CN104059148B - humanized anti-human epidermal growth factor receptor antibody and application thereof - Google Patents
humanized anti-human epidermal growth factor receptor antibody and application thereof Download PDFInfo
- Publication number
- CN104059148B CN104059148B CN201410083224.3A CN201410083224A CN104059148B CN 104059148 B CN104059148 B CN 104059148B CN 201410083224 A CN201410083224 A CN 201410083224A CN 104059148 B CN104059148 B CN 104059148B
- Authority
- CN
- China
- Prior art keywords
- antibody
- egfr
- variable region
- light chain
- heavy chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Abstract
The invention provides a kind of Humanized anti-human EGF-R ELISA (EGFR) antibody and application thereof.By to a strain EGFR mouse monoclonal antibody LA22 humanization, making people source aminoacid sequence in antibody reach more than 90%, filter out the monoclonal antibody of anti-human EGFR.The affinity that the antibody of the present invention is combined with Human epidermal growth factor receptor is 2.3nM, suitable with Mus source antibody, after it is attached to the EGFR of tumor cell surface, it is possible to the promptly EGFR endocytosis on inducing tumor cell surface, becomes ideal Biological target therapy antibody.The present invention is the antitumor for EGFR target and the prevention of other diseases such as inflammation and autoimmune disease and treatment provides specific antibody medicine.This antibody medicine can be significantly reduced in patient body, produce the risk of people anti-Mus source antibody (HAMA) in the future, extend the half-life of antibody medicine, improve curative effect.
Description
Technical field
The present invention relates to preparation and the application for the treatment of human genetically engineered antibody, be directed primarily to special
Property anti-for human epidermal growth factor acceptor (epidemic growth factor receptor, EGFR)
Body and application thereof.
Background technology
EGF-R ELISA (EGFR) is a member of epidermal growth factor gene (erbB) family,
At kinds of tumors such as breast carcinoma, colon cancer, H/N tumors, renal carcinoma, pulmonary carcinoma, cancer of pancreas, prostate
The development of cancer is respectively provided with material impact.Many studies have shown that both at home and abroad, the antibody for EGFR can
Effectively it is implemented in combination in the suppression to EGFR signal transduction pathway by block part born of the same parents are outer,
To multiple by EGFR overexpression or/and the human tumor caused by Tu Bian has preferable curative effect.Epidermis
Growth factor receptors is one of cancer target of studying relatively deeply at present and receiving much attention, application
Genetic engineering means develops the monoclonal antibody of anti-EGFR, is the study hotspot of current oncotherapy.
EGFR molecule is the membrane antigen being distributed widely in human tumor cells surface, transmits at intracellular messengers
During play an important role.Using human antibody or humanized antibody is to overcome people anti-Mus source antibody
Reaction (two kinds of possible methods of (HAMA reaction).The people source high due to high specificity, affinity resists
Body is difficult to obtain, and currently mainly takes the humanized method of Mus resource monoclonal antibody.The U.S. in 2005
EGFR monoclonal antibody Erbitux that ImClone produces lists in the U.S., is reinstating with chemotherapy one
Time can extend the life of Patients With Rectal Carcinoma.By the treatment nasopharyngeal carcinoma of the safe cooperation of Cuba and China hundred
Tai Xinsheng monoclonal antibody was also for the same target spot of EGFR, in listing in 2009.
The Erbitux monoclonal antibody medicine listed at present is exactly humanized mouse-anti EGFR monoclonal antibody, but this
The monoclonal antibody LA22 of invention is directed to the entirely different site of EGFR, and tumor suppression mechanism is different from Erbitux,
Use with Erbitux simultaneously and can improve curative effect.More importantly it is attached to tumor cell surface
After EGFR, it is possible to the promptly EGFR endocytosis on inducing tumor cell surface, become ideal life
Thing targeted therapy antibody.
Summary of the invention
First purpose of the present invention is to provide a kind of Humanized anti-EGFR antibodies.
Second object of the present invention is to provide the gene of encoding such antibodies.
Third object of the present invention is to provide above-mentioned antibody in preparation treatment high expressed/overexpression
Application in the malignant tumor of EGFR and autoimmune disease medicine.
The Humanized anti-human EGFR monoclonal antibody that the present invention provides, its constant region of light chain, heavy chain are permanent
Determine the district constant region of light chain of behaviour whole antibody Immunoglobulin IgG1, CH respectively；Its light chain
Variable region, variable region of heavy chain are respectively the light chain variable of humanization modified EGFR Mus source monoclonal antibody LA22
District and variable region of heavy chain, the chain variable region amino acid sequence of described EGFR Mus source monoclonal antibody LA22 is such as
Shown in SEQ ID NO.2, heavy chain variable amino acid sequence is as shown in SEQ ID NO.1, described
The humanization modified FR district in variable region is carried out.
In one embodiment of the invention, by EGFR Mus source monoclonal antibody LA22 CH and light chain
Constant region is respectively with CH and the constant region of light chain replacement of human IgG1, by by EGFR Mus source
Monoclonal antibody LA22 heavy chain, framework region FR humanization modified of variable region of light chain, it is thus achieved that have good raw
Thing activity and the Humanized anti-human EGFR monoclonal antibody of antigen affinity.
The Humanized anti-human EGFR monoclonal antibody that the present invention provides, its humanization modified light chain can
Becoming district and contain any one aminoacid sequence as shown in SEQ ID NO.12～14, variable region of heavy chain is contained
Any one aminoacid sequence as shown in SEQ ID NO.7～11.
Further, the ammonia as shown in SEQ ID NO.14 is contained in its humanization modified variable region of light chain
Base acid sequence, any one of the aminoacid sequence shown in SEQ ID NO.7～11 is contained in variable region of heavy chain.
Further, its humanization modified variable region of light chain is contained as shown in SEQ ID NO.12～14
Aminoacid sequence any one, the aminoacid sequence as shown in SEQ IDNO.10 is contained in variable region of heavy chain.
Further, its humanization modified variable region of light chain is contained as shown in SEQ ID NO.14
Aminoacid sequence (i.e. light chain h2), the aminoacid as shown in SEQ ID NO.10 is contained in variable region of heavy chain
Sequence (i.e. heavy chain H3).
The invention provides the gene of encoding such antibodies.In the gene of encoding such antibodies, encoded light
Its nucleotides sequence of the gene of chain variable region be classified as SEQ ID NO.20～22 arbitrary shown in DNA sequence
Row；Its nucleotides sequence of the gene of encoding heavy chain variable region be classified as SEQ ID NO.15～19 arbitrary shown in
DNA sequence.
Preferably, its nucleotides sequence of the gene of encoded light chain variable region is classified as shown in SEQ ID NO.22
DNA sequence；Its nucleotides sequence of the gene of encoding heavy chain variable region is classified as such as SEQ ID NO.18 institute
The DNA sequence shown.
The invention provides the expression vector containing said gene.
Host Strains, host cell or expression cassette containing described expression vector are in scope.
The invention provides above-mentioned human monocloned antibody against EGFR in preparation with EGFR as target
Disease therapeuticing medicine in application.
Described medicine is antineoplastic agent, anti-inflammatory drug or the medicine for the treatment of autoimmune disease.
The invention provides the medicine containing above-mentioned human monocloned antibody against EGFR or detectable.
Present invention provide for cloning Mus source monoclonal antibody LA22 heavy chain, the primer of variable region of light chain, respectively
For VH1FOR:TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG
VH1BACK:AGGTSMARCTGCAGSAGTCWGG
VK1FOR:GTTAGATCTCCAGCTTGGTCCC
VK1BACK:GACATTCAGCTGACCCAGTCTCCA
The invention provides the method preparing above-mentioned human monocloned antibody against EGFR, including:
(1) total serum IgE of hybridoma Mus LA22 tumor cell, VH1FOR and VK1FOR are extracted
Respectively total serum IgE reverse transcription is become the cDNA of variable region of heavy chain and variable region of light chain for primer；Then with
The cDNA of variable region of heavy chain and variable region of light chain is template, enters with VH1FOR+VH1BACK respectively
Performing PCR amplification synthesis monoclonal antibody LA22 antibody heavy chain variable region, Mus source, uses VK1FOR+VK1BACK
Carry out PCR amplification synthesis monoclonal antibody LA22 antibody chain variable region, Mus source；Reclaim purpose fragment, clone,
Transformed competence colibacillus cell, screening positive clone；
(2) check order correct positive colony variable region of light chain design restriction enzyme site be Kpn I+Xho I,
Variable region of heavy chain restriction enzyme site KpnI+AgeI, respectively with expression vector pJH16-H39E3.L1kappa
Connect with pJH16, convert, obtain heavy chain, light chain chimeric antibody expression vector；
(3) variable region of light chain and the variable region of heavy chain of Mus source LA22 are carried out humanization design, it is thus achieved that
5 humanized heavy chain variable amino acid sequences, aminoacid sequence is respectively such as SEQ ID NO.7～11
Shown in, its nucleotide sequence is as shown in SEQ ID NO.15～19；With 3 humanized light chain variables
Region amino acid sequence, aminoacid sequence respectively as shown in SEQ ID NO.12～14, its nucleotide sequence
As shown in SEQ ID NO.20～22；
(4) humanization variable region of light chain coded sequence being designed restriction enzyme site is Kpn I+Xho I, weight
Chain variable region coded sequence design restriction enzyme site is KpnI+AgeI, respectively with expression vector pUC57 even
Connect, with Kpn I+Age I variable region of heavy chain coded sequence cut from pUC57 carrier and be inserted into table
Reach the corresponding site of carrier pJH16；Use Kpn I+Xho I by variable region of light chain from pUC57 carrier again
On cut and be inserted in expression vector pJH16-H39E3.L1kappa corresponding site, obtain humanization weight
Group monoclonal antibody heavy and light chain expression vector；
(5) heavy chain, the light chain chimeric antibody expression vector that step (2) are obtained obtain with step (4)
The humanization recombinant monoclonal antibodies heavy chain and the light chain expression vector permutation and combination cotransfection competence that arrive are thin
Born of the same parents, obtain one group of inosculating antibody EGFR monoclonal antibody and 30 groups of human monocloned antibody against EGFR.
The Humanized anti-EGFR antibodies that the present invention provides is directed to the entirely different site of EGFR, presses down
Tumor mechanism is different from Erbitux, and the monoclonal antibody of the present invention and Erbitux use simultaneously and can improve curative effect.
After more importantly it is attached to the EGFR of tumor cell surface, it is possible to promptly inducing tumor cell
The EGFR endocytosis on surface, becomes ideal Biological target therapy antibody.The present invention is by antagonism
EGFR monoclonal antibody carries out humanization modified, makes people source aminoacid sequence in antibody medicine reach more than 90%,
This antibody medicine will be significantly reduced in patient body, produce the risk of people anti-Mus source antibody response (HAMA),
The affinity that the EGFR antibody of the embodiment of the present invention display present invention is combined with Human epidermal growth factor receptor is 2.3nM,
Suitable with Mus source antibody, and overcome HAMA effect, extend the half-life of antibody medicine, improve curative effect.
Accompanying drawing explanation
Fig. 1 is the schematic diagram of the regular-PCR of synthesis chimeric antibody VH and VL coded sequence.
Fig. 2 is the figure that the expression vector pJH16-H39E3.L1kappa used in the present invention expresses light chain
Spectrum.Wherein, Ck represents the constant region coded sequence of people's antibody kappa light chain.
Fig. 3 is the expression vector pJH16 carrier used in the present invention, is used for expressing humanization LA22 weight
Chain, wherein, Exon by j00228 partial sequence represents the CH coded sequence of people's IgG antibody 1.
Fig. 4 is chimeric antibody synthetic gene and the electrophoretogram of carrier enzyme action；In Fig. 4 a 1,2:
The KpnI-XhoI enzyme action of pUC57-LA22 light chain, the stripe size cut at about 450bp, on
Layer band is carrier segments；The KpnI-AgeI enzyme action of 3,4:pUC57-LA22 heavy chains, the bar cut
Band size is at about 550bp, and upper strata band is carrier segments；In Fig. 4 b, 9,10: for
PJH16-H39E3L1, KpnI-XhoI enzyme action, the band cut is at about 450bp；11:pJH16 matter
Grain, KpnI-AgeI enzyme action, the stripe size cut be about 550bp, MARKER be Trans2K
Plus II DNA Marker。
Fig. 5 is light chain humanized synthetic gene enzyme action；The wherein Kpn of 1,2:pUC57-h0-LA22 light chain
I-Xho I enzyme action；The Kpn I-Xho I enzyme action of 3:pUC57-h1-LA22 light chain；4:
The Kpn I-Xho I enzyme action of pUC57-h2-LA22 light chain；M:Trans2K Plus II DNA Marker
Fig. 6 is the electrophoretogram of carrier enzyme action.1: for pJH16-H39E3L1, KpnI-XhoI enzyme action,
The band cut is at about 8.5kbp；2:pJH16 plasmid, KpnI-AgeI enzyme action, the band cut
Size is about 7kbp.
Fig. 7 is heavy chain humanization gene enzyme action；The Kpn I+Age I enzyme action of 1:pJH16 carrier；Cut
Under stripe size be about 7kbp；The Kpn I+Age I enzyme action of 2:pUC57-h0-LA22 heavy chain；
The Kpn I+Age I enzyme action of 3:pUC57-h1-LA22 heavy chain；4:pUC57-h2-LA22 heavy chain
Kpn I+Age I enzyme action；The Kpn I+Age I enzyme action of 5:pUC57-h3-LA22 heavy chain；6:
The Kpn I+Age I enzyme action of pUC57-h4-LA22 heavy chain.
Fig. 8 is sequencing result, BLAST comparison 100%, and checking is illustrated after obtaining building plasmid success
Represent.Wherein H2-1CMV represents humanised antibody heavy chain's variable region gene sequencing sequence of order-checking；
H2-LA22 heavy chain designs the h2-LA22 antibody heavy chain variable region gene order of synthesis for the present invention.
Fig. 9 is humanization mutational site, three variable region of light chains, and wherein gray portion is mutational site.
Figure 10 is humanization mutational site, five variable region of heavy chaines, and wherein gray portion is mutational site.
Figure 11 is that cell conditioned medium purification obtains Humanized monoclonal antibodies SDS-PAGE, wherein
M is albumen ruler II10ul, and 1 is BSA, is 5 μ g, and 2 is the non-reduced 20ul of antibody purification 2ug,
3 is antibody purification 2ug reductase 12 0ul.
Figure 12 is flowcytometric results, and NC is negative control A431 cell, mLA22 table
Show that the EGFR, hLA22 of the LA22 antibody recognition A431 cell surface in Mus source represent humanized
The EGFR of LA22 antibody recognition A431 cell surface.
Figure 13 is the cell ELISA experiment detection LA22 combination to the EGFR of A431 cell surface.
MLA22 is the LA22 in Mus source, and hLA22 is humanized LA22.
Figure 14 is the cell ELISA competitive assay of the LA22 and humanized LA22 in Mus source.Mus source
The ratio of LA22 and humanization LA22 is 1:0 respectively, 2:1,1:1,1:2,0:1.
Figure 15 is that mLA22 and hLA22 of different antibodies concentration is to Cytostatic to tumor cell result.
Detailed description of the invention
Hereinafter implement embodiment and further illustrate present disclosure, but should not be construed as the present invention's
Limit.Without departing from the spirit and substance of the case in the present invention, to the inventive method, step or condition
The amendment made or replacement, belong to the scope of the present invention.
If not specializing, technological means used in embodiment is well known to those skilled in the art
Conventional means.Material used in following embodiment, reagent etc., if no special instructions, all can be from business
Industry approach obtains.
The heavy chain of embodiment 1 anti-EGFR Mus source monoclonal antibody mLA22, the clone of variable region of light chain
The method using 5'RACE (Rapid amplification of cDNA ends) obtains anti-EGFR
The variable region encoding sequences of Mus source monoclonal antibody m LA22.Design and synthesize following primer:
VH1FOR:TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG
VH1BACK:AGGTSMARCTGCAGSAGTCWGG
VK1FOR:GTTAGATCTCCAGCTTGGTCCC
V K1BACK:GACATTCAGCTGACCCAGTCTCCA
Wherein, VH1FOR and VK1FOR is used for synthesizing cDNA, then uses
VH1FOR+VH1BACK is PCR and expands synthetic antibody heavy chain, uses VK1FOR+VK1BACK
It is PCR and expands synthetic antibody light chain, then check order.
1 × 10 is extracted respectively with the Qiagen RNeasy test kit of Qiagen company7Hybridoma Mus
The total serum IgE of LA22 tumor cell (being provided by United States Patent (USP) owner Denry doctor Sato).Press
According to 5'-RACE test kit (Transgen Products) description with VH1FOR and VK1FOR for drawing
Total serum IgE reverse transcription is become the cDNA, cDNA of heavy chain and light chain to synthesize Article 1 chain reaction by thing respectively
Condition is: 42 DEG C, 30min；85℃,5min.Then it is PCR with VH1FOR+VH1BACK
Amplification synthetic antibody variable region of heavy chain, is PCR with VK1FOR+VK1BACK and expands synthetic antibody
Variable region of light chain, two secondary responses all use thermal starting, PCR reaction condition: 94 DEG C 5 minutes;94 DEG C 30 seconds,
58 DEG C 45 seconds, 72 DEG C 2 points 10 seconds, 37 circulation: 72 DEG C 7 minutes.PCR primer is coagulated through 1% agarose
Gel electrophoresis reclaims purification purpose fragment (light chain length about 320bp, heavy chain length about 360bp) after separating.
It is cloned in pEASY-T1 (Transgen) carrier, converts bacillus coli DH 5ɑAfter cell
The enterprising row filter of IPTGIX-gal flat board, takes 8 white bacterial plaques and is inoculated in the LB containing ammonia joint penicillin
Fluid medium expands. screening positive clone, extract plasmid with the plasmid extraction test kit of QIAGEN
And check order, it is determined that the heavy chain of Mus LA22 and the DNA sequence of variable region of light chain.
The DNA sequence such as SEQ ID NO.3 of the LA22 variable region of heavy chain, Mus source (VH) that order-checking obtains
Shown in, the DNA sequence of variable region of light chain (VL) is as shown in SEQ ID NO.4, and infers accordingly
Obtain Mus source LA22 heavy chain variable amino acid sequence as shown in SEQ ID NO.1, variable region of light chain
Aminoacid sequence as shown in SEQ ID NO.2.
The structure of embodiment 2 chimeric mAb expression vector
Check order according to embodiment 1 obtain Mus LA22 heavy chain, variable region of light chain base sequence, design is light
Chain restriction enzyme site is Kpn I+Xho I, Song Jinwei intelligence company synthesis complete genome sequence, connects during synthesis
Carrier be pUC57.The raw medical sci-tech (Beijing) so that pJH16-H39E3.L1kappa[is purchased from back
Company limited, is expression vector containing human IgG1；Design heavy chain restriction enzyme site is Kpn I+Age I, with
PJH16[is purchased from back and raw medical sci-tech (Beijing) company limited, containing human IgG1] it is expression vector,
By they respectively with Jin Weizhi company synthesis Mus LA22 heavy chain, variable region of light chain encoding gene enzyme action
After, 16 DEG C overnight connect.The enzyme action result of pUC57-LA22 light chain and heavy chain is shown in Fig. 4 a, Fig. 4 b.
The genes of interest obtained after enzyme action and expression vector (pJH16-H39E3.L1kappa and pJH16) are cut
Glue Qiagen Gel Extraction Kit reclaims, and connects overnight by T4DNA linked system, then turns
Change bacillus coli DH 5 alpha, sequence verification BLAST comparison 100%, chimeric antibody expression vector is described
Successfully construct.Obtain chimeric antibody heavy sequence as shown in SEQ ID NO.5, chimeric antibody light
Sequence is as shown in SEQ ID NO.6.
The design of embodiment 3 humanization recombinant monoclonal antibodies VL and VH
VL and VH of monoclonal antibody against EGFR m LA22 humanization design, people source have been carried out
Change transformation and should defer to following methods, the CDR of Mus source monoclonal antibody is migrated to human antibody variable region, substitute
Human antibody CDR, makes human antibody obtain the antigen-binding specificity of Mus source monoclonal antibody, reduces it simultaneously
Heterologous.The principle of the method is only to replace and the obvious region of people's antibody FR difference, is maintaining antibody
Activity is also taken into account to reduce and is selected the aminoacid replacement similar to people's antibody surface residues on the basis of heterologous；
It addition, the section replaced should not be too much, for affecting side chain size, electric charge, hydrophobicity, or can
Hydrogen bond can be formed thus have influence on complementary antibody and determine that the residue of district (CDR) conformation is not replaced as far as possible.
Through humanization modified, the present invention provides the weight chain variable of 5 humanization modified antibody LA22
District be respectively as follows: H0-LA22 heavy chain, H1-LA22 heavy chain, H2-LA22 heavy chain, H3-LA22 heavy chain,
H4-LA22 heavy chain, its aminoacid sequence and signal peptide sequence respectively as shown in SEQ ID NO.7～11,
Its nucleotide sequence is respectively as shown in SEQ ID NO.15～19；3 humanization modified light chains are provided
Variable region is respectively as follows: h0-LA22 light chain, h1-LA22 light chain, h2-LA22 light chain, its aminoacid sequence
Row and signal peptide sequence are respectively as shown in SEQ ID NO.12～14, and its nucleotide sequence is respectively such as SEQ
Shown in ID NO.20～22.
The structure of embodiment 4 humanization recombinant monoclonal antibodies expression vector
3 humanization variable region of light chain coded sequence design restriction enzyme sites embodiment 3 obtained are Kpn
I+Xho I, 5 variable region of heavy chain coded sequence design restriction enzyme sites are KpnI+AgeI, respectively with table
Reach carrier pUC57 to connect, with Kpn I+Age I, variable region of heavy chain coded sequence is carried from pUC57
The corresponding site being inserted into expression vector pJH16 is cut on body；Again can by light chain with Kpn I+Xho I
Change district cuts from pUC57 carrier and is inserted into corresponding positions in expression vector pJH16-H39E3.L1kappa
Point, obtains humanization recombinant monoclonal antibodies heavy chain and light chain expression vector.Light chain and the enzyme action of heavy chain
The result is shown in Fig. 5, Fig. 6, Fig. 7.
Result shows, digestion verification is all correct, by 1 shown in Fig. 5～gene order ho/h1/h2-in 4 roads
LA22 estimates that size is that 430bp cuts glue recovery；Vector gene sequence by 1 swimming lane shown in Fig. 6
PJH16-H39E3.L1kappa estimates that vector gene sequence pJH16 that size is 8.5kb and 2 swimming lanes is pre-
Meter 7kb, all cuts glue and reclaims；Gene order H0/H1/H2/H3/H4-by 2,3,4,5,6 roads shown in Fig. 7
LA22 heavy chain estimates that size is that about 550bp cuts glue recovery, and the pJH16 carrier by the 1st road is big simultaneously
The little 7kb fragment that is about cuts glue recovery.By the DNA sheet of the carrier cut out in gel and gene
Section Qiagen Gel Extraction Kit reclaims and obtains band.Connected by T4DNA linked system
At night, convert DH5a.Order-checking, BLAST comparison 100%, checking builds plasmid success.See Fig. 8.
The expression and purification of embodiment 5 Humanized anti-EGFR antibodies
PJH16-LA22 heavy chain, light chain chimeric antibody expression vector and the embodiment built by embodiment 2
The 4 pJH16-LA22 heavy chains built, light chain humanized antibody expression vector transfection Escherichia coli respectively
DH5a.It is inoculated in 100m1LB culture medium, conventionally cultivates.Results culture,
Isozygoty test kit extracting and purifying plasmid DNA by the UltraPure plasmid DNA of Qiagen company.By upper
The plasmid DNA stating purification uses liposome method test kit transfection 293F or CHO of Invitrogen company
Cell (handsome company of the U.S.), operates the description with reference to producer and carries out.
First 293F cell is carried out different light, the transfection of heavy chain plasmid combination, totally 20 groups of 293F winks
Time express.After cultivating 3 days, take culture supernatant, add in 96 orifice plates being surrounded by EGFR in advance, adopt
ELISA indirect method, preliminary assessment secretory antibody is used to combine the activity of EGFR.The part of above-mentioned 20 groups
Testing result is as shown in table 1 below.NC is using antibody diluent as negative control.
The different heavy chains of table 1 screening, the antibody activity evaluation result of light chain combination
Stable expression evaluates employing electrotransfection method transfection CHO cell, and at selective medium
(MTX is purchased to carry out MTX pressurization screening on Opti-CHO (U.S. handsome-opti-cho medium)
Sigma company), pressurize with 50nM, 100nM, 250nM these three gradient respectively, for
Often the cell after wheel pressurization carries out 7d titer determination, and assay method uses ELISA-double-antibody method true
The antibody production of engineering cell strain after the pressurization of fixed often step.After this process completes, limiting dilution assay is utilized to enter
Row monoclonal screens, and the method is mainly by cell is diluted bed board (96 orifice plate), at 37 DEG C
5%CO2Under the conditions of cultivate about 14 days after take 50 microlitres carry out antibody production primary dcreening operation (use ELISA-
Double antibodies sandwich sends out mensuration) the selection result is preferably carried out clone picking amplification culture.Part knot
Fruit is such as table 2: result shows, different heavy chains is all expressed with the combination of light chain h2, engineering cell strain
Create corresponding antibody (ELISA evaluation result data).
The different heavy chains of table 2 screening and the antibody ELISA evaluation result of light chain h2 combination
Antibody purification: utilize the protein A affinity chromatography post culture supernatant to above-mentioned 5 stable cell lines
It is directly separated purification and then obtains the Humanized monoclonal antibodies of the present invention.Result is as follows:
SDS-PAGE electrophoretic examinations proves, products therefrom purity is more than 90%.Result is shown in Figure 11.
The biological activity determination of embodiment 6 Humanized anti-EGFR antibodies
1, the Humanized anti-human epidermal growth factor of the Biacore measuring affinity detection present invention
Receptor antibody and the affinity of EGFR, apply BIAcore based on Applications of surface plasmon resonance
System have detected the combination that mLA22 and hLA22(contains heavy chain H3+ light chain h2) and recombined human table
The binding ability of skin growth factor receptor (EGFR), the results are shown in Table 3, and the adhesion of mLA22 is 2nM,
And hLA22(heavy chain H3+ light chain h2) adhesion be 2.3nM, both of which has reached 10-9, explanation
The Humanized anti-EGFR antibodies of the present invention is suitable with Mus source anti-egfr antibodies binding ability.
Table 3 Humanized anti-EGFR antibodies's affinity
2, flow cytometry collects the A431 cell (from ATCC) of EGFR high expressed, point
Not and after 20ug/mLA22 or hLA224 DEG C of incubation 60min, it is separately added into the anti-Mus of FITC labelling
Or anti-human two anti-(Jackson Lab), 4 DEG C are continued flow cytomery after incubation 60min.Result table
Bright, that mLA22 and hLA22(contains heavy chain H3+ light chain h2 combination) all can identify A431 cell
The EGFR on surface.Result is shown in Figure 12.
3, cell ELISA experiment 2 × 104Individual/hole A431 cell in 96 orifice plates, 37 DEG C, 5%CO2,
After DMEM culture fluid containing 10% hyclone is cultivated 24 hours, abandon culture medium, use with after PBS
After 5% milk powder is closed 1 hour, mLA22 and hLA22 being separately added into variable concentrations continues to hatch 1
Hour, it being subsequently adding anti-Mus and anti-human two and resist, incubated at room showed with after PBS wash clean after 1 hour
Color, OD450Reading.Result is shown in Figure 13.Result illustrates, mLA22 and hLA22 all can identify A431
The EGFR that cell is expressed, all reaches saturation value at about 4ug/ml, shows the people source that the present invention develops
Change antibody hLA22 suitable with the LA22 in Mus source on affinity.
2×104Individual/hole A431 cell in 96 orifice plates, 37 DEG C, 5%CO2, containing 10% hyclone
DMEM culture fluid cultivate after 24 hours, abandon culture medium, with after PBS with 5% milk powder closing 1
After hour, the hLA22 of the mLA22-HRP and different proportion that add 3ug/ml continues to hatch 1 hour,
Incubated at room developed the color with after PBS wash clean after 1 hour, OD450Reading.Result is shown in Figure 14.Result
Show, it is possible to the combination of the EGFR of hLA22 Competitive assays mLA22 and A431 cell surface, and
And both adhesions are suitable.
4, Cytostatic to tumor cell experiment inoculation 2 × 103Individual/hole A431 cell in 96 orifice plates,
37 DEG C, 5%CO2, after DMEM culture fluid containing 10% hyclone is cultivated 4 hours, change respectively
Become the serum-free DMEM(100ul/ hole of mLA22 and hLA22 containing variable concentrations), 37 DEG C,
5%CO2, after cultivating 4 days, mtt assay detection living cells quantity, calculate growth of tumour cell suppression ratio.
Growth of tumour cell suppression ratio (%)=(DMEM without antibody processes cell number one antibody treatment
Cell number) ÷ DMEM process cell number × 100% without antibody
Result is shown in Figure 15.Result shows, mLA22 and hLA22 all can suppress the increasing of A431 cell
Growing, and humanized hLA22 maintains the ability of mLA22 suppression tumor growth substantially, both press down
Effect processed is suitable.
Claims (6)
1. a Humanized anti-human EGFR monoclonal antibody, it is characterised in that its constant region of light chain, CH are the constant region of light chain of people's whole antibody immunoglobulin, CH respectively；Its variable region of light chain, variable region of heavy chain are respectively variable region of light chain and the variable region of heavy chain of humanization modified EGFR Mus source monoclonal antibody LA22, the chain variable region amino acid sequence of described EGFR Mus source monoclonal antibody LA22 is as shown in SEQ ID NO.2, heavy chain variable amino acid sequence is as shown in SEQ ID NO.1, and the described humanization modified FR district in variable region is carried out；
Further, the aminoacid sequence of its humanization modified variable region of light chain is as shown in SEQ ID NO.14, and the aminoacid sequence of variable region of heavy chain is as shown in SEQ ID NO.10.
2. the gene of antibody described in coding claim 1.
3. gene as claimed in claim 2, it is characterised in that its nucleotides sequence of the gene of encoded light chain variable region is classified as the DNA sequence as shown in SEQ ID NO.22；Its nucleotides sequence of the gene of encoding heavy chain variable region is classified as the DNA sequence as shown in SEQ ID NO.18.
4. contain the expression vector of gene described in claim 2.
5. the application in preparing the disease therapeuticing medicine with EGFR as target of the antibody described in claim 1.
6. contain medicine or the detectable of antibody described in claim 1.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410083224.3A CN104059148B (en) | 2013-03-18 | 2014-03-07 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
| PCT/CN2015/073801 WO2015131855A1 (en) | 2013-03-18 | 2015-03-06 | Humanised anti-human epidermal growth factor receptor antibody and application thereof |
| US15/124,288 US10611833B2 (en) | 2014-03-07 | 2015-03-06 | Humanized anti-human epidermal growth factor receptor antibody and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310086034.2 | 2013-03-18 | ||
| CN201310086034 | 2013-03-18 | ||
| CN201410083224.3A CN104059148B (en) | 2013-03-18 | 2014-03-07 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104059148A CN104059148A (en) | 2014-09-24 |
| CN104059148B true CN104059148B (en) | 2016-09-07 |
Family
ID=54062533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410083224.3A Active CN104059148B (en) | 2013-03-18 | 2014-03-07 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104059148B (en) |
| WO (1) | WO2015131855A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059148B (en) * | 2013-03-18 | 2016-09-07 | 回而生医药科技（北京）有限公司 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
| US10611833B2 (en) | 2014-03-07 | 2020-04-07 | Welson Pharmaceuticals, Inc. | Humanized anti-human epidermal growth factor receptor antibody and application thereof |
| CN110878122B (en) * | 2018-09-06 | 2023-07-28 | 上海张江生物技术有限公司 | Recombinant anti-PD-L1 monoclonal antibodies |
| CN111879923A (en) * | 2020-08-06 | 2020-11-03 | 深圳科隆生物新材料有限公司 | Kit capable of eliminating HAMA effect |
| CN115819587B (en) * | 2022-10-14 | 2023-06-09 | 北京东方百泰生物科技股份有限公司 | anti-NKG 2A monoclonal antibody and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5459061A (en) * | 1990-01-26 | 1995-10-17 | W. Alton Jones Cell Science Center, Inc. | Hybridomas producing monoclonal antibodies which specifically bind to continuous epitope on the human EGF receptor and compete with EGF for binding to the EGF receptor |
| CN101277716A (en) * | 2005-04-27 | 2008-10-01 | 回而生医药科技有限公司 | Antibodies for the treatment of cancers |
| CN101675075A (en) * | 2007-03-01 | 2010-03-17 | 西福根有限公司 | Recombinant anti-epidermal growth factor receptor antibody compositions |
| CN102325549A (en) * | 2009-03-31 | 2012-01-18 | 罗氏格黎卡特股份公司 | Treatment of cancer with umanized anti-egfr igg1 antibody and irinotecan |
| CN102753580A (en) * | 2009-10-28 | 2012-10-24 | 亚培生物医疗股份有限公司 | Anti-egfr antibodies and their uses |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059148B (en) * | 2013-03-18 | 2016-09-07 | 回而生医药科技（北京）有限公司 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
-
2014
- 2014-03-07 CN CN201410083224.3A patent/CN104059148B/en active Active
-
2015
- 2015-03-06 WO PCT/CN2015/073801 patent/WO2015131855A1/en active Application Filing
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5459061A (en) * | 1990-01-26 | 1995-10-17 | W. Alton Jones Cell Science Center, Inc. | Hybridomas producing monoclonal antibodies which specifically bind to continuous epitope on the human EGF receptor and compete with EGF for binding to the EGF receptor |
| CN101277716A (en) * | 2005-04-27 | 2008-10-01 | 回而生医药科技有限公司 | Antibodies for the treatment of cancers |
| CN101675075A (en) * | 2007-03-01 | 2010-03-17 | 西福根有限公司 | Recombinant anti-epidermal growth factor receptor antibody compositions |
| CN102325549A (en) * | 2009-03-31 | 2012-01-18 | 罗氏格黎卡特股份公司 | Treatment of cancer with umanized anti-egfr igg1 antibody and irinotecan |
| CN102753580A (en) * | 2009-10-28 | 2012-10-24 | 亚培生物医疗股份有限公司 | Anti-egfr antibodies and their uses |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2015131855A1 (en) | 2015-09-11 |
| CN104059148A (en) | 2014-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11466085B2 (en) | Anti-PD-L1 nanobody, coding sequence and use thereof | |
| CN107814845B (en) | Novel anti-PD-1 nano antibody and application thereof | |
| US20220002418A1 (en) | Anti-pd-l1/vegf bifunctional antibody and use thereof | |
| CN104059148B (en) | humanized anti-human epidermal growth factor receptor antibody and application thereof | |
| CN112794909B (en) | anti-TIGIT monoclonal antibody and application thereof | |
| CN101155832B (en) | Method for improving antibody | |
| CN107840891A (en) | The anti-MSLN antibody of high-affinity and its application | |
| CN109776678A (en) | A kind of humanization PD-L1 monoclonal antibody, preparation method and application | |
| CN112513089A (en) | anti-CD 73 antibody, antigen binding fragment thereof and application | |
| CN107840889A (en) | The anti-CD123 antibody of high-affinity and its application | |
| CN101165068B (en) | Monoclonal antibody for resisting HER2/ErbB2 antigen, preparation method and medicament composition thereof | |
| CN104098698B (en) | A kind of anti-cd 3 antibodies and its preparation method and application | |
| CN101701039A (en) | Variable regions of light chains and heavy chains of FMU-EPCAM-2A9 monoclonal antibodies | |
| TW202229353A (en) | Anti-TSPAN8-anti-CD3 Bispecific Antibody and Anti-TSPAN8 Antibody | |
| CN108727488B (en) | Preparation and application of anti-norovirus GII.17 monoclonal antibody | |
| CN110396131B (en) | ErbB2 single-chain antibody, chimeric antigen receptor targeting human ErbB2, recombinant vector, recombinant cell and application | |
| CN101864398B (en) | Monoclonal antibody of anti-gonadotropin-releasing hormone receptor and application thereof | |
| CN106008708B (en) | A kind of monoclonal antibody and purposes of viruses of human hepatitis B's X protein | |
| CN108148137B (en) | B7H4/1E10 monoclonal antibody and application thereof | |
| CN105646712B (en) | Monoclonal antibody and its application | |
| CN104650228A (en) | Full humanized HER2 antibody as well as coding gene and application thereof | |
| CN101817882B (en) | Light-chain variable region and heavy-chain variable region of FMU-EPCAM-4E4 monoclonal antibody | |
| CN101899112A (en) | Light chain and heavy chain variable region of FMU-EPCAM-2D7 monoclonal antibody | |
| CN111349157B (en) | Monoclonal antibody of cadherin 6 and application thereof | |
| CN102585004B (en) | AEG-1 (Astrocyte Elevated Gene-1)/1E3 monoclonal antibody with high affinity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |