (COPD) Using New Molecular Biomarkers | |
| WO2016050110A1 (en) | Biomarkers for rheumatoid arthritis and usage thereof | |
| JP6662969B2 (en) | Methods for diagnosing the molecular phenotype of patients with diseases associated with chronic inflammation | |
| JP2022512796A (en) | Type I interferon signature and usage | |
| KR101064866B1 (en) | Primers capable of simultaneous detecting bovine coronavirus, bovine rotavirus and bovine viral diarrhea virus, and simultaneous detection method of diarrhea viruses in ruminants, including cattle, using the same | |
| CN104177488B (en) | One species specificity is for the aptamer of Neutrokine-α albumen and application thereof | |
| Vidic et al. | selection approach to develop DNA aptamers for a stem-like cell subpopulation of non-small lung cancer adenocarcinoma cell line A549 | |
| EP3055426B1 (en) | Detection of hepatitis delta virus (hdv) for the diagnosis and treatment of sjögren's syndrome and lymphoma | |
| CN105713083A (en) | Specific aptamer NKXA17 for Neutrokine-alpha protein and application of specific aptamer NKXA17 | |
| CN105732803A (en) | Aptamer NKXA6 specifically aiming at Neutrokine-alpha protein and application thereof | |
| CN105732802A (en) | Aptamer NKXA11 specifically aiming at Neutrokine-alpha protein and application thereof | |
| CN105732799A (en) | Aptamer NKXA18 specifically aiming at Neutrokine-alpha protein and application thereof | |
| CN105732800A (en) | Aptamer NKXA15 specifically aiming at Neutrokine-alpha protein and application thereof | |
| CN105732801A (en) | Aptamer NKXA13 specifically aiming at Neutrokine-alpha protein and application thereof | |
| CN105732804A (en) | Aptamer NKXA4 specifically aiming at Neutrokine-alpha protein and application thereof | |
| CN105753967A (en) | Nucleic acid aptamer NKXA14 specifically aiming at Neutrokine-alpha protein and application thereof | |
| US20230096620A1 (en) | Alpha4beta7 inhibitor and il-23 inhibitor combination therapy | |
| CN105693848A (en) | Aptamer NKXA7 specifically for Neutrokine-alpha protein and application of aptamer NKXA7 | |
| CN105693847A (en) | Aptamer NKXA9 specifically for Neutrokine-alpha protein and application of aptamer NKXA9 | |
| CN105693846A (en) | Aptamer NKXA10 specifically for Neutrokine-alpha protein and application of aptamer NKXA10 | |
| CN105693849A (en) | Aptamer NKXA5 specifically for Neutrokine-alpha protein and application of aptamer NKXA5 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 710100, public square, 385 Middle Road, Xi'an, Shaanxi Applicant after: Ma Hailong Address before: 32, 1, building 0203, R & F 366, 710100 Aerospace Avenue, Shaanxi, Xi'an, Changan District Applicant before: Ma Hailong |
|
| COR | Change of bibliographic data | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| CB03 | Change of inventor or designer information |
Inventor after: Lv Jing Inventor after: Deng Tao Inventor after: Zhang Zhiwei Inventor after: Zhu Xiuhuang Inventor before: Ma Hailong |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160804 Address after: 100176 Beijing branch of Beijing economic and Technological Development Zone Street 88 Hospital No. 9 Building 2 unit Applicant after: Beijing CapitalBio MedLab Co., Ltd. Address before: 710100, public square, 385 Middle Road, Xi'an, Shaanxi Applicant before: Ma Hailong |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |