CN104177488A - Specific nucleic acid aptamer for Neutrokine-alpha protein and application thereof - Google Patents

Specific nucleic acid aptamer for Neutrokine-alpha protein and application thereof Download PDF

Info

Publication number
CN104177488A
CN104177488A CN201410342519.8A CN201410342519A CN104177488A CN 104177488 A CN104177488 A CN 104177488A CN 201410342519 A CN201410342519 A CN 201410342519A CN 104177488 A CN104177488 A CN 104177488A
Authority
CN
China
Prior art keywords
neutrokine
albumen
ssdna
sle
aptamer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410342519.8A
Other languages
Chinese (zh)
Other versions
CN104177488B (en
Inventor
马海龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Capitalbio Medlab Co Ltd
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201410342519.8A priority Critical patent/CN104177488B/en
Publication of CN104177488A publication Critical patent/CN104177488A/en
Application granted granted Critical
Publication of CN104177488B publication Critical patent/CN104177488B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/525—Tumour necrosis factor [TNF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Toxicology (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a specific nucleic acid aptamer for Neutrokine-alpha protein, which has favorable combination activity with the Neutrokine-alpha protein and can be used for preparing a kit, thereby implementing specific screening and removing the Neutrokine-alpha protein.

Description

One species specificity is for aptamer and the application thereof of Neutrokine-α albumen
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to be used for the treatment of the polypeptide of systemic lupus erythematous.
Background technology
Systemic lupus erythematous (SLE) it is believed that it is autoimmune disorders, and wherein a large amount of abnormal generation of the abnormal superfunction of bone-marrow-derived lymphocyte and immunoglobulin (Ig) γ (IgG) autoantibody plays keying action.This pathological process causes fixing and cutting and chemotaxin (chemotaxin), vasoactive peptide and the release of destructive enzyme in tissue of the disappearance of the coated cell of Ig and destruction, complement proteins.
The concurrent atherosclerosis of systemic lupus erythematous (SLE) (AS) is one of main cause of death of SLE.As far back as 1976, it has been observed that SLE mortality curve is " bimodal " pattern, one is the high rate in reactivity lupus commitment septicemia, another is the high rate of inactivity lupus late stage myocardial infarction.Although various diseases measure of control have improved the survival rate of Patients with SLE greatly, but AS remains the major cause that causes SLE death.Case-control (the age of lupus erythematosus, race, matching with sex) research shows: in the age is less than the patient of lupus erythematosus of 50 years old, 31-37% patient shows the representative mark of AS pathology, and in control group, only has the crowd of 9-15% to show this mark that represents; In the age is more than or equal to the patient of 50 years old, the lupus patient of 70-80% shows the representative mark of atherosclerotic lesion, and in contrast crowd, only has the people of 21-45% to have this representative mark.
SLE is characterised in that manifestations form.In disease process, 95% patient has told musculoskeletal disease altogether, and 80% shows skin injury, 85% has hematologic disease, and 60% has nervous disorders, and 60% has heart and lung diseases, 30%～50% has kidney disease, and 40% has gastrointestinal tract disease, and 15% has thrombus and 15% to have eye disease.Most patient (95%) also stands the systemic symptom all existing most of time, as tired, uncomfortable, fever, apocleisis with lose weight.The burst of most of patients experience and alleviation disease phase alternately.Permanent alleviation (there is no symptom while treatment) is very rare.Before exceeding 50 years, patient's survival that majority is diagnosed as SLE is less than 5 years.Now, survival in 10 years exceedes 90%, and this is mainly based on early diagnosis, suit the medicine to the illness anti-inflammatory and immunosuppressant therapy.The common cause of the death is the infection that immunosuppression causes.
Result of study shows: including hypertension, obesity, diabetes, smoking, hypercholesterolemia, postmenopausal state etc., conventional risk factors all can not be explained the reason that in patients with SLE, coronary heart disease increases the weight of completely, and systemic lupus erythematous itself (in the situation of non-life-time service glucocorticosteroid) is still an independent hazard factor.Although disease course and systemic lupus erythematous damage index are all the independent predictors that promotes atherosclerosis (carotid plaques), it is not yet completely clear how lupus increases atherosclerotic occurrence risk.
Conventional antimalarial drug, antiphlogiston and the immunosuppressive drug of using in SLE treatment.In the time that symptom is difficult to control, non-steroidal anti-inflammatory agent is supplemented with cortin.In addition the active SLE that, major organs is got involved need to adopt the radical Sex therapy of endoxan.
Up to now, also not can be used for the causal treatment of curing SLE and/or improving patient's quality of the life in long-term basis.But the possibility that uses monoclonal antibody to select as treatment has been opened in the development in antibody technique recently and the further qualification to the factor that causes this autoimmune disorders.Especially, the favorable method for the treatment of SLE interacts with a large amount of pathologic immune responses that excessively produce that cause polyclone autoantibody being or by the specific treatment of its correction.Because the pathogeny of SLE relates generally to the B cell of imbalance, concerned is especially can target B cell monoclonal antibody.Potential B cell-surface antigens target is CD19, CD20, CD21 and CD22.In addition, IL-10, IL-1ra, IL-12 are the important cytokine that regulates immune response, and especially between SLE patient's burst period, raise.The blood plasma level of the autoantibody of IL-10 and anti-double-chain DNA (dsDNA) often reflects the patient's who suffers from SLE disease activity.The IL-10 level (Park etc., the Clin.Exp.Rheumatol.1998 May-June relevant to SLE patient's disease activity that raise; 16 (3): 283-8).But IL-10 has polyphenic cytokine to immunity system, and known its also participates in reducing proinflammatory response.
SLE patient is carried out adopting the clinical trial of monoclonal antibody.Especially, several tests relate to antibody Rituximab (Rituximab), a kind of gomphosis mouse anti-CD-20 monoclonal antibody that is used for the treatment of non-Hodgkin′s lymphomas.Robak and Robak (2009) notice, the result of these tests demonstrates this antibody higher activity in SLE patient, and developed the antibody (Ofatumumab, IMMU-106 and GA-101) of several new target CD20.Other has reported that the active clinical trial of monoclonal antibody in SLE adopts anti-CD22 antibody, epratuzumab (Epratuzumab), anti-TNF alpha antibodies, infliximab (Infliximab), anti-IL-10 antibody, B-N10 (Llorente etc., Arthritis Rheum.2000 August; 43 (8): 1790-800), anti-CD40L antibodies, IDEC 131 and BG 9588, BLYS inhibitor, Baily monoclonal antibody (Belimumab), anti-IL6 receptor antibody, the appropriate gram of female monoclonal antibody of profit (Toclimumab) and anti-C5 antibody complete according to storehouse pearl monoclonal antibody (Eculizumab).
Neutrokine-α albumen (SEQ ID NO:1) is a member of tnf ligand family, itself and APRIL (28.7%), TNF α (16.2%) and Lymphotoxin-α (LT α) (14.1%) are enjoyed aminoacid sequence homogeny (Moore, et al., (1999) Science 285:260-263).The formal title of Neutrokine-α is tumour necrosis factor (part) superfamily member 13B (TNFSF13b).285 amino acid whose polypeptide of total length Neutrokine-α genes encoding, its 47th between 73 amino acids being cross-film district, is the distinctive non-hydrophobicity sequence of II type embrane-associated protein before cross-film district.The same with other members of TNF family, Neutrokine-α plays a role with the form of trimer protein.When Neutrokine-α is after cell surface expression, at the 134th amino acids place lysing cell outskirt, to discharge the tripolymer of biologic activity.
Known Neutrokine-α and three kinds of different receptors bind from tumor necrosis factor receptor super family.They are cross-film activator and CAM mutual effect body, B cell activation factor acceptor, B cell maturation antigen.The expression of acceptor is mainly defined in bone-marrow-derived lymphocyte.The major part effect of believing Neutrokine-α is all mediated by BAFF-R, because the major defect in the B cellular component of Neutrokine-alpha expression defect or BAFF-R expression deficient mice is also not obvious in TACI or BCMA deficient mice.
In the time detecting Neutrokine-α albumen in vitro and in vivo, Neutrokine-α demonstrates propagation, differentiation and the existence that can promote B cell.In addition, Neutrokine-α also demonstrates some effects to T cell.The mouse that is changed into overexpression Neutrokine-α by genetic engineering has the periphery B cell of increase number and the immunoglobulin (Ig) concentration increasing.In addition, Neutrokine-α transgenic mice shows autoimmunization phenotype, and that in itself and robot system lupus erythematosus, sees is similar, comprises autoantibody and glomerulonephritis relevant symptoms occur.Afterwards studies show that the Neutrokine-alpha levels in serum and/or the synovial fluid of for example systemic lupus erythematous, rheumatoid arthritis and Patients with Sjogren Syndrome of autoimmune disease is also raised.Therefore be, that Neutrokine-alpha-2 antagonists has therapeutic action aspect treatment autoimmune disease in the general view of scientific circles.
Detailed Description Of The Invention
The object of the present invention is to provide can specific binding Neutrokine-α albumen aptamer, thereby realize suppressed to combined Neutrokine-α in human body, separation or function, thereby reach the effect of systemic lupus erythematosus, rheumatoid arthritis.
The described oligonucleotide sequence that can identify Neutrokine-α albumen, comprises SEQ ID No.2-15, and adopts an oligonucleotide sequence wherein just can complete the recognition detection to Neutrokine-α albumen;
Described one group of preparation method that can identify the oligonucleotide sequence of Neutrokine-α albumen comprises the following steps:
1, synthesize the ssDNA oligonucleotide library (5 '-TCA GTC GCT TCG CCG TCT CCT TC----for screening
N35----GCA CAA GAG GGA GAC CCC AGA GGG-3 '), wherein N35 is 35 random oligonucleotides;
2, carry out SELEX screening after oligonucleotide library is mixed with Neutrokine-α albumen respectively, obtain aptamer enriched library;
3,, after SELEX has screened, the aptamer enriched library obtaining is carried out to cloning and sequencing;
4, the height copy ssDNA occurring in selection sequencing result, carries out affine specific checking, and screening obtains the oligonucleotide sequence that can identify Neutrokine-α albumen.
Embodiment
Embodiment:
1, the preparation of Neutrokine-α albumen
Adopt the recombinant expressed mode of yeast well known to those skilled in the art to obtain and have bioactive Neutrokine-α albumen identical with Neutrokine-α albumen, this protein sequence is as shown in SEQ ID NO:1; The concentration of protein solution is 10mg/ml.
2, library and primer is synthetic
2.1, synthesize the ssDNA oligonucleotide library (5 '-AATTCACTTACTTAACCAATCCGG----N35----ACACAAGAGTGAGAATTAGAG CG-3 ') for screening, wherein N35 is 35 random oligonucleotides;
Primer P1:AATTCACTTACTTAACCAATCCGG;
Primer P2:CGCTCTAATTCTCACTCTTGTGT.
2.2, the SELEX of aptamer screening, concrete grammar is as follows:
2.2.1ssDNA with the combination of Neutrokine-α albumen, separate, concrete grammar is as follows:
Get the ssDNA oligonucleotide library 4 μ L of 100 μ M, be diluted to 100 μ l with 2 × binding buffer liquid, 95 DEG C of sex change 5min, after ice bath 10min, add 100 μ l Neutrokine-α albumen, shaking table is in conjunction with 50min, the more centrifugal 7min of 6000rpm, abandons supernatant, then use 1 × binding buffer liquid to wash precipitation, abandon supernatant; In precipitation, add again 1 × binding buffer liquid, 100 μ L, 96 DEG C of heating 5min, the then centrifugal 10min of 15000rpm, get supernatant liquor, to precipitation heating centrifugal again, merge supernatant liquor, separable ssDNA the level library that obtains having with Neutrokine-α albumen avidity; Described 2 × binding buffer liquid is the solution after 20 × binding buffer liquid distilled water dilutes 10 times, and described 1 × binding buffer liquid is the solution after 20 × binding buffer liquid distilled water dilutes 20 times; Described 20 × binding buffer liquid formula is 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl2, pH 7.4.
2.2.2 the combination of ssDNA and Neutrokine-α albumen, separate, concrete grammar is as follows:
By step 2.2.1 separate obtain can with the protein bound ssDNA of Neutrokine-α, be combined again 30min with 100 μ l Neutrokine-α albumen shaking tables, subsequent step is with step 2.2.1, separable to having ssDNA level library of avidity with Neutrokine-α albumen.
2.2.3 asymmetric PCR amplification ssDNA, concrete grammar is as follows:
Step 2.2.2 is separated to ssDNA the level library obtaining and carry out asymmetric PCR amplification, cumulative volume is that the asymmetric PCR amplification system of 25 μ l is: 10 × PCR damping fluid: 2 μ l; P1 (10 μ M): 1 μ l; P2 (0.2 μ M): 1 μ l; DNTP (each 2.5mM): 0.4 μ l; MgCl 2(25mM): 1.2 μ l; SsDNA template (0.2 μ g/ μ l): 2 μ l; Taq archaeal dna polymerase (5u/ μ l): 0.2 μ l; DdH2O:17.2 μ l; PCR reaction parameter: 94 DEG C of denaturation 4min, then carry out 94 DEG C of sex change 30s of 40 circulations, 58 DEG C of annealing 30s, 72 DEG C are extended 20s, and last 72 DEG C are extended 7min;
2.2.4 the mensuration of avidity, concrete grammar is as follows:
2.2.4.1 amplification: use with the primer P1 asymmetric PCR of digoxigenin labeled screen the ssDNA time grade of library of increase, amplification condition is identical with asymmetric PCR amplification system and the parameter of step 2.2.3 with parameter;
2.2.4.2 with protein binding: the PCR product 100 μ L that get step 2.2.4.1 amplification gained, 95 DEG C of sex change 5min, add after ice bath 10min in 100 μ L albumen, fully mix, at room temperature in conjunction with 30min, then 6000rpm is centrifugal, protein isolate and supernatant liquor, in albumen, include with albumen in the ssDNA with digoxigenin labeled of combination, in supernatant liquor, be unconjugated ssDNA, do a blank that does not add ssDNA simultaneously, use 2 × binding buffer liquid to replace PCR product, carry out equally aforesaid operations;
2.2.4.3 washing: by 1 × binding buffer liquid, 500 μ L washing 1 time for albumen, 6000rpm is centrifugal, abandons supernatant, gets albumen;
2.2.4.4 be combined with enzyme mark rabbit anti digoxin antibody: in albumen, add the excessive enzyme mark rabbit anti digoxin antibody of 100 μ L1:900TBS dilutions, after fully mixing, reaction 10min, the ssDNA that makes it the digoxigenin labeled in albumen is combined;
Described TBS is 0.5M Tris-NaCl solution, and compound method is: first water-soluble 8.5～9g NaCl, then add Tris-HCl (0.5M, pH7.6) solution 100ml, finally add water and be settled to 1L; 0.5M Tris-HCl (pH7.6,100ml) solution preparation method: take Tris 6.06g, add distilled water 40ml to dissolve, drip dense HCl and adjust pH to 7.6, be settled to 100ml.
2.2.4.5 washing: 6000rpm is centrifugal, removes supernatant, then use 1 × binding buffer liquid, 500 μ L washing 3 times, obtain albumen;
2.2.4.6TMB (tetramethyl benzidine) colour developing: add the resuspended albumen of 400 μ L distilled water, add again 200 μ L TMB nitrite ions, after lucifuge colour developing 10min, with 2mol/L H2SO4200 μ L termination reaction, measure the light absorption value OD450 at 450nm place, this value reflects the avidity of the ssDNA of being combined with bacterium, be OD combination, blank is carried out above-mentioned steps 2.2.4.3,2.2.4.4 equally, 2.2.4.5 and 2.2.4.6, obtain blank corresponding absorbancy OD blank;
Described TMB nitrite ion uses conventional compound method preparation.
2.2.4.7 measure the volumetric molar concentration of DNA in PCR product: the PCR product of getting step 2.2.4.1 amplification gained, taking the initial ssDNA library of concentration known gradient as standard substance, with Bandscan software as image analysis software, adopt the DNA content in ethidium bromide agarose gel electrophoresis method quantitative assay PCR product, obtain the volumetric molar concentration of corresponding DNA, and then can calculate the DNA mole number in 100 μ L PCR products.
2.2.4.8 calculate the avidity in corresponding library:
2.3 repeat screening, concrete grammar is: take turns the product of asymmetric PCR as the screening library of next round using each, repeat above-mentioned SELEX screening step 2.2, until avidity no longer rises, obtain the aptamer enriched library of ssDNA finally by mistake 14 screenings of taking turns.After asymmetric PCR amplification, the same step above of condition, clones and checks order, and obtains 18 effective ssDNA that copy number is the highest, and 18 aptamers are carried out respectively to affine specificity checking, wherein has 4 specificitys not unique, therefore gives up.Therefore obtaining 14 has better affine specific oligonucleotide sequence (aptamer) to Neutrokine-α albumen, and concrete sequence is as follows:
The concrete data of avidity are as follows:
Aptamer title Avidity Aptamer title Avidity
NKXA1 0.49 NKXA10 0.49
NKXA3 0.51 NKXA11 0.48
NKXA4 0.46 NKXA13 0.57
NKXA5 0.49 NKXA14 0.54
NKXA6 0.52 NKXA15 0.48
NKXA7 0.54 NKXA17 0.42
NKXA9 0.51 NKXA18 0.47
2.4, analyze specificity and the affinity of 20 aptamers
Fluorescently-labeled aptamer sequence and Neutrokine-α albumen are hatched, carry out flow cytometry detection, wherein 14 sequences have shown high fluorescent, use GraphPad Prism5.0 software to do non-linear regression curve for saturation curve, respectively 14 high-affinity aptamer sequences are adopted to identical experimental implementation, having obtained every is the Kd value of configuration:
Aptamer title Kd value (nM) Aptamer title Kd value (nM)
NKXA1 20.5 NKXA10 19.5
NKXA3 21.2 NKXA11 21.2
NKXA4 24.7 NKXA13 22.5
NKXA5 25.6 NKXA14 27.2
NKXA6 26.5 NKXA15 25.1
NKXA7 23.1 NKXA17 26.4
NKXA9 28.6 NKXA18 30.1
Wherein the Kd value of NKXA10 is minimum, illustrate with target protein fast combination and Stability Analysis of Structures not easily separated.
Adopt DNAMAN software building 14 aptamers secondary structure and calculated their minimum free energy, its structure minimum free energy is also all less, structure is also relatively stable.
2.5 aptamer specificity analyses
Adopt respectively BSA, APRIL albumen, Neutrokine-α albumen and 14 aptamers to carry out specific detection, through finding in conjunction with test, these 14 sequences do not combine with BSA, APRIL albumen, and only keep higher specificity with Neutrokine-α protein binding.
3, the application of aptamer
By 14 aptamers of the present invention, its 5 ' end adds the mark with magnetic mark magnetic bead, can prepare and become test kit, pharmaceutical composition, by contacting with blood, screen the special separation that can realize for Neutrokine-α albumen in blood by magnetic, thereby reach the effect of systemic lupus erythematosus, rheumatoid arthritis.

Claims (5)

1. for a Neutrokine-α albumen for aptamer screening, its sequence is shown in SEQ ID NO:1.
2. identify an oligonucleotide sequence for Neutrokine-α albumen, it is characterized in that for shown in arbitrary sequence of SEQ ID No.2-15.
3. the application of the oligonucleotide sequence shown in claim 2 for screening Neutrokine-α albumen.
4. the oligonucleotide sequence shown in claim 2 prepares pharmaceutical composition, reagent or test kit.
5. the application of the oligonucleotide sequence shown in claim 4 in pharmaceutical composition, reagent or test kit for the preparation for the treatment of lupus erythematosus.
CN201410342519.8A 2014-07-13 2014-07-13 One species specificity is for the aptamer of Neutrokine-α albumen and application thereof Active CN104177488B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410342519.8A CN104177488B (en) 2014-07-13 2014-07-13 One species specificity is for the aptamer of Neutrokine-α albumen and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410342519.8A CN104177488B (en) 2014-07-13 2014-07-13 One species specificity is for the aptamer of Neutrokine-α albumen and application thereof

Related Child Applications (12)

Application Number Title Priority Date Filing Date
CN201610294381.8A Division CN105693847A (en) 2014-07-13 2014-07-13 Aptamer NKXA9 specifically for Neutrokine-alpha protein and application of aptamer NKXA9
CN201610294384.1A Division CN105732803A (en) 2014-07-13 2014-07-13 Aptamer NKXA6 specifically aiming at Neutrokine-alpha protein and application thereof
CN201610294371.4A Division CN105753967A (en) 2014-07-13 2014-07-13 Nucleic acid aptamer NKXA14 specifically aiming at Neutrokine-alpha protein and application thereof
CN201610294401.1A Division CN105693849A (en) 2014-07-13 2014-07-13 Aptamer NKXA5 specifically for Neutrokine-alpha protein and application of aptamer NKXA5
CN201610294403.0A Division CN105732804A (en) 2014-07-13 2014-07-13 Aptamer NKXA4 specifically aiming at Neutrokine-alpha protein and application thereof
CN201610294348.5A Division CN105732799A (en) 2014-07-13 2014-07-13 Aptamer NKXA18 specifically aiming at Neutrokine-alpha protein and application thereof
CN201610294383.7A Division CN105693848A (en) 2014-07-13 2014-07-13 Aptamer NKXA7 specifically for Neutrokine-alpha protein and application of aptamer NKXA7
CN201610294350.2A Division CN105732800A (en) 2014-07-13 2014-07-13 Aptamer NKXA15 specifically aiming at Neutrokine-alpha protein and application thereof
CN201610294374.8A Division CN105693846A (en) 2014-07-13 2014-07-13 Aptamer NKXA10 specifically for Neutrokine-alpha protein and application of aptamer NKXA10
CN201610294373.3A Division CN105732802A (en) 2014-07-13 2014-07-13 Aptamer NKXA11 specifically aiming at Neutrokine-alpha protein and application thereof
CN201610294372.9A Division CN105732801A (en) 2014-07-13 2014-07-13 Aptamer NKXA13 specifically aiming at Neutrokine-alpha protein and application thereof
CN201610294349.XA Division CN105713083A (en) 2014-07-13 2014-07-13 Specific aptamer NKXA17 for Neutrokine-alpha protein and application of specific aptamer NKXA17

Publications (2)

Publication Number Publication Date
CN104177488A true CN104177488A (en) 2014-12-03
CN104177488B CN104177488B (en) 2016-09-14

Family

ID=51958856

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410342519.8A Active CN104177488B (en) 2014-07-13 2014-07-13 One species specificity is for the aptamer of Neutrokine-α albumen and application thereof

Country Status (1)

Country Link
CN (1) CN104177488B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106680411A (en) * 2017-03-20 2017-05-17 申冬昌 Kit for detecting systemic lupus erythematosus (SLE) and detection method thereof
CN110684774A (en) * 2019-11-07 2020-01-14 郑州大学 Aptamer specifically binding to DEK protein and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1550501A (en) * 2003-05-15 2004-12-01 �й�����Ԥ���������IJ�����Ԥ������ Oligopolynucleotide of inhibiting activity of necrosin in human tumor
CN101512007A (en) * 2005-10-13 2009-08-19 人体基因组科学有限公司 Methods and compositions for use in treatment of patients with autoantibody positive diseases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1550501A (en) * 2003-05-15 2004-12-01 �й�����Ԥ���������IJ�����Ԥ������ Oligopolynucleotide of inhibiting activity of necrosin in human tumor
CN101512007A (en) * 2005-10-13 2009-08-19 人体基因组科学有限公司 Methods and compositions for use in treatment of patients with autoantibody positive diseases

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106680411A (en) * 2017-03-20 2017-05-17 申冬昌 Kit for detecting systemic lupus erythematosus (SLE) and detection method thereof
CN106680411B (en) * 2017-03-20 2018-10-09 汉氏联合（天津）干细胞研究院有限公司 One kind being used for the kit and its detection method of detecting system lupus erythematosus (SLE)
CN110684774A (en) * 2019-11-07 2020-01-14 郑州大学 Aptamer specifically binding to DEK protein and application thereof
CN110684774B (en) * 2019-11-07 2021-11-19 郑州大学 Aptamer specifically binding to DEK protein and application thereof

Also Published As

Publication number Publication date
CN104177488B (en) 2016-09-14

Similar Documents

Publication Publication Date Title
CN111849994B (en) Aptamer of SARS-CoV-2S protein or RBD protein and application thereof
TW201827079A (en) Methods of treating inflammatory conditions
Segal-Salto et al. A blocking monoclonal antibody to CCL24 alleviates liver fibrosis and inflammation in experimental models of liver damage
JP6858182B2 (en) Biomarkers for interleukin 33 (IL-33) -mediated diseases and their use
US10822406B2 (en) Method for treating chronic intestinal inflammation and inflammatory bowel disease by administering antagonists of Oncostatin-M (OSM) and/or antagonists of OSM receptor-beta (OSMR)
TW201928063A (en) Methods for treating HEPCIDIN-mediated disorders
CN104177488A (en) Specific nucleic acid aptamer for Neutrokine-alpha protein and application thereof
KR20230140553A (en) Methods, systems, and kits for treatment of inflammatory diseases targeting TL1A
JP2014074723A (en) Biomarker for expecting responsiveness to anti-tumor necrosis factor (tnf) alpha treatment
EP2148934B1 (en) Matrix marker model and methods for assessing and treating rheumatoid arthritis
JP7016165B2 (en) Apoptosis-promoting antibodies and their use
US20230096620A1 (en) Alpha4beta7 inhibitor and il-23 inhibitor combination therapy
CN105753967A (en) Nucleic acid aptamer NKXA14 specifically aiming at Neutrokine-alpha protein and application thereof
CN105713083A (en) Specific aptamer NKXA17 for Neutrokine-alpha protein and application of specific aptamer NKXA17
CN105732803A (en) Aptamer NKXA6 specifically aiming at Neutrokine-alpha protein and application thereof
CN105732802A (en) Aptamer NKXA11 specifically aiming at Neutrokine-alpha protein and application thereof
CN105732804A (en) Aptamer NKXA4 specifically aiming at Neutrokine-alpha protein and application thereof
CN105732799A (en) Aptamer NKXA18 specifically aiming at Neutrokine-alpha protein and application thereof
CN105732800A (en) Aptamer NKXA15 specifically aiming at Neutrokine-alpha protein and application thereof
CN105732801A (en) Aptamer NKXA13 specifically aiming at Neutrokine-alpha protein and application thereof
CN105693849A (en) Aptamer NKXA5 specifically for Neutrokine-alpha protein and application of aptamer NKXA5
CN105693848A (en) Aptamer NKXA7 specifically for Neutrokine-alpha protein and application of aptamer NKXA7
CN105693847A (en) Aptamer NKXA9 specifically for Neutrokine-alpha protein and application of aptamer NKXA9
CN105693846A (en) Aptamer NKXA10 specifically for Neutrokine-alpha protein and application of aptamer NKXA10
CN114651010A (en) Methods for diagnosis and treatment of rheumatoid arthritis

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: 710100, public square, 385 Middle Road, Xi'an, Shaanxi

Applicant after: Ma Hailong

Address before: 32, 1, building 0203, R & F 366, 710100 Aerospace Avenue, Shaanxi, Xi'an, Changan District

Applicant before: Ma Hailong

COR Change of bibliographic data
C41 Transfer of patent application or patent right or utility model
CB03 Change of inventor or designer information

Inventor after: Lv Jing

Inventor after: Deng Tao

Inventor after: Zhang Zhiwei

Inventor after: Zhu Xiuhuang

Inventor before: Ma Hailong

COR Change of bibliographic data
TA01 Transfer of patent application right

Effective date of registration: 20160804

Address after: 100176 Beijing branch of Beijing economic and Technological Development Zone Street 88 Hospital No. 9 Building 2 unit

Applicant after: Beijing CapitalBio MedLab Co., Ltd.

Address before: 710100, public square, 385 Middle Road, Xi'an, Shaanxi

Applicant before: Ma Hailong

C14 Grant of patent or utility model
GR01 Patent grant