CN105753967A

CN105753967A - Nucleic acid aptamer NKXA14 specifically aiming at Neutrokine-alpha protein and application thereof

Info

Publication number: CN105753967A
Application number: CN201610294371.4A
Authority: CN
Inventors: 马海龙
Original assignee: Individual
Current assignee: Individual
Priority date: 2014-07-13
Filing date: 2014-07-13
Publication date: 2016-07-13

Abstract

The invention provides a nucleic acid aptamer NKXA14 specifically aiming at Neutrokine-alpha protein. The nucleic acid aptamer NKXA14 has better binding activity with the Neutrokine-alpha protein and can be prepared into a kit, thereby specifically screening and removing the Neutrokine-alpha protein.

Description

One species specificity for Neutrokine-α albumen aptamer NKXA14 and Application

Technical field

The invention belongs to biological technical field, specifically, the present invention relates to for systemic lupus erythematosus many Peptide.

Background technology

Systemic loupus erythematosus (SLE) is presently considered to be autoimmune disease, wherein the abnormal hyperfunction of bone-marrow-derived lymphocyte and A large amount of abnormal generation of immunoglobulin (Ig) γ (IgG) auto-antibody plays key effect.This pathological process causes Ig to be coated with The disappearance of cell and destruction, the fixing and cutting of complement protein and chemotaxin (chemotaxin), vasoactive peptide and Destructive enzyme release in the tissue.

The concurrent atherosclerotic (AS) of systemic loupus erythematosus (SLE) is one of main cause of death of SLE.As far back as 1976 Year, it has been observed that SLE mortality curve in " bimodal " pattern, one is in activity lupus commitment septicemia High rate, another is the high rate of inactivity lupus late stage myocardial infarction.Although various Disease epizootic are arranged Execute the survival rate substantially increasing Patients with SLE, but AS remains the main cause causing SLE death. The case-control of lupus erythematosus (age, race, and sex match) research shows: in the age lupus erythematosus less than 50 years old In patient, 31-37% patient shows the representative mark of AS pathology, and the crowd only having 9-15% in control group shows This represent mark；In the age patient more than or equal to 50 years old, the lupus patient of 70-80% shows Atherosclerosis Change the representative mark of pathology, and in comparison crowd, the people of only 21-45% has this representative mark.

SLE is characterised by manifestations form.In disease process, the patient of 95% has told muscle skeleton disease altogether Disease, 80% shows skin injury, and 85% has hematologic disease, and 60% has neurological disorders, and 60% has heart and lung diseases, and 30%～50% has kidney Dirty disease, 40% has enterogastric diseases, and 15% has thrombus and 15% to have eye disease.Most patient (95%) is also subject to greatly The systemic conditions all existed time most, such as tired, uncomfortable, fever, apocleisis with lose weight.Most of patients experience burst with Alleviate the disease phase alternately.Permanent alleviation (not having symptom when not treating) is the rarest.Before 50 years, majority is diagnosed as Patient's survival of SLE was less than 5 years.Now, within 10 years, survival is more than 90%, and this is mainly based upon early diagnosis, to the ill anti-inflammatory and immunity and presses down System treatment.The common cause of the death is the infection that immunosupress causes.

Result of study shows: include that hypertension, obesity, diabetes, smoking, hypercholesterolemia, postmenopausal state etc. exist Interior conventional risk factors all can not explain the reason that in patients with SLE, coronary heart disease increases the weight of completely, and systemic loupus erythematosus is originally Body (in the case of non-Long-Time Service glucocorticoid) is still that an independent hazard factor.Although disease course and systemic red Yabbi sore damage index is all the independent predictor promoting atherosclerotic (carotid plaques), but how lupus increases dynamic The occurrence risk of pulse atherosclerosis is not yet fully apparent from.

Conventional use Anti-Malarial, anti-inflammatory agent and immunosuppressive drug in SLE treats.When symptom is difficult to control to, right Non-steroidal anti-inflammatory agent supplements with cortin.Additionally, the active SLE that major organs is got involved needs to use the radical of endoxan Sex therapy.

Up to now, the most not can be used for curing SLE and/or in long-term basis, improving the cause of disease of quality of the life of patient Property treatment.But, the development in antibody technique recently and to having identified further of factor causing this autoimmune disease Through opening the possibility using monoclonal antibody as therapeutic choice.Especially, the favorable method for the treatment of SLE will be and cause The specific treatment that a large amount of pathologic immune responses excessively produced of polyclone auto-antibody interact or correct it.By Pathogenesis in SLE relates generally to the B cell of imbalance, and of particular concern is can the monoclonal antibody of targeting B cell.Latent B cell surface antigen target be CD19, CD20, CD21 and CD22.Exempt from additionally, IL-10, IL-1ra, IL-12 are regulations The important cytokine of epidemic disease response, and especially raise during the burst of SLE patient.IL-10 and anti-double-chain DNA (dsDNA) The blood plasma level of auto-antibody often reflects the disease activity of the patient suffering from SLE.The IL-10 level raised is with SLE patient's Disease activity relevant (Park etc., Clin.Exp.Rheumatol.1998 May-June;16(3):283-8).But, IL- 10 is to have polyphenic cell factor to immune system, and known its also participates in reducing proinflammatory response.

SLE patient has carried out using the clinical testing of monoclonal antibody.Especially, to relate to antibody profit appropriate in several tests Former times monoclonal antibody (Rituximab), a kind of gomphosis mouse anti-CD-20 monoclonal antibody for treating non Hodgkin lymphom. Robak and Robak (2009) notices, the result of these tests demonstrates the activity that this antibody is higher in SLE patient, and Have been developed for the antibody (Ofatumumab, IMMU-106 and GA-101) of several new targeting CD20.Other reports monoclonal Antibody in SLE activity clinical testing use anti-CD22 antibody, epratuzumab (Epratuzumab), anti-TNF alpha antibodies, Infliximab (Infliximab), anti-IL-10 antibody, B-N10 (Llorente etc., Arthritis Rheum.2000 August;43 (8): 1790-800), anti-CD40L antibodies, IDEC 131 and BG 9588, BLYS inhibitor, Baily monoclonal antibody (Belimumab), anti-IL6 receptor antibody, the appropriate gram of female monoclonal antibody (Toclimumab) of profit and anti-C5 antibody are according to storehouse pearl monoclonal antibody (Eculizumab) complete.

Neutrokine-α albumen (SEQ ID NO:1) is a member of tnf ligand family, itself and APRIL (28.7%), TNF α (16.2%) and Lymphotoxin-α (LT α) (14.1%) enjoy Amino acid sequence identity (Moore, et al.,(1999)Science 285:260-263).The formal name of Neutrokine-α is the super family of TNF (part) Race member 13B (TNFSF13b).285 amino acid whose polypeptide of total length Neutrokine-α gene code, its 47th to 73 It is cross-film district between amino acids, is II type embrane-associated protein distinctive non-hydrophobic sequence before cross-film district.With TNF family Other members the same, Neutrokine-α plays a role with the form of trimer protein.When Neutrokine-α is at cell table After face is expressed, cell lysis outskirt at the 134th amino acids, in order to discharge the tripolymer of BA.

Known Neutrokine-α with from three kinds of tumor necrosis factor receptor super family not isoacceptor be combined.They are Cross-film activator and CAM interaction body, B cell activating factor receptor, B cell maturation antigen.The expression of acceptor is principally limited to B Lymphocyte.Believe that the major part effect of Neutrokine-α is all mediated by BAFF-R, because at Neutrokine-α table Reach defect or BAFF-R and express the major defect in the B cell component of deficient mice in TACI or BCMA deficient mice not Substantially.

When detecting Neutrokine-α albumen in vitro and in vivo, Neutrokine-α is shown to promote B cell Breed, break up and survive.It addition, Neutrokine-α also shows that some effects to T cell.By genetic engineering chemical conversion excessively The mouse expressing Neutrokine-α has the periphery B cell increasing number and the immunoglobulin concentrations increased.It addition, Neutrokine-α transgenic mice shows autoimmune phenotype, and it is similar with see in people's systemic loupus erythematosus, bag Include generation autoantibody and glomerulonephritis related symptoms.Research later shows at autoimmunity disease such as systemic red yabbi Neutrokine-alpha levels in the serum of sore, rheumatoid arthritis and Patients with Sjogren Syndrome and/or synovial fluid is also by upper Adjust.Therefore, being Neutrokine-alpha-2 antagonists in the view that scientific circles are universal has treatment in terms for the treatment of autoimmunity disease Effect.

Summary of the invention

It is an object of the invention to provide can the aptamer of specific binding Neutrokine-α albumen, thus realize by In human body, Neutrokine-α is combined, separate or function is suppressed, thus reaches systemic lupus erythematosus, rheumatoid Arthritic effect.

The described oligonucleotide sequence that can identify Neutrokine-α albumen, including SEQ ID No.2-15, and uses it In an oligonucleotide sequence just can complete the recognition detection to Neutrokine-α albumen；

The preparation method of described one group of oligonucleotide sequence that can identify Neutrokine-α albumen comprises the following steps:

1, synthesis is for the ssDNA oligonucleotide library (5 '-TCA GTC GCT TCG CCG TCT CCT TC----of screening

N35----GCA CAA GAG GGA GAC CCC AGA GGG-3 '), wherein N35 is 35 random oligonucleotides；

2, SELEX screening is carried out after being mixed with Neutrokine-α albumen respectively by oligonucleotide library, it is thus achieved that aptamer is enriched with Library；

3, after SELEX has screened, the aptamer enriched library obtained is carried out cloning and sequencing；

4, selecting the high copy ssDNA occurred in sequencing result, carry out affine specific checking, screening obtains and can identify The oligonucleotide sequence of Neutrokine-α albumen.

Detailed description of the invention

Embodiment:

1, the preparation of Neutrokine-α albumen

The mode using yeast well known to those skilled in the art recombinant expressed obtain have identical with Neutrokine-α albumen Bioactive Neutrokine-α albumen, this protein sequence is as shown in SEQ ID NO:1；The concentration of protein solution is 10mg/ ml。

2, library and the synthesis of primer

2.1, synthesis for screening ssDNA oligonucleotide library (5 '-AATTCACTTACTTAACCAATCCGG---- N35----ACACAAGAGTGAGAATTAGAGCG-3 '), wherein N35 is 35 random oligonucleotides；

Primer P1:AATTCACTTACTTAACCAATCCGG;

Primer P2:CGCTCTAATTCTCACTCTTGTGT.

2.2, the SELEX screening of aptamer, concrete grammar is as follows:

2.2.1 ssDNA with Neutrokine-α albumen combination, separate, concrete grammar is as follows:

Take the ssDNA oligonucleotide library 4 μ L of 100 μMs, with 2 × combine buffer solution and be diluted to 100 μ l, 95 DEG C of sex change 5min, ice Adding 100 μ l Neutrokine-α albumen after bath 10min, shaking table combines 50min, then 6000rpm is centrifuged 7min, abandons supernatant, so Afterwards with 1 × combine buffer solution and wash precipitation, abandon supernatant；In precipitation, add 1 × combine buffer solution 100 μ L, 96 DEG C of heating 5min, Then 15000rpm is centrifuged 10min, takes supernatant, to precipitation again heat and be centrifuged, merge supernatant, the most separable obtain with Neutrokine-α albumen has ssDNA level library of affinity；Described 2 × combine buffer solution be 20 × combine buffer solution with double Steam water and dilute the solution after 10 times, described 1 × combine buffer solution be 20 × combine after buffer solution distilled water dilutes 20 times molten Liquid；Described 20 × combine buffer formulation be 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl2, pH 7.4.

2.2.2 ssDNA with Neutrokine-α albumen combination, separate, concrete grammar is as follows:

By step 2.2.1 isolated can ssDNA protein bound with Neutrokine-α, then with 100 μ l Neutrokine-α albumen shaking table combines 30min, subsequent step with step 2.2.1, separable to and Neutrokine-α albumen There is ssDNA level library of affinity.

2.2.3 asymmetric PCR amplification ssDNA, concrete grammar is as follows:

Step 2.2.2 being separated ssDNA the level library obtained and carries out asymmetric PCR amplification, cumulative volume is the asymmetric of 25 μ l PCR amplification system is: 10 × PCR buffer solution: 2 μ l；P1 (10 μMs): 1 μ l；P2 (0.2 μM): 1 μ l；DNTP (each 2.5mM): 0.4 μ l；MgCl₂(25mM): 1.2 μ l；SsDNA template (0.2 μ g/ μ l): 2 μ l；Taq archaeal dna polymerase (5u/ μ l): 0.2 μ l；DdH2O: 17.2μl；PCR response parameter: 94 DEG C of denaturations 4min, then carries out 94 DEG C of sex change 30s of 40 circulations, 58 DEG C of annealing 30s, 72 DEG C extend 20s, last 72 DEG C extend 7min；

2.2.4 the mensuration of affinity, concrete grammar is as follows:

2.2.4.1 amplification: expand ssDNA the level literary composition screened with the primer P1 asymmetric PCR with digoxigenin labeled Storehouse, amplification condition and parameter are identical with the asymmetric PCR amplification system of step 2.2.3 and parameter；

2.2.4.2 with protein combination: take the PCR primer 100 μ L of step 2.2.4.1 amplification gained, 95 DEG C of sex change 5min, ice bath Adding after 10min in 100 μ L albumen, be sufficiently mixed, at room temperature combine 30min, then 6000rpm is centrifuged, separate albumen with Supernatant, includes in albumen and the ssDNA of the band digoxigenin labeled of combination in albumen, is unconjugated ssDNA in supernatant, Do a blank being not added with ssDNA simultaneously, i.e. with 2 × combine buffer solution and replace PCR primer, carry out aforesaid operations equally；

2.2.4.3 washing: by albumen with 1 × combine buffer solution 500 μ L and wash 1 time, 6000rpm is centrifugal, abandons supernatant, takes albumen；

2.2.4.4 be combined with enzyme mark rabbit anti digoxin antibody: in albumen, add the enzyme of the excess of 100 μ L 1: 900TBS dilutions Mark rabbit anti digoxin antibody, after being sufficiently mixed, reaction 10min, the ssDNA of the digoxigenin labeled being allowed in albumen are combined；

Described TBS is 0.5M Tris-NaCl solution, and compound method is: first water-soluble 8.5～9g NaCl, then adds Tris-HCl (0.5M, pH7.6) solution 100ml, finally adds water and is settled to 1L；0.5M Tris-HCl (pH7.6,100ml) solution preparation side Method: weigh Tris 6.06g, adds distilled water 40ml and dissolves, and drips dense HCl and adjusts pH to 7.6, is settled to 100ml.

2.2.4.5 washing: 6000rpm is centrifuged, and removes supernatant, then with 1 × combine buffer solution 500 μ L washing 3 times, obtain albumen；

2.2.4.6 TMB (tetramethyl benzidine) colour developing: add the 400 μ resuspended albumen of L distilled water, adds 200 μ L TMB colour developings Liquid, after lucifuge colour developing 10min, terminates reaction with 2mol/L H2SO4 200 μ L, measures the light absorption value OD450 at 450nm, this value The affinity of ssDNA that i.e. reflection is combined with bacterium, i.e. OD combination, blank carries out above-mentioned steps 2.2.4.3 equally, 2.2.4.4, 2.2.4.5 and 2.2.4.6, blank corresponding absorbance OD is obtained blank；

Described TMB nitrite ion uses conventional compound method preparation.

2.2.4.7 the molar concentration of DNA in PCR primer is measured: take the PCR primer of step 2.2.4.1 amplification gained, with The initial ssDNA library of concentration known gradient is standard items, with Bandscan software as image analysis software, uses bromination second DNA content in ingot agarose gel electrophoresis method quantitative determination PCR primer, it is thus achieved that the molar concentration of corresponding DNA, and then can count Calculate the DNA molal quantity in 100 μ L PCR primer.

2.2.4.8 the affinity in corresponding library is calculated:

2.3 repeat screening, method particularly includes: using each product screening library as next round taking turns asymmetric PCR, repeat Above-mentioned SELEX screens step 2.2, until affinity no longer rises, eventually passes 14 screenings taken turns and obtains the adaptation of ssDNA Sub-enriched library.After asymmetric PCR expands, condition, with step the most above, is cloned and checks order, obtain that copy number is the highest 18 18 aptamers are carried out affine specificity verification by individual effective ssDNA respectively, wherein have 4 specific the most unique, therefore give up Abandon.Therefore obtain 14 and Neutrokine-α albumen is had preferable affine specific oligonucleotide sequence (aptamer), specifically Sequence is as follows:

Aptamer title	Adaptor sequence
		NKXA1	5′-AATTCACTTACTTAACCAATCCGG ATATTTCCAACACTCCAACTTTCCCTACAATTCTAACACAAGAGTGAGAATTAGAGCG-3′
NKXA3	5′-AATTCACTTACTTAACCAATCCGG TCACATTACAAATACATTCATCCCCAACACACCAAACACAAGAGTGAGAATTAGAGCG-3′
		NKXA4	5′-AATTCACTTACTTAACCAATCCGG TTCTCTTACCCAAATTCTTCCAACCTTACCTTCCAACACAAGAGTGAGAATTAGAGCG-3′
NKXA5	5′-AATTCACTTACTTAACCAATCCGG TCTATAAAATATTTCAATCTCTCTCTATATCATTCACACAAGAGTGAGAATTAGAGCG-3′
		NKXA6	5′-AATTCACTTACTTAACCAATCCGG CCTCTACTAATCAAACTCTTACCCACCCTCTATCTACACAAGAGTGAGAATTAGAGCG-3′
NKXA7	5′-AATTCACTTACTTAACCAATCCGG TCACATATATCTCAACTCTATCCACTCTCTCAACTACACAAGAGTGAGAATTAGAGCG-3′
		NKXA9	5′-AATTCACTTACTTAACCAATCCGG CAACTCAATATCTTCCCTTAACTTATCCCTACACCACACAAGAGTGAGAATTAGAGCG-3′
NKXA10	5′-AATTCACTTACTTAACCAATCCGG ATCTACACCCCCACCATCTACCAACCACCACCCAAACACAAGAGTGAGAATTAGAGCG-3′
		NKXA11	5′-AATTCACTTACTTAACCAATCCGG CACTCATACATATCAACACCTCACTCCTTATTCCCACACAAGAGTGAGAATTAGAGCG-3′
NKXA13	5′-AATTCACTTACTTAACCAATCCGG CATTATATCAATTACACATCTCCATTTAATCAACAACACAAGAGTGAGAATTAGAGCG-3′
		NKXA14	5′-AATTCACTTACTTAACCAATCCGG TTACTTCTTCATTCATAATACCATCCTAATAACTTACACAAGAGTGAGAATTAGAGCG-3′
NKXA15	5′-AATTCACTTACTTAACCAATCCGG ACCTACACAATCTATCACTTATAACTTCAAACTTTACACAAGAGTGAGAATTAGAGCG-3′
		NKXA17	5′-AATTCACTTACTTAACCAATCCGG AATTTTAATACAAATCTCTAAATAAACCACCCCAAACACAAGAGTGAGAATTAGAGCG-3′
NKXA18	5′-AATTCACTTACTTAACCAATCCGG AATATACTAATACCCATAAACTTAAATCTCAACTCACACAAGAGTGAGAATTAGAGCG-3′

The concrete data of affinity are as follows:

Aptamer title	Affinity	Aptamer title	Affinity
				NKXA1	0.49	NKXA10	0.49
NKXA3	0.51	NKXA11	0.48
				NKXA4	0.46	NKXA13	0.57
NKXA5	0.49	NKXA14	0.54
				NKXA6	0.52	NKXA15	0.48
NKXA7	0.54	NKXA17	0.42
				NKXA9	0.51	NKXA18	0.47

2.4, the specific of 20 aptamers and compatibility are analyzed

Fluorescently-labeled adaptor sequence is hatched with Neutrokine-α albumen, carries out flow cytometry detection, wherein 14 Sequence shows high fluorescent, uses GraphPad Prism5.0 software to do nonlinear regression curve for saturation curve, point The other experimental implementation identical to 14 high-affinity adaptor sequence employings, having obtained every is the Kd value configured:

Aptamer title	Kd value (nM)	Aptamer title	Kd value (nM)
				NKXA1	20.5	NKXA10	19.5
NKXA3	21.2	NKXA11	21.2
				NKXA4	24.7	NKXA13	22.5
NKXA5	25.6	NKXA14	27.2
				NKXA6	26.5	NKXA15	25.1
NKXA7	23.1	NKXA17	26.4
				NKXA9	28.6	NKXA18	30.1

Wherein the Kd value of NKXA10 is minimum, illustrates can be quickly combined with target protein and Stability Analysis of Structures is not readily separated.

Use the secondary structure of 14 aptamers of DNAMAN software building and calculate their minimum free energy, its knot Structure minimum free energy is the least, and structure is the most stable.

2.5 aptamers are specifically analyzed

It is respectively adopted BSA, APRIL albumen, Neutrokine-α albumen and 14 aptamers and carries out specific detection, through combining Test finds, these 14 sequences do not combine with BSA, APRIL albumen, and only keeps relatively with Neutrokine-α protein combination High is specific.

3, the application of aptamer

By the 14 of the present invention aptamers, its 5 ' end adds the mark with magnetic mark magnetic bead, can be prepared as into kit, Pharmaceutical composition, by with contacting blood, by magnetic screening can realize for the spy of Neutrokine-α albumen in blood Different separation, thus reach the effect of systemic lupus erythematosus, rheumatoid arthritis.

Sequence table

＜ 110 ＞ horse sea otter

＜ 120 ＞ mono-species specificity is for the aptamer NKXA14 of Neutrokine-α albumen and application thereof

〈160〉16

〈210〉1

〈211〉285

〈212〉PRT

＜ 213 ＞ people

〈400〉1

1 MDDSTEREQS RLTSCLKKRE EMKLKECVSI LPRKESPSVR SSKDGKLLAATLLLALLSCC

61 LTVVSFYQVA ALQGDLASLR AELQGHHAEK LPAGAGAPKA GLEEAPAVTAGLKIFEPPAP

121 GEGNSSQNSR NKRAVQGPEE TVTQDCLQLI ADSETPTIQK GSYTFVPWLLSFKRGSALEE

181 KENKILVKET GYFFIYGQVL YTDKTYAMGH LIQRKKVHVF GDELSLVTLFRCIQNMPETL

241 PNNSCYSAGI AKLEEGDELQ LAIPRENAQI SLDGDVTFFG ALKLL

〈210〉2

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA1

5′- AATTCACTTACTTAACCAATCCGG ATATTTCCAACACTCCAACTTTCCCTACA

ATTCTAACACAAGAGTGAGAATTAGAGCG-3′

〈210〉3

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA3

5′- AATTCACTTACTTAACCAATCCGG TCACATTACAAATACATTCATCCCCAACACA

CCAAACACAAGAGTGAGAATTAGAGCG-3′

〈210〉4

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA4

5′- AATTCACTTACTTAACCAATCCGG TTCTCTTACCCAAATTCTTCCAACCTTACC

TTCCAACACAAGAGTGAGAATTAGAGCG-3′

〈210〉5

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA5

5′- AATTCACTTACTTAACCAATCCGG TCTATAAAATATTTCAATCTCTCTCTATATCAT

TCACACAAGAGTGAGAATTAGAGCG-3′

〈210〉6

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA6

5′- AATTCACTTACTTAACCAATCCGG CCTCTACTAATCAAACTCTTACCCACCCTCT

ATCTACACAAGAGTGAGAATTAGAGCG-3′

〈210〉7

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA7

5′- AATTCACTTACTTAACCAATCCGG TCACATATATCTCAACTCTATCCACTCTCT

CAACTACACAAGAGTGAGAATTAGAGCG-3′

〈210〉8

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA9

5′- AATTCACTTACTTAACCAATCCGG CAACTCAATATCTTCCCTTAACTTATCCC

TACACCACACAAGAGTGAGAATTAGAGCG-3′

〈210〉9

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA10

5′- AATTCACTTACTTAACCAATCCGG ATCTACACCCCCACCATCTACCAACCACC

ACCCAAACACAAGAGTGAGAATTAGAGCG-3′

〈210〉10

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA11

5′- AATTCACTTACTTAACCAATCCGG CACTCATACATATCAACACCTCACTCCTT

ATTCCCACACAAGAGTGAGAATTAGAGCG-3′

〈210〉11

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA13

5′- AATTCACTTACTTAACCAATCCGG CATTATATCAATTACACATCTCCATTTAA

TCAACAACACAAGAGTGAGAATTAGAGCG-3′

〈210〉12

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA14

5′- AATTCACTTACTTAACCAATCCGG TTACTTCTTCATTCATAATACCATCCTAATA

ACTTACACAAGAGTGAGAATTAGAGCG-3′

〈210〉13

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA15

5′- AATTCACTTACTTAACCAATCCGG ACCTACACAATCTATCACTTATAACTTCAAA

CTTTACACAAGAGTGAGAATTAGAGCG-3′

〈210〉14

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA17

5′- AATTCACTTACTTAACCAATCCGG AATTTTAATACAAATCTCTAAATAAACCAC

CCCAAACACAAGAGTGAGAATTAGAGCG-3′

〈210〉15

<211〉 82

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉NKXA18

5′- AATTCACTTACTTAACCAATCCGG AATATACTAATACCCATAAACTTAAATCTC

AACTCACACAAGAGTGAGAATTAGAGCG-3′

〈210〉16

<211〉23

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉P1

AATTCACTTACTTAACCAATCCGG

〈210〉17

<211〉 24

〈212〉DNA

＜ 213 ＞ artificial sequence

〈400〉P2

CGCTCTAATTCTCACTCTTGTGT

Claims

1., for a Neutrokine-α albumen for aptamer screening, its sequence is shown in SEQ ID NO:1.

2. the oligonucleotide sequence identifying Neutrokine-α albumen, it is characterised in that shown in SEQ ID No.12.

3. the oligonucleotide sequence shown in claim 2 is for screening the application of Neutrokine-α albumen.

4. pharmaceutical composition, reagent or the kit that the oligonucleotide sequence shown in claim 2 prepares.

5. the oligonucleotide sequence shown in claim 4 is used for treating the pharmaceutical composition of lupus erythematosus, reagent or examination in preparation Application in agent box.